WO2001046437A1 - Nouveau polypeptide, region de liaison d'arn-eucaryote rnp-1-21, et polynucleotide codant pour ce polypeptide - Google Patents

Nouveau polypeptide, region de liaison d'arn-eucaryote rnp-1-21, et polynucleotide codant pour ce polypeptide Download PDF

Info

Publication number
WO2001046437A1
WO2001046437A1 PCT/CN2000/000546 CN0000546W WO0146437A1 WO 2001046437 A1 WO2001046437 A1 WO 2001046437A1 CN 0000546 W CN0000546 W CN 0000546W WO 0146437 A1 WO0146437 A1 WO 0146437A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
polynucleotide
binding region
rnp
eukaryotic rna
Prior art date
Application number
PCT/CN2000/000546
Other languages
English (en)
Chinese (zh)
Inventor
Yumin Mao
Yi Xie
Original Assignee
Fudan University
Shanghai Bio Door Gene Technology Ltd.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Fudan University, Shanghai Bio Door Gene Technology Ltd. filed Critical Fudan University
Priority to AU23401/01A priority Critical patent/AU2340101A/en
Publication of WO2001046437A1 publication Critical patent/WO2001046437A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • the present invention belongs to the field of biotechnology. Specifically, the present invention describes a novel polypeptide, eukaryotic RNA binding region RNP-1 21, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a method and application for preparing the polynucleotide and polypeptide.
  • the eukaryotic RNA binding region RNP has two regions that are highly conserved. One is a hydrophobic fragment containing six amino acid residues (called RNP-2 mo tif); the other is the octapeptide MOTIF (called RNP-1 or RNP- -CS), is the most conservative part of the entire area.
  • RNP-2 mo tif hydrophobic fragment containing six amino acid residues
  • RNP-1 or RNP- -CS the octapeptide MOTIF
  • the typical eukaryotic RNA binding region RNP-1 is usually composed of 8 amino acids, and its sequence structure is as follows: [RK] — G— ⁇ EDRKHPCG ⁇ — [AGSCI] — [FY] ⁇ [LIVA] — X — [FYLM].
  • the aromatic amino acid residues are related to the insertion of RNA between bases, and the nearby positively charged residues facilitate the approach and binding of the corresponding negatively charged nucleic acid phosphate backbone.
  • RNA binding region is of great significance for high-affinity RNA binding.
  • heterologous nuclear protein hnRNP
  • elF-4B eukaryotic protein synthesis initiation factor 4B
  • RNA binding region RNP-1 21 protein plays an important role in important body functions as described above, and it is believed that a large number of proteins are involved in these regulatory processes, there has been a need in the art to identify more eukaryotic RMs involved in these processes. Binding region RNP-1 21 protein, in particular the amino acid sequence of this protein is identified. The isolation of the new eukaryotic RNA-binding region RNP-1 21 protein encoding gene also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for developing diagnostic and / or therapeutic drugs, so isolating its coding DNA is important. Object of the invention
  • Another object of the invention is to provide a polynucleotide encoding the polypeptide.
  • Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding a eukaryotic RNA binding region RNP-121.
  • Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding a eukaryotic RNA binding region RNP-121.
  • Another object of the present invention is to provide a method for producing eukaryotic RNA-binding region RNP-121.
  • Another object of the present invention is to provide an antibody against the polypeptide of the present invention, eukaryotic RNA binding region RNP-1 21.
  • Another object of the present invention is to provide mimetic compounds, antagonists, agonists, and inhibitors against the polypeptide of the present invention, eukaryotic RNA binding region RNP-121.
  • Another object of the present invention is to provide a method for diagnosing and treating a disease associated with abnormality of eukaryotic RNA-binding region RNP-1 21. Summary of invention
  • the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
  • the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
  • sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 144-716 in SEQ ID NO: 1; and (b) having a sequence of 1-2586 in SEQ ID NO: 1 Sequence of bits.
  • the invention further relates to a vector, in particular an expression vector, containing the polynucleotide of the invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; and a method comprising culturing said Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
  • a vector in particular an expression vector, containing the polynucleotide of the invention
  • a host cell genetically engineered with the vector including a transformed, transduced or transfected host cell
  • a method comprising culturing said Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
  • the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
  • the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of eukaryotic RNA binding region RNP-1 21 protein, which comprises utilizing the polypeptide of the invention.
  • the invention also relates to compounds obtained by this method.
  • the invention also relates to a method for detecting a disease or susceptibility to disease associated with abnormal expression of RNP-1 2 1 protein in eukaryotic RNA binding region in vitro, which comprises detecting mutations in the polypeptide or a sequence encoding a polynucleotide thereof in a biological sample. Or detecting the amount or biological activity of a polypeptide of the invention in a biological sample.
  • the invention also relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
  • the present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention for the preparation of a medicament for treating cancer, developmental disease or immune disease or other diseases caused by abnormal expression of eukaryotic RNA binding region RNP-1 21.
  • FIG. 1 is a comparison diagram of amino acid sequence homology of the eukaryotic RNA-binding region RNP-1 21 of the present invention with 52 amino acids in 45-96 and domain eukaryotic RNA-binding region RNP-1 characteristic proteins.
  • the upper sequence is the eukaryotic RNA-binding region RNP-1 21, and the lower sequence is the eukaryotic RNA-binding region RNP-1 characteristic protein domain.
  • FIG. 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of the isolated eukaryotic RNA-binding region RNP-1 21 (21Kda) is the molecular weight of the protein.
  • the arrow indicates the isolated protein band.
  • Nucleic acid sequence refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
  • amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
  • amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
  • a protein or polynucleotide “variant” refers to an amino acid sequence having one or more amino acids or nucleotide changes, or a polynucleotide sequence encoding it. The changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence. Variants can have "conservative" changes, where substitutions Amino acids have similar structural or chemical properties as the original amino acids, such as replacing isoleucine with leucine. Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
  • “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
