WO2001046242A1 - NOUVEAU POLYPEPTIDE, GENE σ-54 9, ET POLYNUCLEOTIDE CODANT POUR CE POLYPEPTIDE - Google Patents
NOUVEAU POLYPEPTIDE, GENE σ-54 9, ET POLYNUCLEOTIDE CODANT POUR CE POLYPEPTIDE Download PDFInfo
- Publication number
- WO2001046242A1 WO2001046242A1 PCT/CN2000/000543 CN0000543W WO0146242A1 WO 2001046242 A1 WO2001046242 A1 WO 2001046242A1 CN 0000543 W CN0000543 W CN 0000543W WO 0146242 A1 WO0146242 A1 WO 0146242A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- polypeptide
- polynucleotide
- factor
- sequence
- seq
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
Definitions
- the present invention belongs to the field of biotechnology. Specifically, the present invention describes a novel polypeptide, ⁇ -54 factor 9, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a method and application for preparing such polynucleotides and polypeptides.
- regulatory proteins can activate the expression of promoter genes recognized by core RNA polymerase binding ⁇ -54 factor 9, a process that relies on the hydrolysis of ATP to provide energy.
- ⁇ -54 factor 9 a process that relies on the hydrolysis of ATP to provide energy.
- About half of these regulatory proteins belong to the signaling binary system and all contain a site whose N-terminus can be phosphorylated by a transactivating enzyme protein.
- the C-terminus of almost all of this protein contains a helix-folding-helix ( ⁇ ) binding region.
- the region of the regulatory protein that interacts with ⁇ -54 factor 9 contains approximately 230 amino acid residues.
- the region interacting with ⁇ -54 factor 9 itself has ATPase activity, which can promote conformational changes during the interaction phase, which includes the atypical ATP binding domain A (P-loop) and domain B, both of which The ATP-binding domain is located at the N-terminal portion of the protein.
- ATP-binding domain is located at the N-terminal portion of the protein.
- most proteins have a conserved sequence like this: [LIVMFY] (3) — X— G— [DEQ] — [STE] — G_ [STAV] — G— K— X (2) — [LIVMFY] 0 There are also some areas that are more conservative.
- ⁇ -54 factor 9 After ⁇ -54 factor 9 is bound to the core enzyme, a stable, closed promoter complex is formed.
- the activating protein is bound to ⁇ -54 factor 9
- the entire complex undergoes an isomerization reaction to form an open-chain Promoter complex, the energy required for this process is supplied by ATP hydrolysis catalyzed by an activating protein with ATPase activity.
- the ⁇ -54 binding system can also recognize the enhancer DM at the -12 and -24 positions away from the start of transcription, replacing the -10 and -35 positions in general.
- ⁇ -54 factor 9 protein plays an important role in important body functions as described above, and it is believed that a large number of proteins are involved in these regulatory processes, there has been a need in the art to identify more ⁇ -54 factor 9 proteins that participate in these processes. In particular, the amino acid sequence of this protein is identified. Isolation of the new ⁇ -54 factor 9 protein encoding gene also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so it is important to isolate its coding DNA. Object of the invention
- Another object of the invention is to provide a polynucleotide encoding the polypeptide.
- Another object of the present invention is to provide a method for producing a ⁇ -54 factor of 9.
- Another object of the present invention is to provide antibodies against the polypeptide of the present invention, sigma-54 factor 9.
- Another object of the present invention is to provide mimic compounds, antagonists, agonists, and inhibitors against the polypeptide of the present invention, ⁇ -54 factor 9.
- the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
- the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
- the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
- sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 649-945 in SEQ ID NO: 1; and (b) a sequence having 1-1352 in SEQ ID NO: 1 Sequence of bits.
- the invention further relates to a vector, in particular an expression vector, containing the polynucleotide of the invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; and a method comprising culturing said Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
- a vector in particular an expression vector, containing the polynucleotide of the invention
- a host cell genetically engineered with the vector including a transformed, transduced or transfected host cell
- a method comprising culturing said Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
- the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
- the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of sigma-54 factor 9 protein, which comprises utilizing the polypeptide of the invention.
- the invention also relates to compounds obtained by this method.
- the present invention also relates to a method for in vitro detection of a disease or disease susceptibility associated with abnormal expression of a sigma-54 factor 9 protein, comprising detecting mutations in the polypeptide or a polynucleotide sequence encoding the same in a biological sample, Alternatively, the amount or biological activity of a polypeptide of the invention in a biological sample is detected.
- the invention also relates to a pharmaceutical composition
- a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
- the present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention in the preparation of a medicament for treating cancer, developmental disease or immune disease or other diseases caused by abnormal expression of sigma-54 factor 9.
- Figure 1 is a comparison diagram of the amino acid sequence homology of the ⁇ -54 factor 9 protein of the present invention in a total of 50 amino acids and domains of the ⁇ -54 factor 9 from 1-50.
- the upper sequence is the ⁇ -54 factor 9, and the lower sequence is the ⁇ -54 family protein domain.
- ⁇ "and”: “and”. “Indicate that the probability of the same amino acid appearing between two sequences decreases in sequence.
- Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of the separated ⁇ -54 factor 9. 9kDa is the molecular weight of the protein. The arrow indicates the isolated protein band.