  • Insertion means that a change in the amino acid sequence or nucleotide sequence results in an increase in one or more amino acids or nucleotides compared to a molecule that exists in nature.
  • Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
  • Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
  • immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response and to bind specific antibodies in a suitable animal or cell.
  • An "agonist” refers to a molecule that, when bound to the eukaryotic RNA-binding region RNP-1 21, causes a change in the protein to regulate the activity of the protein.
  • An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that can bind to the eukaryotic RNA-binding region RNP-121.
  • Antagonist refers to a molecule that can block or regulate the biological or immunological activity of the eukaryotic RNA-binding region RNP-1 21 when it binds to the eukaryotic RM-binding region RNP-1 21.
  • Antagonists and inhibitors can include proteins, nucleic acids, carbohydrates or any other molecule that can bind to eukaryotic RNA-binding region RNP-1 21.
  • Regulatory refers to a change in the function of the eukaryotic RNA binding region RNP-1 21, including an increase or decrease in protein activity, a change in binding characteristics, and any other biological properties and functions of the eukaryotic RNA binding region RNP-1 21. Or changes in immune properties.
  • substantially pure means substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated.
  • Those skilled in the art can purify the eukaryotic RNA-binding region RNP-1 21 using standard protein purification techniques.
  • the substantially pure eukaryotic RNA-binding region RNP-1 21 produces a single main band on a non-reducing polyacrylamide gel.
  • the purity of the eukaryotic RM binding region RNP-1 21 polypeptide can be analyzed by amino acid sequence.
  • Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
  • sequence C-T-G-A
  • complementary sequence G-A-C-T
  • the complementarity between two single-stranded molecules can be partial or complete.
  • the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
  • “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
  • Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. The inhibition of such hybridization can be detected by performing hybridization (Southern blotting or Nor thern blotting, etc.) under conditions of reduced stringency.
  • Substantially homologous sequences or hybridization probes can compete and inhibit completely homologous sequences from Binding of target sequences under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.
  • Percent identity refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALIGN program (Lasergene sof tware package, DNASTAR, Inc., Madi son Wis.). The MEGALIGN program can compare two or more sequences according to different methods, such as the Clus ter method (Hi ggins, DG and PM Sharp (1988) Gene 73: 237-244). The Clus ter method will check the distance between all pairs by Groups of sequences are arranged in clusters. The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula: The number of matching residues between sequence ⁇ and sequence S X 1 l ⁇ o ⁇ o
  • the number of residues in sequence ⁇ -the number of spacer residues in sequence ⁇ -the number of spacer residues in sequence ⁇ can also be determined by the Clus ter method or by a method known in the art such as Jotun Hein (Hein J (1990) Methods in enzymology 183: 625-645).
  • Similarity refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
  • Amino acids used for conservative substitutions for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
  • Antisense refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence.
  • the "antisense strand” refers to a nucleic acid strand that is complementary to the “sense strand”.
  • Derivative refers to HFP or a chemical modification of its nucleic acid. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
  • Antibody refers to a complete antibody molecule and its fragments, such as Fa,? (') 2 and?, Which can specifically bind to the epitope of the eukaryotic RNA binding region RNP-121.
  • a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
  • isolated refers to the removal of a substance from its original environment (for example, its natural environment if it occurs naturally).
  • a naturally occurring polynucleotide or polypeptide is not isolated when it is present in a living animal, but the same polynucleotide or polypeptide is shared with some or all of the natural system. Separated matter is separated.
  • Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not a component of its natural environment, they are still isolated.
  • isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
  • polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances existing in the natural state. .
  • isolated eukaryotic RNA-binding region RNP-1 21 refers to eukaryotic RNA-binding region RNP-1 21 that is substantially free of other proteins, lipids, sugars, or other substances with which it is naturally associated. Those skilled in the art can purify the eukaryotic RNA-binding region RNP-1 21 using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of the eukaryotic RNA-binding region RNP-1 21 polypeptide can be analyzed by amino acid sequence.
  • the present invention provides a new polypeptide, eukaryotic R-binding region RNP-1 21, which is basically composed of the amino acid sequence shown in SEQ ID NO: 2.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
  • the polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques. Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude initial methionine residues.
  • the invention also includes fragments, derivatives and analogs of the eukaryotic RNA-binding region RNP-121.
  • fragment refers to a polypeptide that substantially maintains the same biological function or activity of the eukaryotic RNA-binding region RNP-1 21 of the present invention.
  • the fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution
  • the amino acid may or may not be encoded by a genetic codon; or ( ⁇ ) such a type in which a group on one or more amino acid residues is substituted by another group to include a substituent; or (III) such One, in which the mature polypeptide is fused to another compound (such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol); or (IV) such a polypeptide sequence in which the additional amino acid sequence is fused into the mature polypeptide ( Such as the leader sequence or secreted sequence or the sequence used to purify this polypeptide or protease sequence) As explained herein, such fragments, derivatives and analogs are considered to be within the knowledge of those skilled in the art.
  • the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the polynucleotide sequence of the present invention includes a nucleoside of SEQ ID NO: 1 Acid sequence.
  • the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a polynucleotide sequence with a total length of 2586 bases, and its open reading frames 144-716 encode 190 amino acids.
  • This polypeptide has the characteristic sequence of the eukaryotic RNA binding region RNP-1 characteristic protein, and it can be deduced that the eukaryotic RNA binding region RNP-1 21 has the structure and function represented by the eukaryotic RNA binding region RNP-1 characteristic protein.
  • the polynucleotide of the present invention may be in the form of DNA or RM.
  • DNA forms include cDNA, genomic D, or synthetic DNA.
  • DNA can be single-stranded or double-stranded.
  • DNA can be coding or non-coding.
  • the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
  • a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
  • the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
  • polynucleotide encoding a polypeptide refers to a polynucleotide that includes the polypeptide and a polynucleotide that includes additional coding and / or non-coding sequences.
  • the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
  • This polynucleotide variant can be a naturally occurring allelic variant or a non-naturally occurring variant.
  • These nucleotide variants include substitution variants, deletion variants, and insertion variants.
  • an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
  • the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity between the two sequences).
  • the present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions.
  • “strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60 ° C; or (2) Add a denaturant during hybridization, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% Fico ll, 42 ° C, etc .; or (3) only between the two sequences Hybridization occurs only when the identity is at least 95%, and more preferably 97%.
  • the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
  • nucleic acid fragments that hybridize to the sequences described above.
  • a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 nuclei. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques (such as PCR) to identify and / or isolate polynucleotides encoding the eukaryotic RM-binding region RNP-1 21.
  • polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
  • the specific polynucleotide sequence encoding the eukaryotic RNA-binding region RNP-1 21 of the present invention can be obtained by various methods.
  • polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
  • the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.
  • genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences.
  • the standard method for isolating the cDNA of interest is to isolate mRM from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library.
  • mRNA extraction There are many mature techniques for mRNA extraction, and kits are also commercially available (Qiagene).
  • the construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989).
  • Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
  • genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DNA-RNA hybrids; (2) the presence or absence of marker gene functions; (3) determination of the level of transcripts of eukaryotic RNA-binding region RNP-1 21 (4) Detecting protein products expressed by genes through immunological techniques or measuring biological activity. The above methods can be used alone or in combination.
  • the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
  • the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
  • the probe used here is usually a DNA sequence chemically synthesized based on the gene sequence information of the present invention.
  • the genes or fragments of the present invention can of course be used as probes.
  • DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
  • the protein product of the RNP-1 21 gene expression in the eukaryotic RNA binding region can be detected by immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA).
  • immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA).
  • a method of amplifying DNA / RNA by PCR is preferably used to obtain the gene of the present invention.
  • the RACE method RACE- rapid cDNA end amplification method
  • the primers can be appropriately selected based on the polynucleotide sequence information of the present invention disclosed herein, and can be synthesized by conventional methods.
  • the amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
  • polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be measured by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDM sequence, sequencing needs to be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
  • the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using the eukaryotic RNA binding region RNP-1 21 coding sequence, and the recombinant technology to produce the Said method of polypeptide.
  • the polynucleotide sequence encoding the eukaryotic RNA binding region RNP-1 21 can be inserted into a vector to form a recombinant vector containing the polynucleotide of the present invention.
  • vector refers to bacterial plasmids, bacteriophages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors known in the art.
  • Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al.
  • any plasmid and vector can be used to construct a recombinant expression vector.
  • An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
  • Methods known to those skilled in the art can be used to construct an expression vector containing a DNA sequence encoding a eukaryotic RNA binding region RNP-1 21 and appropriate transcription / translation regulatory elements. These methods include in vitro recombinant DNA technology, DNA synthesis technology, and in vivo recombination technology (Sambroook, etal. Mo l ecu l ar Cl on ing, a Labora tory Manua l, Co ld Spr ing Harbor Labora tory. New York, 1989) 0
  • the DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis. Representative examples of these promoters are: the l ac or trp promoter of E.
  • the expression vector also includes a ribosome binding site and a transcription terminator for translation initiation. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Examples include 100 to 270 base pairs of SV40 enhancer on the late side of the origin, polyoma enhancer and adenovirus enhancer on the late side of the origin of replication, etc.
  • the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • GFP fluorescent protein
  • tetracycline or ampicillin resistance for E. coli.
  • a polynucleotide encoding a eukaryotic RM binding region RNP-1 21 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to form a genetically engineered host containing the polynucleotide or the recombinant vector.
  • the term "host cell” refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E.
  • coli Streptomyces
  • bacterial cells such as Salmonella typhimurium
  • fungal cells such as yeast
  • plant cells such as fly S2 or Sf 9
  • animal cells such as CH0, COS, or Bowes s melanoma cells, etc. .
  • Transformation of a host cell with a DM sequence according to the present invention or a recombinant vector containing the DNA sequence can be performed by conventional techniques well known to those skilled in the art.
  • the host is a prokaryote such as E. coli
  • competent cells capable of DNA uptake can be in the exponential growth phase were harvested, treated with CaC l 2 method used in steps well known in the art. The alternative is to use MgC l 2 .
  • transformation can also be performed by electroporation.
  • the host is a eukaryotic organism, the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
  • the polynucleotide sequence of the present invention can be used to express or produce a recombinant eukaryotic RNA binding region RNP-1 21 (Scence, 1984; 224: 14 31). Generally there are the following steps:
  • the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