- Nucleic acid sequence refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
- amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
- amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
- a protein or polynucleotide “variant” refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it. The changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence. Variants can have "conservative" changes in which the substituted amino acid has a structural or chemical property similar to the original amino acid, such as the replacement of isoleucine with leucine. Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
- “Deletion” refers to the absence of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence. Missed.
- Insertion means that a change in the amino acid sequence or nucleotide sequence results in an increase in one or more amino acids or nucleotides compared to a molecule that exists in nature.
- Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
- Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
- immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response and to bind specific antibodies in a suitable animal or cell.
- An "agonist” refers to a molecule that, when combined with sigma-54 factor 9, can cause changes in the protein and thereby regulate the activity of the protein.
- An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that can bind the sigma-54 factor 9.
- Antagonist refers to a molecule that, when combined with sigma-54 factor 9, can block or regulate the biological or immunological activity of sigma-54 factor 9.
- Antagonists and inhibitors can include proteins, nucleic acids, carbohydrates, or any other molecule that can bind sigma-54 factor 9.
- ⁇ -54 factor 9 refers to a change in the function of ⁇ -54 factor 9, including an increase or decrease in protein activity, a change in binding characteristics, and any other biological, functional, or immune properties of ⁇ -54 factor 9.
- substantially pure means substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated.
- Those skilled in the art can purify sigma-54 factor 9 using standard protein purification techniques.
- the substantially pure ⁇ -54 factor 9 produces a single main band on a non-reducing polyacrylamide gel.
- the purity of the ⁇ -54 factor 9 peptide can be analyzed by amino acid sequence.
- Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
- sequence C-T-G-A
- complementary sequence G-A-C-T.
- the complementarity between two single-stranded molecules can be partial or complete.
- the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
- “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
- Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Southern blotting or Nor thern blotting, etc.) under conditions of reduced stringency.
- Substantially homologous sequences or hybridization probes can compete and inhibit the binding of completely homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.
- Percent identity refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALIGN program (Lasergene sof tware package, DNASTAR, Inc., Madi son Wis.) The MEGALIGN program can compare two or more sequences according to different methods, such as the Clus ter method (Higgins, DG and PM Sharp (1988) Gene 73: 237- 244). The Clus ter method arranges groups of sequences into clusters by checking the distance between all pairs. The clusters are then assigned in pairs or groups. The identity between two amino acid sequences such as sequence A and sequence B The percentage is calculated by:
- Sequence of residues - the sequence of spacer residues - the sequence of residues X ⁇ interval may be measured as Jotun Hein identity percentage (He in the nucleic acid sequences between Clus ter or a method well known in the art J., (1990) Methods in enzymology 183: 625-645).
- Similarity refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
- Amino acids used for conservative substitutions for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
- Antisense refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence.
- the "antisense strand” refers to a nucleic acid strand that is complementary to the “sense strand”.
- Derivative refers to HFP or a chemical modification of its nucleic acid. Such a chemical modification may be a substitution of a hydrogen atom with a fluorenyl group, an acyl group or an amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
- Antibody refers to a complete antibody molecule and its fragments, such as Fa,? ( ⁇ ') 2, and?, which can specifically bind the ⁇ -54 factor 9 epitope.
- a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
- isolated refers to the removal of matter from its original environment (for example, its natural environment if it is naturally occurring).
- a naturally occurring polynucleotide or polypeptide is not isolated when it is present in a living animal, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist in the natural system.
- Such a polynucleotide may be part of a vector, or such a polynucleotide or polypeptide may be part of a composition. Since the carrier or composition is not part of its natural environment, they are still isolated.
- isolated refers to the separation of a substance from its original environment (if natural Matter, the original environment is the natural environment).
- polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances existing in the natural state. .
- isolated sigma-54 factor 9 means that sigma-54 factor 9 is substantially free of other proteins, lipids, sugars, or other substances with which it is naturally associated. Those skilled in the art can purify sigma-54 factor 9 using standard protein purification techniques. Substantially pure peptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of ⁇ -54 factor 9 polypeptide can be analyzed by amino acid sequence.
- the present invention provides a new polypeptide, ⁇ -54 factor 9, which basically consists of the amino acid sequence shown in SEQ ID NO: 2.
- the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
- the polypeptides of the present invention may be naturally purified products or chemically synthesized products, or produced using recombinant techniques from prokaryotic or eukaryotic hosts (e.g., bacteria, yeast, higher plants, insects, and mammalian cells). Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
- the invention also includes fragments, derivatives and analogs of ⁇ -54 factor 9.
- fragment refers to a polypeptide that substantially maintains the same biological function or activity of the sigma-54 factor 9 of the present invention.
- a fragment, derivative or analog of the polypeptide of the present invention may be: U) a type in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substituted
- the amino acid may or may not be encoded by the genetic code; or (II) such a type in which a group on one or more amino acid residues is substituted by another group to include a substituent; or (III) such a Species, wherein the mature polypeptide is fused to another compound (such as a compound that extends the half-life of the polypeptide, such as polyethylene glycol); or (IV) such a polypeptide sequence in which the additional amino acid sequence is fused into the mature polypeptide (eg Leader sequences or secreted sequences or sequences used to purify this polypeptide or protease sequences)
- such fragments, derivatives and analogs are considered to be within the knowledge of those skilled in the art.
- the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
- the polynucleotide sequence of the present invention includes a nucleotide sequence of SEQ ID NO: 1.
- the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a polynucleotide sequence of 1352 bases in length and its open reading frame of 649-891 encodes 80 amino acids.
- This peptide has the characteristic sequence of the ⁇ -54 factor family protein, and it can be deduced that the ⁇ -54 factor 9 has the structure and function represented by the ⁇ -54 factor family protein.
- the polynucleotide of the present invention may be in the form of DNA or RNA.
- DNA forms include cDNA, genomic DNA, or synthetic DNA.
- DNA can be single-stranded or double-stranded.
- D can be a coding chain or not Coding chain.
- the coding region sequence encoding the mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
- a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
- the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
- polynucleotide encoding a polypeptide refers to a polynucleotide that includes the polypeptide and a polynucleotide that includes additional coding and / or non-coding sequences.
- the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
- This polynucleotide variant can be a naturally occurring allelic variant or a non-naturally occurring variant.
- These nucleotide variants include substitution variants, deletion variants, and insertion variants.
- an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
- the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity between the two sequences).
- the present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions.
- “strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60'C; or (2) Add denaturants during hybridization, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% Fi co ll, 42 ° C, etc .; or (3) only between two sequences Hybridization occurs only when the identity is at least 95%, and more preferably 97%.
- the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
- nucleic acid fragments that hybridize to the sequences described above.
- a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 cores Glycylic acid or more.
- Nucleic acid fragments can also be used in nucleic acid amplification techniques (such as PCR) to identify and / or isolate polynucleotides encoding ⁇ -54 factor 9.
- polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
- the specific polynucleotide sequence encoding the ⁇ -54 factor 9 of the present invention can be obtained by various methods.
- polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
- the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) Isolation of double-stranded DM from genomic DNA Sequence; 2) chemically synthesizing the D sequence to obtain double-stranded DNA of the polypeptide.
- genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences.
- the standard method for isolating the cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library.
- mRNA extraction There are many mature techniques for mRNA extraction, and kits are also commercially available (Qiagene :).
- the construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989).
- Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
- genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DM-DNA or DNA-RNA hybridization; (2) the presence or absence of marker gene function; (3) determination of the transcript level of sigma-54 factor 9; (4) Detection of gene-expressed protein products by immunological techniques or determination of biological activity. The above methods can be used singly or in combination.
- the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
- the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
- the probe used here is usually a DNA sequence chemically synthesized based on the gene sequence information of the present invention.
- the genes or fragments of the present invention can of course be used as probes.
- DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
- immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) can be used to detect protein products expressed by the ⁇ -54 factor 9 gene.
- a method using PCR technology to amplify DNA / RNA is preferably used to obtain the gene of the present invention.
- the RACE method RACE-rapid cDNA end rapid amplification method
- the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Select and synthesize using conventional methods.
- the amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
- polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be measured by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, sequencing needs to be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
- the present invention also relates to a vector comprising a polynucleotide of the present invention, and a vector or a direct use of the vector of the present invention.
- a host cell produced by genetic engineering using the ⁇ _54 factor 9 coding sequence, and a method for producing the polypeptide of the present invention by recombinant technology.
- a polynucleotide sequence encoding a ⁇ -54 factor 9 may be inserted into a vector to form a recombinant vector containing the polynucleotide of the present invention.
- vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
- Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al.
- any plasmid and vector can be used to construct a recombinant expression vector.
- An important feature of expression vectors is that they usually contain origins of replication, promoters, marker genes, and translational regulatory elements.
- the expression vector also includes a ribosome binding site for translation initiation, a transcription terminator, and the like. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers and adenovirus enhancers on the late side of the origin of replication.
- the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
- selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
- GFP fluorescent protein
- tetracycline or ampicillin resistance for E. coli.
- a polynucleotide encoding ⁇ -54 factor 9 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to form a genetically engineered host containing the polynucleotide or the recombinant vector.
- Cell refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E.
- coli Streptomyces
- bacterial cells such as Salmonella typhimurium
- fungal cells such as yeast
- plant cells such as fly S2 or Sf 9
- animal cells such as CH0, COS or Bowes melanoma cells.
- Transformation of a host cell with a DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art.
- the host is a prokaryote such as E. coli
- competent cells capable of absorbing DM may be harvested after exponential growth phase, treated with CaC l 2 method used in steps well known in the art. Alternatively, MgCl 2 is used.
- transformation can also be performed by electroporation.
- the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
- the polynucleotide sequence of the present invention can be used to express or produce recombinant ⁇ -54 factor 9 (Science, 1984; 224: 1431). Generally there are the following steps:
- the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
- a suitable method such as temperature conversion or chemical induction
- the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If necessary, the recombinant protein can be isolated and purified by various separation methods using its physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
- conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid
- polypeptides of the present invention can be directly used in the treatment of diseases, for example, they can be used to treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection, and immunological diseases.
- ⁇ -54 factor 9 a process that relies on the hydrolysis of ATP to provide energy.
- the region interacting with ⁇ -54 factor 9 has ATPase activity itself, and can promote conformational changes during the interaction phase. Contains atypical ATP-binding domain A (Pl oop) and domain B.
- ⁇ -54 factor 9 is bound to the core enzyme, a stable, closed promoter complex is formed.
- the activating protein is bound to ⁇ -54 factor 9, the entire complex undergoes an isomerization reaction to form an open chain.
- promoter complex the energy required for this process is supplied by ATP hydrolysis catalyzed by an activating protein with ATPase activity.