  • a suitable method such as temperature conversion or chemical induction
  • the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell.
  • Physical, chemical, and other properties can be used for various separation methods if required Isolation and purification of recombinant proteins. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
  • polypeptides of the present invention can be directly used in the treatment of diseases, for example, they can be used to treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection, and immunological diseases.
  • Heterologous nucleoproteins, small nucleoproteins, RNA precursors and mRM-binding proteins, as well as Drosophila sex-determining protein lethal factor (Sxl), Drosophila sex-determining protein conversion gene-2 (Tra-2), etc., are all Eukaryotic proteins involved in binding single-stranded RMs, which contain one or more copies of RNA binding sites.
  • the eukaryotic RM binding region RNP-1 is highly conservative.
  • the aromatic amino acid residues are related to the insertion of RM between bases.
  • RNA binding region The interactions between many proteins involved in RNA processing play an important role in the metabolic process of cells, and the RNA binding region is of great significance for high-affinity RNA binding.
  • heterologous nuclear protein hnRNP
  • eukaryotic protein synthesis initiation factor 4B elF-4B
  • the abnormal expression of RNA-binding proteins can cause genetic disruption in humans and spinal impulse.
  • the polypeptide containing the eukaryotic RNA binding region RNP-1 of the present invention has the above functions.
  • the abnormal expression of the eukaryotic RNA-binding region RNP-1 21 of the present invention will produce various diseases, especially developmental disorders, various tumors and cancers and immune system diseases. These diseases include, but are not limited to:
  • Embryonic developmental disorders congenital abortion, cleft palate, facial oblique fissure, limb absentness, limb differentiation disorder, gastrointestinal atresia or stenosis, hyaline membrane disease, atelectasis, polycystic kidney disease, ectopic kidney, double ureter, cryptorchidism , Congenital inguinal hernia, double uterus, vaginal atresia, hypospadias, hermaphroditism, atrial septal defect, ventricular septal defect, pulmonary stenosis, arterial duct occlusion, neural tube defect, congenital hydrocephalus, iris defect, congenital Cataract, congenital glaucoma or cataract, congenital deafness, auricle deformity
  • Tumors of various tissues gastric cancer, liver cancer, lung cancer, esophageal cancer, breast cancer, leukemia, lymphoma, thyroid tumor, uterine fibroids, neuroblastoma, astrocytoma, ependymoma, glioblastoma, Colon cancer, malignant histiocytosis, melanoma, teratoma, sarcoma, adrenal cancer, bladder cancer, bone cancer, osteosarcoma, myeloma, bone marrow cancer, brain cancer, uterine cancer, endometrial cancer, gallbladder cancer, colon Cancer, thymic tumor, nasal cavity and sinus tumor, nasopharyngeal cancer, laryngeal cancer, tracheoma, pleural mesothelioma, fibroid, fibrosarcoma, lipoma, liposarcoma, leiomyoma
  • inflammations such as allergic reactions, adult respiratory distress syndrome, pulmonary eosinophilia, wind Wet-like arthritis, rheumatoid arthritis, osteoarthritis, cholecystitis, glomerulonephritis, dermatomyositis, polymyositis, Addison's disease, telangiectasia, B l oom Syndrome, xeroderma pigmentosa, certain hereditary, hematological, and immune disorders.
  • the abnormal expression of the eukaryotic RNA-binding region RNP-1 21 of the present invention will also produce certain hereditary, blood diseases, immune system diseases, and the like.
  • the polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat various diseases, especially developmental disorders, various tumors and cancers, and immune system diseases. Sexual, hematological and immune system diseases.
  • the invention also provides methods of screening compounds to identify agents that increase (agonist) or suppress (antagonist) the eukaryotic RNA binding region RNP-1 21.
  • Agonists increase the eukaryotic RNA-binding region RNP-1 2 1 to stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
  • a mammalian cell or a membrane preparation expressing a eukaryotic RM-binding region RNP-1 21 can be cultured together with a labeled eukaryotic RNA-binding region RNP-1 21 in the presence of a drug. The ability of the drug to increase or block this interaction is then determined.
  • Antagonists of the eukaryotic RNA-binding region RNP-1 21 include antibodies, compounds, receptor deletions, and the like that have been screened. Antagonists of the eukaryotic RNA binding region RNP-1 2 1 can bind to the eukaryotic RNA binding region RNP-1 21 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide to make the Peptides cannot perform biological functions.
  • the eukaryotic RNA-binding region RNP-1 21 can be added to the bioanalytical assay by measuring the effect of the compound on the interaction between the eukaryotic RNA-binding region RNP-1 21 and its receptor. Determine if the compound is an antagonist.
  • Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds.
  • Polypeptide molecules capable of binding to eukaryotic RM binding region RNP-1 21 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. During screening, the RNP-1 21 molecule in the eukaryotic RNA-binding region should generally be labeled.
  • the present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies.
  • the invention also provides antibodies directed against the eukaryotic RNA-binding region RNP-1 21 epitope. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by Fab expression libraries.
  • Polyclonal antibodies can be produced by injecting eukaryotic RM-binding region RNP-1 21 directly into immunized animals (such as rabbits, mice, rats, etc.).
  • immunized animals such as rabbits, mice, rats, etc.
  • a variety of adjuvants can be used to enhance the immune response, including but not Limited to Freund's adjuvant and the like.
  • Techniques for preparing monoclonal antibodies to eukaryotic RNA-binding region RNP-1 21 include, but are not limited to, hybridoma technology (Kohler and Milstein. Nature, 1975, 256: 495-497), triple tumor technology, and human beta-cell hybridoma technology , EBV-hybridoma technology, etc.
  • Chimeric antibodies that bind human constant regions and non-human-derived variable regions can be produced using existing techniques (Morrison et al, PNAS, 1985, 81: 6851).
  • the existing technology for producing single-chain antibodies (US Pat No. 4946778) can also be used to produce single-chain antibodies against the eukaryotic RNA binding region RNP-1 21.
  • Antibodies against eukaryotic RNA-binding region RNP-1 21 can be used in immunohistochemistry to detect eukaryotic RNA-binding region RNP-1 21 in biopsy specimens.
  • Monoclonal antibodies that bind to eukaryotic RNA-binding region RNP-1 21 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
  • Antibodies can also be used to design immunotoxins that target a particular part of the body.
  • eukaryotic RNA binding region RNP-1 21 high affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
  • a common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
  • This hybrid antibody can be used to kill the eukaryotic RNA binding region RNP-1 21 Positive cells.
  • the antibodies of the present invention can be used to treat or prevent diseases related to the eukaryotic RNA binding region RNP-1 21.
  • the proper dose of antibody can stimulate or block the production or activity of RNP-1 21 in eukaryotic RNA binding region.
  • the invention also relates to a diagnostic test method for quantitatively and locally detecting the level of RNP-1 21 in a eukaryotic RNA binding region.
  • tests are well known in the art and include FISH assays and radioimmunoassays.
  • the level of RNP-1 21 in eukaryotic RNA-binding region detected in the test can be used to explain the importance of RNP-1 21 in eukaryotic RNA-binding region in various diseases and to diagnose RNP-1 21 in eukaryotic RNA-binding region. A working disease.
  • polypeptide of the present invention can also be used for peptide mapping analysis.
  • the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
  • Polynucleotides encoding the eukaryotic RNA-binding region RNP-1 21 can also be used for a variety of therapeutic purposes.
  • Gene therapy technology can be used to treat abnormal cell proliferation, development or metabolism caused by the non-expression or abnormal / inactive expression of eukaryotic RNA-binding region RNP-1 21.
  • Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated eukaryotic RNA-binding region RNP-1 21 to inhibit endogenous eukaryotic RNA-binding region RNP-1 21 activity.
  • a variant eukaryotic RNA-binding region RNP-1 21 can It is a shortened eukaryotic RNA-binding region RNP-1 2 1 lacking a signaling domain. Although it can bind to downstream substrates, it lacks signaling activity. Therefore, the recombinant gene therapy vector can be used to treat diseases caused by abnormal expression or activity of RNP-1 21 in eukaryotic RNA binding region.
  • Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to transfer a polynucleotide encoding a eukaryotic RM-binding region RNP-1 21 into a cell.
  • a method for constructing a recombinant viral vector carrying a polynucleotide encoding a eukaryotic RNA-binding region RNP-1 21 can be found in the existing literature (Sambrook, eta l.).
  • the polynucleotide encoding the eukaryotic RNA binding region RNP-1 2 1 can be packaged into liposomes and transferred into cells.
  • Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
  • a vector such as a virus, phage, or plasmid
  • Oligonucleotides including antisense RNA and DNA
  • ribozymes that inhibit the eukaryotic RNA binding region RNP-1 21 mRNA are also within the scope of the present invention.
  • a ribozyme is an enzyme-like RM molecule that specifically decomposes specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation.
  • Antisense RNA, DNA, and ribozymes can be obtained using any existing RNA or DNA synthesis technology, such as solid-phase phosphoramidite chemical synthesis to synthesize oligonucleotides.
  • Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA. This DNA sequence has been integrated downstream of the vector's RNA polymerase promoter. In order to increase the stability of the nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the linkage between ribonucleosides using phosphate thioester or peptide bonds instead of phosphodiester bonds.
  • the polynucleotide encoding the eukaryotic RNA-binding region RNP-1 1 21 can be used for diagnosis of diseases related to the eukaryotic RNA-binding region NP-1 2 1.
  • the polynucleotide encoding the eukaryotic RNA binding region RNP-1 21 can be used to detect the expression of the eukaryotic RNA binding region RNP-1 21 or the abnormal expression of the eukaryotic RNA binding region RNP-1 21 in a disease state.
  • the DM sequence encoding the eukaryotic RNA-binding region RNP-1 21 can be used to hybridize biopsy specimens to determine the expression status of the eukaryotic RNA-binding region RNP- 1 2 1.
  • Hybridization techniques include Southern blotting, Northern blotting, and in situ hybridization. These techniques and methods are all mature and open technologies, and related kits are commercially available. Part or all of the polynucleotides of the present invention can be used as probes to be fixed on a microarray (Microray) or a DNA chip (also known as a "gene chip") for analyzing differential expression analysis of genes and genes in tissues diagnosis.
  • the eukaryotic RNA-binding region RNP-1 21 specific primers can be used to perform in vitro amplification of RNA-polymerase chain reaction (RT-PCR) to detect the eukaryotic RNA-binding region RNP-1 21 transcription product.
  • Detecting mutations in the RNP-1 21 gene in eukaryotic RNA binding regions can also be used to diagnose eukaryotic RNA binding Regional RNP-1 21 related diseases.
  • Eukaryotic RNA-binding region RNP-1 21 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type eukaryotic RNA-binding region RNP-1 21 DNA sequence. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression, so Northern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
  • sequences of the invention are also valuable for chromosome identification. This sequence will specifically target a specific position on a human chromosome and can hybridize to it. Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for marking chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DNA sequences on a chromosome.
  • PCR primers (preferably 15-35bp) are prepared from the cDNA, and the sequences can be located on the chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
  • PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
  • oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
  • Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.
  • Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step.
  • FISH Fluorescent in situ hybridization
  • cDNA or genomic sequences between the affected and unaffected individuals need to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in the chromosome, such as deletions or translocations that are visible at the chromosomal level or detectable using cDNA sequence-based PCR. Based on the resolution capabilities of current physical mapping and gene mapping technologies, cDNAs that are accurately mapped to disease-related chromosomal regions can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping capability and every 20kb corresponds to a gene).
  • the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
  • suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
  • the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
  • the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell.
  • the polypeptides of the invention can be used in combination with other therapeutic compounds.
  • the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
  • the eukaryotic RNA-binding region RNP-1 21 is administered in an amount effective to treat and / or prevent a specific indication.
  • the amount and range of eukaryotic RNA-binding region RNP-1 21 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician. Examples
  • Total human fetal brain RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform.
  • Poly (A) mRNA was isolated from total RNA using Quik mRNA Isolat ion Kit (product of Qiegene). 2ug poly (A) mRNA is reverse transcribed to form cDNA.
  • a Smart cDNA cloning kit (purchased from Clontech) was used to orient the cDNA fragment into the multicloning site of the pBSK (+) vector (Clontech) to transform DH5 ⁇ to form a cD library.