- the ⁇ -54 binding system can also recognize enhancer DNA at the -12 and -24 positions away from the start of transcription, instead of the -10 and -35 positions under normal circumstances.
- Site-directed mutagenesis and specific chemical probes on some key sites show that the binding and interaction of ⁇ -54 factor 9 with the core enzyme controls the speed of transcription initiation and the conformation of the polymerase, thus indirectly affecting RNA synthesis. Speed and future protein synthesis and expression.
- abnormal expression of mo tif in the specific sigma-54 factor 9 action region will cause abnormal function of the polypeptide containing this mo tif, resulting in abnormal RNA synthesis and protein expression, and related diseases such as Tumors, embryonic developmental disorders, growth disorders, etc.
- the abnormal expression of the ⁇ -54 factor 9 of the present invention will produce various diseases, especially various tumors, embryonic developmental disorders, and growth disorders. These diseases include, but are not limited to:
- Tumors of various tissues gastric cancer, liver cancer, lung cancer, esophageal cancer, breast cancer, leukemia, lymphoma, thyroid tumor, uterine fibroids, neuroblastoma, astrocytoma, ependymoma, glioblastoma, Colon cancer, melanoma, adrenal cancer, bladder cancer, bone cancer, osteosarcoma, myeloma, bone marrow cancer, brain cancer, uterine cancer, endometrial cancer, gallbladder cancer, colon cancer, thymic tumor, nasal cavity and sinus tumor, nose Pharyngeal cancer, Laryngeal cancer, Tracheal tumor, Fibroma, Fibrosarcoma, Lipoma, Liposarcoma, Leiomyoma
- Embryonic disorders congenital abortion, cleft palate, limb loss, limb differentiation disorder, hyaline membrane disease, atelectasis, polycystic kidney, double ureter, cryptorchidism, congenital inguinal hernia, double uterus, vaginal atresia, suburethral Fissure, hermaphroditism, atrial septal defect, ventricular septal defect, pulmonary stenosis, arterial duct occlusion, neural tube defect, congenital hydrocephalus, iris defect, congenital cataract, congenital glaucoma or cataract, congenital deafness
- Growth and development disorders mental retardation, cerebral palsy, brain development disorders, mental retardation, familial cerebral nucleus dysplasia syndrome, strabismus, skin, fat and muscular dysplasia such as congenital skin laxity, premature aging Disease, congenital keratosis, various metabolic defects such as various amino acid metabolic defects, stunting, dwarfism, sexual retardation
- ⁇ -54 factor 9 of the present invention will also generate certain inflammations, certain hereditary, hematological diseases, and immune system diseases.
- the polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat various diseases, especially various tumors, embryonic development disorders, growth and development disorders, and certain inflammations. Certain genetic, hematological and immune system diseases.
- the invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) sigma-54 factor 9. Agonists increase biological functions such as sigma-54 factor 9 to stimulate cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
- mammalian cells or membrane preparations expressing ⁇ -54 factor 9 can be cultured with labeled ⁇ -54 factor 9 in the presence of a drug. The ability of the drug to increase or block this interaction is then determined.
- Antagonists of ⁇ -54 factor 9 include antibodies, compounds, receptor deletions, and analogs that are screened. Antagonists of ⁇ -54 factor 9 can bind to ⁇ -54 factor 9 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot perform biological functions.
- sigma-54 factor 9 When screening compounds as antagonists, sigma-54 factor 9 can be added to the bioanalytical assay to determine whether the compound is an antagonist by measuring the effect of the compound on the interaction between sigma-54 factor 9 and its receptor. Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds.
- Peptide molecules capable of binding to ⁇ -54 factor 9 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. When screening, ⁇ -54 factor 9 molecules should generally be labeled.
- the present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies.
- the invention also provides antibodies against the ⁇ -54 factor 9 epitope. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by Fab expression libraries.
- Polyclonal antibodies can be produced by injecting ⁇ -54 factor 9 directly into immunized animals (such as rabbits, mice, rats, etc.).
- immunized animals such as rabbits, mice, rats, etc.
- adjuvants can be used to enhance the immune response, including but not limited to Freund's adjuvant.
- Techniques for preparing ⁇ -54 factor 9 monoclonal antibodies include, but are not limited to, hybridoma technology (Kohler and Milstein. Nature, 1975, 256: 495-497), triple tumor technology, human beta-cell hybridoma technology, and EBV-hybridization Tumor technology, etc.
- Chimeric antibodies that bind human constant regions to non-human-derived variable regions can be produced using existing techniques (Morrison et al, PNAS, 1985, 81: 6851).
- the existing technology for producing single chain antibodies (U. S. Pat No. 4946778) can also be used to produce single chain antibodies against ⁇ -54 factor 9.
- Antibodies against ⁇ -54 factor 9 can be used in immunohistochemical techniques to detect ⁇ -54 factor 9 in biopsy specimens.
- Monoclonal antibodies that bind to ⁇ -54 factor 9 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
- Antibodies can also be used to design immunotoxins that target a particular part of the body.
- Such as ⁇ -54 factor 9 high affinity monoclonal antibodies can be used with bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.) Covalent bonding.
- a common method is to attack the amino group of the antibody with a thiol crosslinker such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds. This hybrid antibody can be used to kill ⁇ -54 factor 9 positive cells.
- the antibodies of the present invention can be used to treat or prevent sigma-54 factor 9-related diseases.
- the proper dose of antibody can stimulate or block the production or activity of sigma-54 factor 9.
- the present invention also relates to a diagnostic test method for quantitatively and locally detecting the level of ⁇ -54 factor 9.
- tests are well known in the art and include FISH assays and radioimmunoassays.
- the level of ⁇ -54 factor 9 detected in the test can be used to explain the importance of ⁇ - 54 factor 9 in various diseases and to diagnose diseases in which ⁇ -54 factor 9 plays a role.
- polypeptide of the present invention can also be used for peptide mapping analysis.
- the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
- Polynucleotides encoding ⁇ -54 factor 9 can also be used for a variety of therapeutic purposes. Gene therapy technology can be used to treat abnormal cell proliferation, development or metabolism caused by the non-expression or abnormal / inactive expression of ⁇ -54 factor 9.
- Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated ⁇ -54 factor 9 to inhibit endogenous ⁇ -54 factor 9 activity.
- a variant ⁇ -54 factor 9 may be a shortened ⁇ -54 factor 9 that lacks the signaling domain. Although it can bind to downstream substrates, it lacks signaling activity. Therefore, the recombinant gene therapy vector can be used for treating diseases caused by abnormal expression or activity of sigma-54 factor 9.
- Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to transfer a polynucleotide encoding a sigma-54 factor 9 into a cell.
- a method for constructing a recombinant viral vector carrying a polynucleotide encoding a sigma-54 factor 9 can be found in the existing literature (Sambrook, et al.).
- the polynucleotide encoding ⁇ -54 factor 9 can be packaged into liposomes and transferred into cells.
- Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
- a vector such as a virus, phage, or plasmid
- Oligonucleotides including antisense RNA and DNA
- ribozymes that inhibit ⁇ -54 factor 9 raRNA are also within the scope of the present invention.
- a ribozyme is an enzyme-like RNA molecule that specifically decomposes specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation.
- Antisense RNA, DNA, and ribozymes can be obtained by any existing RNA or DNA synthesis technology, such as the technology for the synthesis of oligonucleotides by solid-phase phosphoramidite chemical synthesis has been widely used.
- Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA. This DNA sequence has been integrated into the RM polymerase promoter of the vector Downstream. In order to increase the stability of a nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the ribonucleoside linkages should use phosphate thioester or peptide bonds instead of phosphodiester bonds.
- the polynucleotide encoding ⁇ -54 factor 9 can be used for the diagnosis of diseases related to ⁇ -54 factor 9.
- Polynucleotides encoding ⁇ -54 factor 9 can be used to detect the expression of ⁇ -54 factor 9 or the abnormal expression of ⁇ -54 factor 9 in a disease state.
- the DNA sequence encoding ⁇ -54 factor 9 can be used to hybridize biopsy specimens to determine the expression of ⁇ -54 factor 9.
- Hybridization techniques include Southern blotting, Northern blotting, and in situ hybridization. These techniques and methods are publicly available and mature, and the relevant kits are commercially available.
- a part or all of the polynucleotides of the present invention can be used as probes to be fixed on a microarray or a DNA chip (also called a "gene chip") for analyzing differential expression analysis of genes and genetic diagnosis in tissues.
- a microarray or a DNA chip also called a "gene chip”
- Sigma-54 factor 9 specific primers for RNA-polymerase chain reaction (RT-PCR) in vitro amplification can also detect sigma-54 factor 9 transcription products.
- Detection of mutations in the ⁇ -54 factor 9 gene can also be used to diagnose ⁇ -54 factor 9-related diseases.
- Sigma-54 factor 9 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to normal wild-type ⁇ -54 factor 9 DNA sequences. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression, so Northern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
- sequences of the invention are also valuable for chromosome identification. This sequence will specifically target a specific position on a human chromosome and can hybridize to it. Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for marking chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DNA sequences on a chromosome.
- PCR primers (preferably 15-35bp) are prepared from the cDNA, and the sequences can be located on the chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
- PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
- oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
- Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.
- Fluorescent in situ hybridization of cDNA clones to metaphase chromosomes allows precise chromosomal localization in one step.
- FISH Fluorescent in situ hybridization
- the difference in cDNA or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).
- the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
- suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
- the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
- the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
- a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
- these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell.
- the polypeptides of the invention can be used in combination with other therapeutic compounds.
- the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
- sigma-54 factor 9 is administered in an amount effective to treat and / or prevent a particular indication.
- the amount and dose range of ⁇ -54 factor 9 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician. Examples
- Total human fetal brain RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform.
- MRNA is formed by reverse transcription cDNA Quik mRNA Isolation Kit (Qiegene Co.) isolated from the total RNA poly (A) mRNA 0 2ug poly ( A) used. Use Smart cDNA Cloning Kit (purchased from CI on tech). The 0 fragment was inserted into the multiple cloning site of the pBSK (+) vector (Clontech), and transformed into DH5 ct. The bacteria formed a cDNA library.
- Dye terminate cycle react ion sequencing kit Perkin-Elmer
- ABI 377 automatic sequencer Perkin-Elmer
- the determined cDNA sequence was compared with the existing public D sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 0473h04 was new DNA.
- a series of primers were synthesized to determine the inserted cDNA fragments of the clone in both directions.