  • the sequence of the eukaryotic RNA binding region RNP-1 21 of the present invention and the protein sequence encoded by the same were used in a profile scan program (Basi c local alignment search tool) in GCG [Al tschul, SF et al. J. Mol. Biol .1990; 215: 403-10], domain analysis in prosite and other databases.
  • the eukaryotic RM-binding region RNP-1 21 of the present invention is homologous with the characteristic protein of the domain eukaryotic R-binding region RNP-1 at 45-96. The results of the homology are shown in FIG. ; Threshold is 6.53.
  • Example 3 Cloning of the gene encoding the eukaryotic RNA binding region RNP-1 21 by RT-PCR
  • the total RNA from fetal brain cells was used as a template, and oligo-dT was used as a primer for reverse transcription reaction to synthesize cDM. After purification by Qiagene's kit , Using the following primers for PCR amplification:
  • Primerl 5'- GGTAACGCGTCACGGGCGGCCTGG -3 '(SEQ ID NO: 3)
  • Primer2 5- GTCTTACATTTATTCACACAGAGG -3 '(SEQ ID NO: 4)
  • Primerl is a forward sequence located at the 5th end of SEQ ID NO: 1, starting at lbp;
  • Primer2 is the 3 'end reverse sequence in SEQ ID NO: 1.
  • Amplification conditions 50 mmol / L KC1, 10 mmol / L Tris-HC1, pH 8.5, 1.5 mmol / L MgCl 2 , 200 ⁇ mol / L dNTP, lOpmol primer, 1U in a reaction volume of 50 ⁇ 1 Taq DNA polymerase (Clontech).
  • the reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) for 25 cycles under the following conditions: 94 ° C 30sec; 55 ° C 30sec; 72. C 2min.
  • ⁇ -actin was set as a positive control and template blank was set as a negative control.
  • the amplified product was purified using a QIAGEN kit and ligated to a PCR vector (Invitrogen product) using a TA cloning kit.
  • DNA sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as 1-2586bp shown in SEQ ID NO: 1.
  • Example 4 Northern blot analysis of the expression of the RNP-1 21 gene in eukaryotic RNA binding regions Total RNA was extracted by a one-step method [Anal. Biochem 1987, 162, 156-159]. This method involves acid guanidinium thiocyanate phenol-chloroform extraction.
  • the tissue is homogenized with 4M guanidine isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 time volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1 ) And centrifuge after mixing. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water. Use 20 g RNA in 20 mM 3- (N- Morpholine) Propanesulfonic acid (pH 7.0)-5 mM sodium acetate-ImM EDTA-2.
  • 32 P dATP labeled probe 32 P- DM prepared by the random primer Method - with cc.
  • the DNA probe used was the sequence (144bp to 716bp) of the RNP-1 21 coding region of the PCR-amplified eukaryotic RM binding region shown in FIG. 1.
  • a 32P-labeled probe (about 2 x 10 6 cpm / ml) was hybridized with a nitrocellulose membrane to which RM was transferred at 42 ° C overnight in a solution containing 50% formamide-25mM KH 2 P0 4 (pH7.
  • Example 5 In vitro expression, isolation and purification of the recombinant eukaryotic RNA binding region RNP-1 21 Based on the sequence of the coding region shown in SEQ ID NO: 1 and FIG. 1, a pair of specific amplification primers were designed. The sequences are as follows:
  • Pr imer3 5'- CCCCATATGATGGAAGCAGAAACCAAAACTCTTC -3 '(Seq ID No: 5)
  • Pr imer4 5'- CATGGATCCTCATCTTCGAGATTTCCATGCTGTT -3' (Seq ID No: 6)
  • the restriction sites for Mel and BamHI correspond to the expression vector plasmid pET-28b (+) (Novagen, Ca. No. 69865. 3) Selective endonuclease site.
  • PCR was performed using the pBS-0463c08 plasmid containing the full-length target gene as a template.
  • the PCR reaction conditions were as follows: a total volume of 50 ⁇ 1 containing 10 pg of pBS-0463c08 plasmid, primers Primer-3 and Primer-4 were 1 Opmo 1 and Advantage po lymerase Mix (Clontech) 1 ⁇ 1. Cycle parameters: 94. C 20s, 60 ° C 30s, 68. C 2 min, a total of 25 cycles. Ndel and BamHI were used to double digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase. The ligated product was transformed into E.
  • a peptide synthesizer (product of PE company) was used to synthesize the following eukaryotic RNA-binding region RNP-1 21-specific peptides:
  • a titer plate coated with a 15 g / ml bovine serum albumin peptide complex was used as an ELISA to determine antibody titers in rabbit serum.
  • Total IgG was isolated from antibody-positive rabbit serum using protein A-Sepharose.
  • the peptide was bound to a cyanogen bromide-activated Sephar 0 se4B column, and anti-peptide antibodies were separated from total IgG by affinity chromatography.
  • the immunoprecipitation method proved that the purified antibody could specifically bind to the eukaryotic RNA-binding region RNP-1 21.
  • Example 7 Application of the polynucleotide fragment of the present invention as a hybridization probe
  • Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
  • the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
  • the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
  • the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method.
  • Filter hybridization methods include dot blotting, Southern blotting, Northern blotting, and copying methods. They all use the same steps of hybridization after fixing the polynucleotide sample to be tested on the filter.
  • the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer, so that the non-specific binding site of the sample on the filter is saturated with the carrier and the synthetic polymer.
  • the pre-hybridization solution is then replaced with a hybridization buffer containing the labeled probe and incubated to hybridize the probe to the target nucleic acid.
  • the unhybridized probes are removed by a series of membrane washing steps.
  • This embodiment utilizes higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals.
  • the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
  • the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
  • the dot blot method is used to fix the sample on the filter membrane. Needle-to-sample hybridization has the strongest specificity and is retained.
  • oligonucleotide fragments for use as hybridization probes from the polynucleotide SEQ ID NO: 1 of the present invention should follow the following principles and several aspects to be considered:
  • the preferred range of probe size is 18-50 nucleotides
  • GC content is 30% _70%, non-specific hybridization increases when it exceeds;
  • Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements The regions are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, the primary probe should not be used;
  • Probe 1 (probel), which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt)
  • Probe 1 which belongs to the second type of probe, is equivalent to the replacement mutant sequence of the gene fragment of SEQ ID NO: 1 or its complementary fragment (41Nt):
  • PBS phosphate buffered saline
  • step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
  • NC membrane nitrocellulose membrane
  • the 32 P-Probe (the second peak is free ⁇ - 32 P-dATP) to be prepared.
  • the sample membrane was placed in a plastic bag, and 3-10 mg of prehybridization solution (lOxDenhardt's; 6xSSC, 0.1 mg / ml CT DNA (calf thymus DM)) was added. After the bag was sealed, it was shaken in a 68 ° C water bath for 2 hours.
  • prehybridization solution lOxDenhardt's; 6xSSC, 0.1 mg / ml CT DNA (calf thymus DM)