- the sequence of the ⁇ -54 factor 9 of the present invention and the protein sequence encoded by the CG-54 factor 9 were profiled using the GCG profile scan program (Basic local alignment search tool) [Altschul, SF et al. J. Mol. Biol. 1990; 215: 403 -10], perform domain analysis in databases such as Prosite.
- the ⁇ -54 factor 9 of the present invention is homologous with the domain ⁇ -54 factor family protein at 1-50, and the homology result is shown in FIG. 1.
- the homology rate is 0.21, and the score is 10.66; the threshold value is 9.59.
- Example 3 Cloning of a gene encoding ⁇ -54 factor 9 by RT-PCR
- CDM was synthesized by reverse transcription reaction using fetal brain cell total RNA as a template and oligo-dT as a primer. After purification with Qiagene's kit, PCR was performed with the following primers:
- Primerl 5'- GGTACGAAGCCGTCGCCAAAGAGT -3 '(SEQ ID NO: 3)
- Primer2 5-TAGTGCTTTGTCTTTATTTCTGAT -3 '(SEQ ID NO: 4)
- Primerl is a forward sequence located at the 5th end of SEQ ID NO: 1, starting at lbp;
- Primer2 is the 3, terminal reverse sequence of SEQ ID NO: 1.
- Amplification conditions 50 mmol / L KC1, 10 mmol / L Tris-HC1, pH 8.5, 1.5 mmol / L MgCl 2 , 200 ⁇ mol / L dNTP, lOpmol primer, 1U Taq in a reaction volume of 50 ⁇ 1 DM polymerase (Clontech).
- the reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) under the following conditions for 25 cycles: 94 ° C 30sec; 55 ° C 30sec; 72 ° C 2rain 0 ⁇ -act in For positive control and template blank as negative control.
- the amplified product was purified using a QIAGEN kit and ligated to a PCR vector (Invitrogen product) using a TA cloning kit.
- the DNA sequence analysis results showed that the DM sequence of the PCR product was exactly the same as the l-1352bp shown in SEQ ID NO: 1.
- Example 4 Northern blot analysis of ⁇ -54 factor 9 gene expression
- RNA extraction in one step [Anal. Biochem 1987, 162, 156-159] 0
- This method involves acid guanidinium thiocyanate-chloroform extraction. I.e. with 4M guanidinium isothiocyanate -25mM sodium citrate, 0.2M sodium acetate (P H4.0) of the tissue was homogenized phenol, 1 volume and 1/5 volume of chloroform - isoamyl alcohol (49: 1) Centrifuge after mixing. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water.
- Electrophoresis was performed on a 1.2% agarose gel containing 2 g of RNA on 20 mM 3- (N-morpholino) propanesulfonic acid (pH 7.0)-5 mM sodium acetate-1 mM EDTA-2.2M formaldehyde. Then Transfer to a nitrocellulose membrane. A 32 P dATP was used to prepare a 32 P-labeled DNA probe by random primers. The DNA probe used was the ⁇ -54 factor 9 coding region of the PCR amplification shown in FIG. 1 sequence (649bp to 891bp).
- Primer3 5- CCCCATATGATGGCATTATCCCTAGAGGTCATGG -3 '(Seq ID No: 5)
- Primer4 5'- CATGGATCCCTATAACTTGAAAAAAAAAAAAA -3' (Seq ID No: 6)
- the coding sequences of the 5 'and 3' ends of the gene of interest are respectively followed by Ndel and BamHI restriction sites corresponding to the selective endonucleases on the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865.3). Enzyme site.
- the PCR reaction was performed using the pBS-0473h04 plasmid containing the full-length target gene as a template.
- the PCR reaction conditions were as follows: 10 pg of pBS-0473h04 plasmid, Primer-3 and Primer-4 were included in a total volume of 50 ⁇ 1; j was 10pmol, Advantage polymerase Mix (Clontech) 1 ⁇ 1. Cycle parameters: 94. C 20s, 60. C 30s, 68. C 2 min, a total of 25 cycles. Ndel and BamHI were used to double digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase.
- the ligated product was transformed with colibacillus DH5CC by calcium chloride method. After being cultured overnight on LB plates containing kanamycin (final concentration 30 g / ml), it was screened for positive by colony PCR Cloned and sequenced. A positive clone (pET-0473h04) with the correct sequence was selected, and the recombinant plasmid was transformed into E. coli BL21 (DE3) plySs (product of Novagen) using the calcium chloride method.
- a peptide synthesizer (product of PE company) was used to synthesize the following ⁇ -54 factor 9-specific peptides:
- the polypeptide is coupled with hemocyanin and bovine serum albumin to form a complex.
- hemocyanin and bovine serum albumin For the method, see: Avraraeas, et al. Immunochemi stry, 1969; 6: 43. Rabbits were immunized with 4 mg of the hemocyanin polypeptide complex plus complete Freund's adjuvant, and 15 days later, the hemocyanin polypeptide complex plus incomplete Freund's adjuvant was used to boost immunity once.
- a titer plate coated with a 15 g / ml bovine serum albumin peptide complex was used as an ELISA to determine antibody titers in rabbit serum.
- Total IgG was isolated from antibody-positive rabbit serum using protein A-Sepharose.
- the peptide was bound to a cyanogen bromide-activated Seph ar 0 S e4B column, and anti-peptide antibodies were separated from total I gG by affinity chromatography.
- the immunoprecipitation method proved that the purified antibody could specifically bind to sigma-54 factor 9.
- Example 7 Application of the polynucleotide fragment of the present invention as a hybridization probe
- the suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in various aspects.
- the probes can be used to hybridize to the genome or CDM library of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
- the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
- the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method.
- Filter hybridization methods include dot blotting, Southern blotting, Nor thern blotting, and copying methods. They are all used to fix the polynucleotide sample to be tested on the filter and then hybridize using basically the same steps.
- the sample-fixed filter is first applied
- the probe-free hybridization buffer is pre-hybridized so that the non-specific binding site of the sample on the filter is saturated with the carrier and the synthetic polymer.
- the pre-hybridization solution is then replaced with a hybridization buffer containing the labeled probe and incubated to hybridize the probe to the target nucleic acid.
- the unhybridized probes are removed by a series of membrane washing steps.
- This embodiment utilizes higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals.
- the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
- the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
- the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
- oligonucleotide fragments for use as hybridization probes from the polynucleotide SEQ ID NO: 1 of the present invention should follow the following principles and several aspects to be considered:
- the preferred range of probe size is 18-50 nucleotides
- Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements The regions are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, the primary probe should not be used;
- Probe 1 (probel), which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt)
- Probe 2 which belongs to the second type of probe, is equivalent to the replacement mutant sequence of the gene fragment of SEQ ID NO: 1 or its complementary fragment (41Nt):
- PBS phosphate buffered saline
- step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
- NC membrane nitrocellulose membrane
- Two NC membranes are required for each probe, so that it can be used in the following experimental steps.
- the film was washed with high-strength conditions and strength conditions, respectively.
- the 32 P-Probe (the second peak is free ⁇ - 32 P-dATP) is prepared.
- the sample membrane was placed in a plastic bag, and 3-10 mg of prehybridization solution (10xDenhardt's; 6xSSC, 0.1 mg / ml CT DNA (calf thymus DNA)) was added. After the bag was sealed, it was shaken in a 68 ° C water bath for 2 hours.
- prehybridization solution 10xDenhardt's; 6xSSC, 0.1 mg / ml CT DNA (calf thymus DNA)
- High-intensity washing film 1) Take out the hybridized sample membrane.
- Gene chip or gene micro-matrix (DNA Mi croa rray) is a new technology that many national laboratories and large pharmaceutical companies are currently developing and developing. It refers to arranging a large number of target gene fragments in an orderly and high-density manner.
- the data is compared and analyzed on a carrier such as glass, silicon, and the like by fluorescence detection and computer software, so as to achieve the purpose of analyzing biological information quickly, efficiently, and with high throughput.
- the polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research of new gene functions; search for and screen new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases .
- the specific methods and steps have been reported in the literature for various references.
- a total of 4,000 polynucleotide sequences of various full-length cDNAs are used as target DNA, including the polynucleotide of the present invention. Amplify them separately by PCR, and adjust the concentration of the amplified products to At about 500ng / ul, a Cartesian 7500 spotter (purchased from Cartesian, USA) was used to spot on the glass medium, and the distance between the spots was 280 ⁇ m. The spotted slides were hydrated, dried, and cross-linked in a UV cross-linker. After elution, the slides were fixed to D to fix the slides to prepare chips. The specific method steps have been reported in the literature. The sample post-processing steps in this embodiment are:
- Total mRNA was extracted from normal liver and liver cancer in one step, and the mRNA was purified using Oligotex mRNA Midi Kit (purchased from QiaGen).
- the fluorescent reagent Cy3dUTP (5-Amino-propargy 1-2 ⁇ -deoxyuri dine) was separately reverse transcribed. 5 '-triphate coupled to Cy3 fluorescent dye (purchased from Amersham Phamacia Biotech) was used to label the mRNA of normal liver tissue.
- Cy5dUTP (5-Amino-propargy 1-2- -deoxyuri dine 5'-tr iphate coupled to Cy5 fluorescent Dye (purchased from Amersham Phamacia Biotech) was used to label liver cancer tissue mRNA, and the probe was prepared after purification. For specific steps and methods, see:
- the probes from the two types of tissues and the chips were hybridized in a UniHyb TM Hybridization Solution (purchased from TeleChera) for 16 hours, and then washed with a washing solution (1 x SSC, 0.2 SDS) at room temperature and scanned with ScanArray 3000. Instrument (purchased from General Scanning Company, USA) for scanning, and the scanned image was processed by Imagene software (Biodiscovery Company, USA) to calculate the Cy3 / Cy5 ratio of each point. The point where the ratio is less than 0.5 and greater than 2 is considered as Differentially expressed genes.
Landscapes
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Gastroenterology & Hepatology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Medicinal Chemistry (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Toxicology (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
AU19818/01A AU1981801A (en) | 1999-12-21 | 2000-12-11 | A novel sigma-54 factor 9 and the polypeptide encoding thereof |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN 99125657 CN1300744A (zh) | 1999-12-21 | 1999-12-21 | 一种新的多肽-σ-54因子9和编码这种多肽的多核苷酸 |
CN99125657.3 | 1999-12-21 |
Publications (1)
Publication Number | Publication Date |
---|---|
WO2001046242A1 true WO2001046242A1 (fr) | 2001-06-28 |
Family
ID=5284071
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/CN2000/000543 WO2001046242A1 (fr) | 1999-12-21 | 2000-12-11 | NOUVEAU POLYPEPTIDE, GENE σ-54 9, ET POLYNUCLEOTIDE CODANT POUR CE POLYPEPTIDE |
Country Status (3)
Country | Link |
---|---|
CN (1) | CN1300744A (fr) |
AU (1) | AU1981801A (fr) |
WO (1) | WO2001046242A1 (fr) |
-
1999
- 1999-12-21 CN CN 99125657 patent/CN1300744A/zh active Pending
-
2000
- 2000-12-11 WO PCT/CN2000/000543 patent/WO2001046242A1/fr active Application Filing
- 2000-12-11 AU AU19818/01A patent/AU1981801A/en not_active Abandoned
Non-Patent Citations (3)
Title |
---|
J. BIOL. CHEM., vol. 269, no. 15, 15 April 1994 (1994-04-15), pages 11563 - 11571 * |
MOL. MICROBIOL., vol. 11, no. 2, January 1994 (1994-01-01), pages 227 - 236 * |
NATURE, vol. 358, no. 6385, 30 July 1992 (1992-07-30), pages 422 - 424 * |
Also Published As
Publication number | Publication date |
---|---|
AU1981801A (en) | 2001-07-03 |
CN1300744A (zh) | 2001-06-27 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
WO2001068694A1 (fr) | Nouveau polypeptide, proteine humaine d'hexokinase 10, et polynucleotide codant pour ce polypeptide | |
WO2001046242A1 (fr) | NOUVEAU POLYPEPTIDE, GENE σ-54 9, ET POLYNUCLEOTIDE CODANT POUR CE POLYPEPTIDE | |
WO2001049737A1 (fr) | Nouveau polypeptide, latexine proteine humaine 46, et polynucleotide codant pour ce polypeptide | |
WO2001048006A1 (fr) | Nouveau polypeptide, proteine de liaison de la cobalamine 10, et polynucleotide codant pour ce polypeptide | |
WO2001055195A1 (fr) | Nouveau polypeptide, proteine de type an1 humaine, et polynucleotide codant pour ce polypeptide | |
WO2001046437A1 (fr) | Nouveau polypeptide, region de liaison d'arn-eucaryote rnp-1-21, et polynucleotide codant pour ce polypeptide | |
WO2001062782A1 (fr) | Nouveau polypeptide, famille proteique 11 de la rhodopsine, et polynucleotide codant pour ce polypeptide | |
WO2001072793A1 (fr) | Nouveau polypeptide, proteine humaine de regulation 12 de la proteine hydrolase, et polynucleotide codant pour ce polypeptide | |
WO2001046409A1 (fr) | Nouveau polypeptide, proteine ribosomale s7 9, et polynucleotide codant pour ce polypeptide | |
WO2001081594A1 (fr) | Nouveau polypeptide, proteine pax humaine 17, et polynucleotide codant pour ce polypeptide | |
WO2001066770A1 (fr) | Nouveau polypeptide, signal peptidase humaine 15, et polynucleotide codant pour ce polypeptide | |
WO2001047987A1 (fr) | Nouveau polypeptide, gene $g(s)-54, et polynucleotide codant pour ce polypeptide | |
WO2001047985A1 (fr) | Nouveau polypeptide, proteine kinase c-13, et polynucleotide codant pour ce polypeptide | |
WO2001074895A1 (fr) | Nouveau polypeptide, facteur humain de transcription de la differentiation cellulaire 12.1, et polynucleotide codant pour ce polypeptide | |
WO2001049725A1 (fr) | NOUVEAU POLYPEPTIDE, FACTEUR σ-54 13, ET POLYNUCLEOTIDE CODANT POUR CE POLYPEPTIDE | |
WO2001046241A1 (fr) | Nouveau polypeptide, proteine 12 gvpa, et polynucleotide codant pour ce polypeptide | |
WO2001047998A1 (fr) | Nouveau polypeptide, proteine activant la ras gtpase 12, et polynucleotide codant pour ce polypeptide | |
WO2001079437A2 (fr) | Nouveau polypeptide, facteur humain de transcription de la differentiation cellulaire 14, et polynucleotide codant pour ce polypeptide | |
WO2001048166A1 (fr) | Nouveau polypeptide, ribonucleotide reductase 10, et polynucleotide codant pour ce polypeptide | |
WO2001090171A1 (fr) | Nouveau polypeptide, proteine humaine ribosomale sii 12, et polynucleotide codant ce polypeptide | |
WO2001048001A1 (fr) | Nouveau polypeptide, quinone-proteine reductase 7, et polynucleotide codant pour ce polypeptide | |
WO2001047973A1 (fr) | Nouveau polypeptide, proteine 14 associee a la vesicule a gaz, et polynucleotide codant pour ce polypeptide | |
WO2001075018A2 (fr) | Nouveau polypeptide, facteur humain de regulation de la transcription 31, et polynucleotide codant pour ce polypeptide | |
WO2001055427A1 (fr) | Nouveau polypeptide, proteine humaine kelch 19, et polynucleotide codant pour ce polypeptide | |
WO2001073063A1 (fr) | Nouveau polypeptide, proteine humaine hexokinase 13, et polynucleotide codant pour ce polypeptide |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A1 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
DFPE | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101) | ||
REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
122 | Ep: pct application non-entry in european phase | ||
NENP | Non-entry into the national phase |
Ref country code: JP |