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Toxicology (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

L'invention concerne un nouveau polypeptide, une région de liaison d'ARN-eucaryote RNP-1-21, et un polynucléotide codant pour ce polypeptide ainsi qu'un procédé d'obtention de ce polypeptide par des techniques recombinantes d'ADN. L'invention concerne en outre les applications de ce polypeptide dans le traitement de maladies, notamment des tumeurs malignes, de l'hémopathie, de l'infection par VIH, de maladies immunitaires et de diverses inflammations. L'invention concerne aussi l'antagoniste agissant contre le polypeptide et son action thérapeutique ainsi que les applications de ce polynucléotide codant pour la région de liaison d'ARN-eucaryote RNP-1-21.
PCT/CN2000/000546 1999-12-21 2000-12-11 Nouveau polypeptide, region de liaison d'arn-eucaryote rnp-1-21, et polynucleotide codant pour ce polypeptide WO2001046437A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU23401/01A AU2340101A (en) 1999-12-21 2000-12-11 Novel polypeptide - eukaryotic rna-binding redion rnp-1-21 and polynucleotide encoding it

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN 99125661 CN1300747A (zh) 1999-12-21 1999-12-21 一种新的多肽－真核rna结合区域rnp－1 21和编码这种多肽的多核苷酸
CN99125661.1 1999-12-21

Publications (1)

Publication Number Publication Date
WO2001046437A1 true WO2001046437A1 (fr) 2001-06-28

Family

ID=5284075

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2000/000546 WO2001046437A1 (fr) 1999-12-21 2000-12-11 Nouveau polypeptide, region de liaison d'arn-eucaryote rnp-1-21, et polynucleotide codant pour ce polypeptide

Country Status (3)

Country Link
CN (1) CN1300747A (fr)
AU (1) AU2340101A (fr)
WO (1) WO2001046437A1 (fr)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2003093505A2 (fr) * 2002-04-29 2003-11-13 Commissariat A L'energie Atomique Procede de determination de la presence d'un agent transmissible non conventionel (atnc) responsable d'une encephalopathie spongiforme subaigue transmissible

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
DATABASE GENBANK [online] 16 September 1992 (1992-09-16), ABE M., accession no. NCBI Database accession no. PS0381 *
DATABASE GENBANK [online] 8 February 2001 (2001-02-08), CARNINCI P. ET AL., accession no. NCBI Database accession no. BAB25466 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2003093505A2 (fr) * 2002-04-29 2003-11-13 Commissariat A L'energie Atomique Procede de determination de la presence d'un agent transmissible non conventionel (atnc) responsable d'une encephalopathie spongiforme subaigue transmissible
WO2003093505A3 (fr) * 2002-04-29 2004-04-15 Commissariat Energie Atomique Procede de determination de la presence d'un agent transmissible non conventionel (atnc) responsable d'une encephalopathie spongiforme subaigue transmissible

Also Published As

Publication number Publication date
AU2340101A (en) 2001-07-03
CN1300747A (zh) 2001-06-27

Similar Documents

Publication Publication Date Title
WO2002026973A1 (fr) Nouveau polypeptide, une ribonucleoproteine nucleaire heterogene humaine 32.01, et un polynucleotide codant ce polypeptide
WO2002026972A1 (fr) Nouveau polypeptide, proteine humaine 20.13 de liaison de l'acide polyadenylique, et polynucleotide codant ce polypeptide
WO2001083780A1 (fr) Nouveau polypeptide, methylthioadenosine phosphorylase humaine 37, et polynucleotide codant pour ce polypeptide
WO2001046437A1 (fr) Nouveau polypeptide, region de liaison d'arn-eucaryote rnp-1-21, et polynucleotide codant pour ce polypeptide
WO2001066730A1 (fr) Nouveau polypeptide, proteine humaine rs3 12, et polynucleotide codant pour ce polypeptide
WO2001046409A1 (fr) Nouveau polypeptide, proteine ribosomale s7 9, et polynucleotide codant pour ce polypeptide
WO2001094530A2 (fr) Nouveau polypeptide, proteine 57 de la sous-famille des proteines a doigt de zinc scan, et polynucleotide codant ce polypeptide
WO2001075101A1 (fr) Nouveau polypeptide, proteine humaine de regulation de la transcription 8, et polynucleotide codant pour ce polypeptide
WO2002020606A1 (fr) Nouveau polypeptide, la proteine humaine 38.39 liee aux defauts d'audition, et polynucleotide codant pour elle
WO2001049724A1 (fr) Nouveau polypeptide, proteine lissencephale humaine 43, et polynucleotide codant pour ce polypeptide
WO2001075048A2 (fr) Nouveau polypeptide, proteine ribosomale humaine s11 23, et polynucleotide codant pour ce polypeptide
WO2002033077A1 (fr) Nouveau polypeptide, une proteine de regulation 10.01 etant associee au developpement humain et polynucleotide la codant
WO2001066584A1 (fr) Nouveau polypeptide, proteine humaine pax 9, et polynucleotide codant pour ce polypeptide
WO2001048195A1 (fr) Nouveau polypeptide, proteine rcc1 10, et polynucleotide codant pour ce polypeptide
WO2001070956A1 (fr) Nouveau polypeptide, proteine humaine de reparation 8 du mesappariement de l'adn, et polynucleotide codant pour ce polypeptide
WO2001081594A1 (fr) Nouveau polypeptide, proteine pax humaine 17, et polynucleotide codant pour ce polypeptide
WO2001048212A1 (fr) Nouveau polypeptide, phosphoribosyl pyrophosphate synthetase 11, et polynucleotide codant pour ce polypeptide
WO2001070803A1 (fr) Nouveau polypeptide, proteine humaine de regulation de la transcription 9.7, et polynucleotide codant pour ce polypeptide
WO2001079437A2 (fr) Nouveau polypeptide, facteur humain de transcription de la differentiation cellulaire 14, et polynucleotide codant pour ce polypeptide
WO2001079428A2 (fr) Nouveau polypeptide, proteine humaine de reparation 8.9 du mesappariement de l'adn, et polynucleotide codant pour ce polypeptide
WO2001055419A1 (fr) Nouveau polypeptide, site de liaison 27 d'arn s1, et polynucleotide codant pour ce polypeptide
WO2001047985A1 (fr) Nouveau polypeptide, proteine kinase c-13, et polynucleotide codant pour ce polypeptide
WO2001046242A1 (fr) NOUVEAU POLYPEPTIDE, GENE σ-54 9, ET POLYNUCLEOTIDE CODANT POUR CE POLYPEPTIDE
WO2001049860A1 (fr) Nouveau polypeptide, helicase 9, et polynucleotide codant pour ce polypeptide
WO2001073009A1 (fr) Nouveau polypeptide, bromodomaine humain 11, et polynucleotide codant pour ce polypeptide

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP