WO2001047998A1 - Nouveau polypeptide, proteine activant la ras gtpase 12, et polynucleotide codant pour ce polypeptide - Google Patents

Nouveau polypeptide, proteine activant la ras gtpase 12, et polynucleotide codant pour ce polypeptide Download PDF

Info

Publication number
WO2001047998A1
WO2001047998A1 PCT/CN2000/000680 CN0000680W WO0147998A1 WO 2001047998 A1 WO2001047998 A1 WO 2001047998A1 CN 0000680 W CN0000680 W CN 0000680W WO 0147998 A1 WO0147998 A1 WO 0147998A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
polynucleotide
activating protein
gtpase activating
sequence
Prior art date
Application number
PCT/CN2000/000680
Other languages
English (en)
Chinese (zh)
Inventor
Yumin Mao
Yi Xie
Original Assignee
Shanghai Biowindow Gene Development Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shanghai Biowindow Gene Development Inc. filed Critical Shanghai Biowindow Gene Development Inc.
Priority to AU23411/01A priority Critical patent/AU2341101A/en
Publication of WO2001047998A1 publication Critical patent/WO2001047998A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • the present invention belongs to the field of biotechnology. Specifically, the present invention describes a novel polypeptide, Ras GTPase activating protein 12, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and the polypeptide.
  • the Ras gene is one of these subgroups and includes at least three members, N-ras, H-ras, and K-ras2.
  • the mutated form of Ras is called a tumor suppressor gene, and it is considered a pathogen of cancer.
  • Ras' normal cell genes and tumor suppressor genes encode chemically related proteins, collectively referred to as the ras p21 protein. Both the normal ras p21 and tumor suppressor gene ras p21 proteins bind to nucleotides GTP and GDP, and slowly hydrolyze GTP to GDP.
  • GTPase activating protein This intrinsic GTPase activity is stimulated by the cytokine GAP, which is called GTPase activating protein, but it has no effect on GTPase activity related to tumor suppressor mutations.
  • GAP is a cytoplasmic protein that can be transferred from the cytoplasm to the plasma membrane to interact with p21. Because it is a GTP-binding form of active ras, these proteins are called negative regulators of ras.
  • the members of the GAP family are all large molecular weight proteins (from 765 to 3079 residues), but the same conserved sequence is a limited region (about 250 residues) and is called the "catalytic domain" Or rasGAP domain.
  • the most conserved region in this region is a motif containing 15 residues, which is a characteristic sequence of the protein family: [GSN] -X- [LIVMF]-[FY]-[LIVMFY] -R- [LIVMFY] (2)-[GACN] -P- [AV]-[LIV] (2)-[SGAN]-P.
  • Ras tumor suppressor genes are related to the growth of various tumors and involve 10-40% of the most common human cancers, such as bladder cancer, colon cancer, kidney cancer, liver cancer, lung cancer, nest cancer, pancreatic cancer, and gastric cancer. This gene is also associated with lymphoid and bone marrow hematopoietic tumors, mesenchymal origin tumors.
  • the present invention includes the polypeptides of the above peptides, and the antagonists, inhibitors and agonists of the polypeptides can be used to diagnose, prevent and treat cancer, especially to detect the overexpression of normal or tumor suppressor gene ras p21 and treat the disease caused by ras tumor suppressor gene Cancer.
  • Ras GTPase activating protein 12 protein plays an important role in important functions of the body as described above, and it is believed that a large number of proteins are involved in these regulatory processes, there has been a need in the art to identify more Ras GTPase activating protein 12 involved in these processes Protein, especially the amino acid sequence of this protein.
  • the isolation of the new Ras GTPase activating protein 12 protein-encoding gene also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for developing diagnostic and / or therapeutic drugs for diseases, so It is very important to decode DM. Object of the invention
  • Another object of the invention is to provide a polynucleotide encoding the polypeptide.
  • Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding a Ras GTPase activating protein 12.
  • Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding a Ras GTPase activating protein 12.
  • Another object of the present invention is to provide a method for producing Ras GTPase activating protein 12.
  • Another object of the present invention is to provide antibodies against the polypeptide of the present invention, Ra s GTPase activating protein 12.
  • Another object of the present invention is to provide mimic compounds, antagonists, agonists, and inhibitors against Ras GTPase activating protein 12 of the polypeptide of the present invention.
  • Another object of the present invention is to provide a method for diagnosing and treating a disease associated with an abnormality of Ras GTPase activating protein 12.
  • the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
  • the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
  • sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 221-254 in SEQ ID NO: 1; and (b) a sequence having 1-4 in SEQ ID NO: 1 31 1-bit sequence.
  • the invention further relates to a vector, in particular an expression vector, containing the polynucleotide of the invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; and a method comprising culturing said Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
  • a vector in particular an expression vector, containing the polynucleotide of the invention
  • a host cell genetically engineered with the vector including a transformed, transduced or transfected host cell
  • a method comprising culturing said Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
  • the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
  • the present invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit Ras GTPase activating protein 12 protein activity, which comprises utilizing the polypeptide of the present invention.
  • the present invention also relates to a method for obtaining a disease or disease susceptibility related to abnormal expression of Ras GTPase activating protein 12 protein in vitro by the method, which comprises detecting the polypeptide or a polynucleotide encoding the same in a biological sample. A mutation in a sequence, or the amount or biological activity of a polypeptide of the invention in a biological sample is detected.
  • the invention also relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
  • the present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention in the manufacture of a medicament for treating cancer, developmental disease or immune disease or other diseases caused by abnormal expression of Ras GTPase activating protein 12.
  • Fig. 1 is a comparison diagram of amino acid sequence homology of a total of 78 amino acids of 23 to 100 Ras GTPase activating protein 12 and characteristic sequence fragments of Ras GTPase activating protein of the present invention.
  • the upper sequence is Ras GTPase activating protein 12, and the lower sequence is the characteristic sequence domain of Ras GTPase activating protein.
  • ⁇ "and”: “and”. “Indicate that the probability that the same amino acid appears between the two sequences decreases in order.
  • Figure 1 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of the isolated Ras GTPase activating protein 12. 12kDa is the molecular weight of the protein. The arrow indicates the isolated protein band.
  • Nucleic acid sequence refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
  • amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
  • a protein or polynucleotide “variant” refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it. The changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence. Variants can have "conservative" changes in which the substituted amino acid has a structural or chemical property similar to the original amino acid, such as the replacement of isoleucine with leucine. Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
  • “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
  • Insertion means that a change in the amino acid sequence or nucleotide sequence results in an increase in one or more amino acids or nucleotides compared to a molecule that exists in nature.
  • Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
  • Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
  • immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response and to bind specific antibodies in a suitable animal or cell.
  • An "agonist” refers to a molecule that, when combined with Ras GTPase activating protein 12, can cause the protein to change, thereby regulating the activity of the protein.
  • An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that can bind Ras GTPase activating protein 12.
  • Antagonist refers to a molecule that, when combined with Ras GTPase activating protein 12, can block or regulate the biological or immunological activity of Ras GTPase activating protein 12.
  • Antagonists and inhibitors can include proteins, nucleic acids, carbohydrates, or any other molecule that can bind Ras GTPase activating protein 12.
  • Regular refers to a change in the function of Ras GTPase activating protein 12, including an increase or decrease in protein activity, a change in binding characteristics, and any other biological, functional, or immune properties of Ras GTPase activating protein 12. change.
  • Substantially pure means substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated.
  • Those skilled in the art can purify Ras GTPase activating protein 12 using standard protein purification techniques.
  • the substantially pure Ras GTPase activating protein 12 produces a single main band on a non-reducing polyacrylamide gel.
  • the purity of Ras GTPase activating protein 12 polypeptide can be analyzed by amino acid sequence.
  • Complementary refers to polynucleotides that naturally bind through base-pairing under conditions of acceptable salt concentration and temperature.
  • the sequence "CTGA” can be combined with the complementary sequence "GA-CT”.
  • the complementarity between two single-stranded molecules may be partial or complete.
  • the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
  • Homology refers to the degree of complementarity and can be partially homologous or completely homologous.
  • Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid.
  • the inhibition of such hybridization can be detected by performing hybridization (Southern blotting or Nor thern blotting, etc.) under conditions of reduced stringency.
  • Substantially homologous sequences or hybridization probes can compete and inhibit the binding of completely homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.
  • Percent identity refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALIGN program (Lasergene sof tware package, DNASTAR, Inc., Madi son Wis.). The MEGALIGN program can compare two or more sequences according to different methods, such as the Cluster method (Higgins, DG and PM Sharp (1988) Gene 73: 237-244). The Cluster method arranges groups of sequences into clusters by checking the distance between all pairs. The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences, such as sequence A and sequence B, is calculated by the following formula: Number of residues matching between sequence ⁇ and sequence ⁇ ⁇
  • the number of residues in sequence ⁇ the number of spacer residues in the sequence-the number of spacer residues in the sequence can also be determined by Clus ter method or by methods known in the art such as Jotun He in J., (1990) Methods in enzymo l ogy 183: 625-645).
  • Similarity refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
  • Amino acids used for conservative substitution for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
  • Antisense refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence.
  • the "antisense strand” refers to a nucleic acid strand that is complementary to the “sense strand”.
  • Derivative refers to HFP or a chemical modification of its nucleic acid. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group.
  • Arecaic acid derivatives encode polypeptides that retain the main biological properties of natural molecules.
  • Antibody refers to a complete antibody molecule and its fragments, such as Fa,? ( ⁇ ') 2 and?, Which specifically bind to the epitope of Ras GTPase activating protein 12.
  • a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
  • isolated refers to the removal of matter from its original environment (for example, its natural environment if it is naturally occurring).
  • a naturally occurring polynucleotide or polypeptide is not isolated when it is present in a living animal, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist in the natural system.
  • Such a polynucleotide may be part of a vector, or such a polynucleotide or polypeptide may be part of a composition. Since the carrier or composition is not part of its natural environment, they are still isolated.
  • isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
  • polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances existing in the natural state. .
  • isolated Ras GTPase activating protein 12 means that Ras GTPase activating protein 12 is substantially free of other proteins, lipids, sugars, or other substances with which it is naturally associated. Those skilled in the art can purify Ras GTPase activating protein 12 using standard protein purification techniques. Substantially pure peptides produce a single main band on a non-reducing polyacrylamide gel. The purity of Ra s GTPase activating protein 12 peptide can be analyzed by amino acid sequence.
  • the present invention provides a new polypeptide, Ras GTPase activating protein 12, which is basically composed of the amino acid sequence shown in SEQ ID NO: 2.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
  • the polypeptides of the invention can be naturally purified products, or chemically synthesized products, or produced using recombinant techniques from prokaryotic or eukaryotic hosts (e.g., bacteria, yeast, higher plants, insects, and mammalian cells). Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
  • the invention also includes fragments, derivatives and analogs of Ras GTPase activating protein 12.
  • fragment refers to a polypeptide that substantially retains the same biological function or activity of the Ras GTPase activator protein 12 of the invention.
  • a fragment, derivative or analog of the polypeptide of the present invention may be: U) a type in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substituted
  • the amino acid may or may not be encoded by the genetic code; or (II) such a type in which a group on one or more amino acid residues is substituted by another group to include a substituent; or (II) A type in which a mature polypeptide is fused to another compound (such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol); or a UV), a polypeptide sequence in which an additional amino acid sequence is fused to a mature polypeptide (such as Leader sequence Secret sequence 'j or the sequence or protease sequence used to purify this polypeptide).
  • such fragments, derivatives and analogs are considered to be within the knowledge of those skilled in the art.
  • the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the polynucleotide sequence of the present invention includes a nucleotide sequence of SEQ ID NO: 1.
  • the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a total nucleotide sequence of 4,311 bases, and its open reading frames 221-544 encode 107 amino acids.
  • This polypeptide has the characteristic sequence of Ras GTPase activating protein, and it can be deduced that the Ras GTPase activating protein 12 has the structure and function represented by the characteristic sequence fragment of Ras GTPase activating protein.
  • the polynucleotide of the present invention may be in the form of DNA or RNA.
  • DNA forms include cDNA, genomic DNA or synthetic DNA.
  • DNA can be single-stranded or double-stranded.
  • D can be a coding or non-coding chain.
  • the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
  • a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
  • the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
  • polynucleotide encoding a polypeptide refers to a polynucleotide that includes the polypeptide and a polynucleotide that includes additional coding and / or non-coding sequences.
  • the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
  • This polynucleotide variant can be a naturally occurring allelic variant or a non-naturally occurring variant.
  • These nucleotide variants include substitution variants, deletion variants, and insertion variants.
  • an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
  • the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity between the two sequences).
  • the invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the invention under stringent conditions.
  • "strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60 ° C; or (2) Add a denaturant during hybridization, such as 50 ° /.
  • the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
  • the invention also relates to nucleic acid fragments that hybridize to the sequences described above.
  • nucleic acid fragment contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 nuclei. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques such as PCR to identify and / or isolate polynucleotides encoding Has GTPase activating protein 12.
  • polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
  • the specific polynucleotide sequence encoding the Ras GTPase activating protein 12 of the present invention can be obtained by various methods.
  • polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
  • the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.
  • genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences.
  • the standard method for isolating the cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library.
  • mRNA extraction There are many mature techniques for mRNA extraction, and kits are also commercially available (Qiagene). It is also a common method to construct a CDM library (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989).
  • Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
  • genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DNA-RNA hybridization; (2) the presence or absence of marker gene functions; (3) determination of the level of Ras GTPase activating protein 12 transcripts; (4) ) Detection of protein products expressed by genes through immunological techniques or determination of biological activity. The above methods can be used singly or in combination.
  • the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
  • the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
  • the probe used here is usually a DNA sequence chemically synthesized based on the gene sequence information of the present invention.
  • the genes or fragments of the present invention can of course be used as probes.
  • DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
  • immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) can be used to detect the protein product of Ras GTPase activating protein 12 gene expression.
  • ELISA enzyme-linked immunosorbent assay
  • Amplification of DNA / RNA by PCR (Saiki, et al. Science 1985; 230: 1350-1354) are preferred for obtaining the genes of the invention.
  • the RACE method RACE-Rapid Amplification of cDNA Ends
  • the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Select and synthesize using conventional methods.
  • the amplified D / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
  • polynucleotide sequence of the gene of the present invention or various D fragments and the like obtained as described above can be measured by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, sequencing needs to be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
  • the present invention also relates to a vector comprising a polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using a Ras GTPase activating protein 12 coding sequence, and a recombinant technology for producing a polypeptide of the present invention method.
  • a polynucleotide sequence encoding a Ras GTPase activating protein 12 may be inserted into a vector to form a recombinant vector containing the polynucleotide of the present invention.
  • vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses or other vectors well known in the art.
  • Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors expressed in bacteria (Rosenberg, et al.
  • any plasmid and vector can be used to construct a recombinant expression vector.
  • An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
  • Methods known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding Ras GTPase activator protein 12 and appropriate transcriptional / translational regulatory elements. These methods include in vitro recombinant DNA technology, DNA synthesis technology, and in vivo recombination technology (Sambroook, et al. Molecular Cloning, a Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989).
  • the DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis. Representative examples of these promoters are: the lac or trp promoter of E.
  • the expression vector also includes a ribosome binding site and a transcription terminator for translation initiation. Insertion of enhancer sequences into the vector will allow it to be used in higher eukaryotic cells Transcription is enhanced.
  • Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers on the late side of the origin of replication, and adenoviral enhancers.
  • the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • GFP fluorescent protein
  • tetracycline or ampicillin resistance for E. coli.
  • a polynucleotide encoding Ras GTPase activating protein 12 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a genetically engineered host cell containing the polynucleotide or the recombinant vector.
  • the term "host cell” refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E.
  • coli Streptomyces
  • bacterial cells such as Salmonella typhimurium
  • fungal cells such as yeast
  • plant cells such as fly S2 or Sf9
  • animal cells such as CH0, COS or Bowes melanoma cells.
  • Transformation of a host cell with a DM sequence according to the present invention or a recombinant vector containing the DNA sequence can be performed by conventional techniques well known to those skilled in the art.
  • the host is a prokaryote such as E. coli
  • competent cells capable of DNA uptake can be in the exponential growth phase were harvested, treated with CaC l 2 method used in steps well known in the art. The alternative is to use MgC l 2 .
  • transformation can also be performed by electroporation.
  • the host is a eukaryotic organism, the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
  • the polynucleotide sequence of the present invention can be used to express or produce recombinant Ras GTPase activating protein 12 through conventional recombinant DNA technology (Scence, 1984; 224: 1431). Generally there are the following steps:
  • the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
  • the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If desired, recombinant proteins can be isolated and purified by various separation methods using their physical, chemical, and other properties. These methods are well known to those skilled in the art.
  • These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
  • polypeptides of the present invention can be directly used in the treatment of diseases, for example, they can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, H IV infection, and immunological diseases.
  • the Ra s gene is an intracellular signal transducer and it is also an oncogene.
  • a variant form of Ras is called a tumor suppressor gene, and it is considered a pathogen of cancer.
  • the normal cellular genes and tumor suppressor genes of Ra s encode chemically related proteins, collectively referred to as ra s p21 protein.
  • Both normal ra s p21 and tumor suppressor gene ra s p21 proteins bind to nucleotides, GTP, and GDP, and slowly hydrolyze GTP to GDP.
  • This intrinsic GTPase activity is stimulated by the cytokine GAP, which is called GTPase activating protein, but it has no effect on GTPase activity related to mutations in tumor suppressor genes.
  • GAP is a cytoplasmic protein that can be transferred from the cytoplasm to the plasma membrane and interacts with P21. Because it is a GTP-bound form of active ra s, these proteins are called negative regulators of
  • Ras tumor suppressor genes are related to the growth of various tumors and involve 10-40% of the most common human cancers, such as bladder cancer, colon cancer, kidney cancer, liver cancer, lung cancer, ovarian cancer, pancreatic cancer, and gastric cancer. This gene is also associated with lymphoid and bone marrow hematopoietic tumors, mesenchymal origin tumors.
  • the present invention includes the peptides of the above peptides, and the antagonists, inhibitors and agonists of the peptides can be used to diagnose, prevent and treat cancer, especially to detect the overexpression of normal or tumor suppressor gene ra s p21 and treat the tumor suppressor by ra s Gene-induced cancer.
  • GTPase-activated protein-specific conserved sequences are required to form their active motifs. It can be seen that abnormal expression of the specific GTPase activating protein mo tif will cause abnormal function of the polypeptide containing the mo tif of the present invention, thereby causing abnormal cell proliferation and causing related diseases such as various tumors and embryo development Disorders, growth disorders, etc.
  • Ras GTPase activating protein 12 of the present invention will produce various diseases, especially various tumors, embryonic developmental disorders, and growth and development disorders.
  • diseases include but are not limited to: Tumors: bladder cancer, colon cancer, kidney cancer, liver cancer, lung cancer, ovarian cancer, pancreatic cancer, gastric cancer, leukemia, lymphoma, bone cancer, osteosarcoma, myeloma, bone marrow cancer, esophageal cancer, breast cancer, thyroid tumor, uterus Myoma, neuroblastoma, astrocytoma, ependymal tumor, glioblastoma, colon cancer, melanoma, adrenal cancer, bladder cancer, brain cancer, uterine cancer, endometrial cancer, gallbladder cancer, nodules Bowel cancer, thymic tumor, nasal cavity and sinus tumor, nasopharyngeal cancer, laryngeal cancer, tracheal tumor, fibroma, fibrosar
  • Embryonic disorders congenital abortion, cleft palate, limb loss, limb differentiation disorder, hyaline membrane disease, atelectasis, polycystic kidney, double ureter, cryptorchidism, congenital inguinal hernia, double uterus, vaginal atresia, suburethral Fissure, hermaphroditism, atrial septal defect, ventricular septal defect, pulmonary stenosis, arterial duct occlusion, neural tube defect, congenital hydrocephalus, iris defect, congenital cataract, congenital glaucoma or cataract, congenital deafness
  • Growth and development disorders mental retardation, cerebral palsy, brain development disorders, mental retardation, familial cerebral nucleus dysplasia syndrome, strabismus, skin, fat and muscular dysplasia such as congenital skin laxity, premature aging Disease, congenital keratosis, various metabolic defects such as various amino acid metabolic defects, stunting, dwarfism, sexual retardation
  • Ra s GTPase activating protein 12 of the present invention will also produce certain hereditary, hematological and immune system diseases.
  • the polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat various diseases, especially various tumors, embryonic developmental disorders, growth and development disorders, and certain inheritances. Sexual, hematological and immune system diseases.
  • the invention also provides methods of screening compounds to identify agents that increase (agonist) or suppress (antagonist) Ras GTPase activating protein 1 2.
  • Agonists increase Ra s GTPase activating protein 1 2 to stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
  • mammalian cells or membrane preparations expressing Ras GTPase activating protein 1 2 can be cultured together with labeled Ras GTPase activating protein 1 2 in the presence of drugs. The ability of the drug to increase or block this interaction is then determined.
  • Antagonists of Ra s GTPase activating protein 1 2 include antibodies, compounds, receptor deletions, and the like that have been screened.
  • the antagonist of R as GTPase activating protein 1 2 can bind to Ras GTPase activating protein 1 2 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot function. biological functions.
  • Ras GTPase activating protein 1 2 When screening compounds as antagonists, Ras GTPase activating protein 1 2 can be added to a bioanalytical assay, and the compound can be identified by measuring the effect of the compound on the interaction between Ras GTPase activating protein 1 2 and its receptor. Whether it is an antagonist. Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds.
  • Polypeptide molecules capable of binding to Ra s GTPase activating protein 1 2 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. When screening, the Ras GTPase activating protein 12 molecule should generally be labeled.
  • the present invention provides a method for producing an antibody using a polypeptide, a fragment, a derivative, an analog thereof, or a cell thereof as an antigen.
  • These antibodies can be polyclonal or monoclonal antibodies.
  • the invention also provides antibodies against Ras GTPase activating protein 12 epitopes. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by Fab expression libraries.
  • Polyclonal antibodies can be produced by injecting Ras GTPase activating protein 12 directly into immunized animals (such as rabbits, mice, rats, etc.).
  • immunized animals such as rabbits, mice, rats, etc.
  • a variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's adjuvant. Wait.
  • Techniques for preparing monoclonal antibodies to Ras GTPase activator protein 12 include, but are not limited to, hybridoma technology (Kohler and Milstein. Nature, 1975, 256: 495-497), triple tumor technology, human beta-cell hybridoma technology, and EBV- Hybridoma technology, etc.
  • Chimeric antibodies that bind human constant regions and non-human variable regions can be produced using existing techniques (Morrison et al, PNAS, 1985, 81: 6851). And existing techniques for producing single-chain antibodies (US Pat No. .4946778) can also be used to produce single chain antibodies against Ras GTPase activator protein 12.
  • Anti-Ras GTPase activating protein 12 antibodies can be used in immunohistochemical techniques to detect Ras GTPase activating protein 12 in biopsy specimens.
  • Monoclonal antibodies that bind to Ras GTPase activating protein 12 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
  • Antibodies can also be used to design immunotoxins that target a particular part of the body.
  • Ras GTPase activating protein 12 has a high affinity monoclonal antibody that can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
  • a common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
  • This hybrid antibody can be used to kill Ras GTPase activating protein 12 positive cells .
  • the antibodies of the present invention can be used to treat or prevent diseases related to Ras GTPase activating protein 12. Administration of an appropriate dose of antibody can stimulate or block the production or activity of Ras GTPase activating protein 12.
  • the invention also relates to a diagnostic test method for quantitative and localized detection of Ras GTPase activating protein 12 levels. These tests are well known in the art and include FISH assays and radioimmunoassays. The level of Ras GTPase activating protein 12 detected in the test can be used to explain the importance of Ras GTPase activating protein 12 in various diseases and to diagnose diseases in which Ras GTPase activating protein 12 plays a role.
  • the polypeptide of the present invention can also be used for peptide mapping analysis.
  • the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
  • the polynucleotide encoding Ras GTPase activating protein 12 can also be used for a variety of therapeutic purposes. Gene therapy technology can be used to treat abnormal cell proliferation, development or metabolism caused by the non-expression or abnormal / inactive expression of Ras GTPase activating protein 12.
  • Recombinant gene therapy vectors can be designed to express mutant Ras GTPase activating protein 12 to inhibit endogenous Ras GTPase activating protein 12 activity.
  • a mutated Ras GTPase activating protein 12 may be a shortened Ras GTPase activating protein 12 lacking a signaling domain, and although it can bind to downstream substrates, it lacks signaling activity. Therefore, recombinant gene therapy vectors can be used to treat diseases caused by abnormal expression or activity of Ras GTPase activating protein 12.
  • Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc.
  • a recombinant polynucleotide encoding Ras GTPase activating protein 12 can be packaged into liposomes and transferred into cells.
  • Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
  • a vector such as a virus, phage, or plasmid
  • Oligonucleotides including antisense RNA and DNA
  • ribozymes that inhibit Ras GTPase activating protein 12 mRNA are also within the scope of the present invention.
  • a ribozyme is an enzyme-like RNA molecule that specifically decomposes a specific RM. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation.
  • Antisense RNA, DNA, and ribozymes can be obtained using any existing RNA or DNA synthesis technology, such as solid-phase phosphoramidite chemical synthesis to synthesize oligonucleotides.
  • Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA. This DNA sequence has been integrated downstream of the vector's RNA polymerase promoter. In order to increase the stability of the nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the linkage between ribonucleosides using phosphate thioester or peptide bonds instead of phosphodiester bonds.
  • the polynucleotide encoding Ras GTPase activating protein 12 can be used for the diagnosis of diseases related to Ras GTPase activating protein 12.
  • the polynucleotide encoding Ras GTPase activating protein 12 can be used to detect the expression of Ras GTPase activating protein 12 or the abnormal expression of Ras GTPase activating protein 12 in a disease state.
  • the DNA sequence encoding Ras GTPase activating protein 12 can be used to hybridize biopsy specimens to determine the expression of Ras GTPase activating protein 12.
  • Hybridization techniques include Southern blotting, Northern blotting, and in situ hybridization. These techniques and methods are publicly available and mature, and related kits are commercially available.
  • a part or all of the polynucleotides of the present invention can be used as probes to be fixed on a microarray or a DNA chip (also known as a "gene chip") for analyzing the difference of genes in tissues. Heterologous analysis and genetic diagnosis.
  • Ras GTPase activating protein 12 specific primers can be used for RNA-polymerase chain reaction (RT-PCR) amplification in vitro to detect Ras GTPase activating protein 12 transcription products.
  • Ras GTPase activating protein 12 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type Ras GTPase activating protein 12 DNA sequence. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression, so Northern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
  • sequences of the invention are also valuable for chromosome identification. This sequence will specifically target a specific position on a human chromosome and can hybridize to it. Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for marking chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DM sequences on a chromosome.
  • a PCR primer (preferably 15-35bp) is prepared from the cDNA, and the sequence can be located on the chromosome. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
  • PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
  • oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
  • Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.
  • Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step.
  • FISH Fluorescent in situ hybridization
  • the differences in cDNA or genomic sequences between the affected and unaffected individuals need to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for staining Structural changes in the body, such as deletions or translocations that are visible from the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).
  • the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
  • suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
  • the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
  • the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell.
  • the polypeptides of the invention can be used in combination with other therapeutic compounds.
  • the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
  • Ras GTPase activating protein 12 is administered in an amount effective to treat and / or prevent a specific indication.
  • the amount and range of Ras GTPase activating protein 12 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician. Examples
  • the Ras GTPase activating protein 12 sequence and the encoded protein sequence of the present invention were subjected to a profile scan program (Basic local alignment search tool) in GCG [Altschul, SF et al. J. Mol. Biol. 1990; 215: 403-10], performing domain analysis in databases such as Prote.
  • the Ras GTPase activating protein 12 of the present invention is homologous with the characteristic sequence fragment of the Ras GTPase activating protein at the domain of 23-100, and the homology result is shown in FIG. 1 with a homology rate of 0.23 and a score of 12.45; the threshold value is 12.27 .
  • Example 3 Cloning of a gene encoding Ras GTPase activating protein 12 by RT-PCR
  • CDNA was synthesized using fetal brain total RNA as a template and oligo-dT as a primer for reverse transcription reaction. After purification with Qiagene's kit, the following primers were used for PCR amplification:
  • Primerl 5'- GGCTTCAAATTGGATGGCACTGCA -3 '(SEQ ID NO: 3)
  • Primer2 5'- CAAAGATGTCTCAGTTTATTAGTT -3 '(SEQ ID NO: 4)
  • Primerl is a forward sequence starting at lbp of the 5th end of SEQ ID NO: 1;
  • Pritner2 is the 3 'end reverse sequence in SEQ ID NO: 1.
  • Amplification conditions 50 ⁇ l reaction volume containing 50 crypto ol / L C1, 10 mraol / L Tris-HCl, pH 8.5, 1.5 mmol / L MgCl 2 , 2 (mol / L dNTP, lOpmol primer, 1U Taq DNA polymerase (Clontech).
  • the reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) under the following conditions for 25 cycles: 94.C 30sec; 55 ° C 30sec; 72 ° C 2min 0 at RT- During PCR, ⁇ -act in was used as a positive control and template blank was used as a negative control.
  • Amplification products were purified using QIAGEN's kit, and TA cloning kit was used to connect to the pCR vector (Invitrogen's product).
  • the results of DNA sequence analysis showed that The DNA sequence of the PCR product is exactly the same as 1-4311bp shown in SEQ ID NO: 1.
  • Example 4 Analysis of the expression of Ras GTPase activating protein 12 gene by Northern blotting method Total RNA was extracted in one step [Anal. Biochem 1987, 162, 156-159] This method involves acid guanidinium thiocyanate phenol-chloroform extraction.
  • RNA precipitate 4M guanidine isothiocyanate-25 mM sodium citrate, 0.2 M sodium acetate (pH 4.0) Homogenize the tissue, add 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1), mix and centrifuge. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water.
  • Electrophoresis was performed on a 1.2% agarose gel containing 2 g of RNA on 20 mM 3- (N-morpholino) propanesulfonic acid (pH 7.0)-5 mM sodium acetate-1 mM EDTA-2.2M formaldehyde. Then transferred to nitrocellulose.
  • oc- 32 P dATP with 32 P- DM labeled probe prepared by random priming SYSTEM. D probes used for PCR amplification shown in FIG Ras GTP GTPase activating protein 12 encoding Sequence (221bp to 544bp).
  • 32P-labeled probe (about 2 x 10 6 cpm / ml) was hybridized with a nitrocellulose membrane to which RNA was transferred at 42 ° C overnight in a solution containing 50% Formamide-25mM KH 2 P0 4 (pH7.4) -5 ⁇ SSC-5 ⁇ Denhardt's solution and 20 ⁇ g / ml salmon sperm DNA. After hybridization, the filter was placed in 1 x SSC-0.1 ° / .SDS Wash at 55 ° C for 30 min. Then, use Phosphor Imager for analysis and quantification.
  • Example 5 In vitro expression, isolation and purification of recombinant Ras GTPase activating protein 12
  • Primer3 5'- CATGCTAGCATGTTGACAGAGTCTTGCTCTATT -3 '(Seq ID No: 5)
  • Primer4 5'- CCCAAGCTTTTATGCTCCTAGTGGAATTGAACC -3' (Seq ID No: 6)
  • the 5 'ends of these two primers contain Nhel and Hindlll restriction sites, respectively.
  • the coding sequences of the 5 'and 3' ends of the target gene are followed, respectively.
  • the Nhel and Hindlll restriction sites correspond to the selective endonucleases on the expression vector plasmid pET-28M +) (Novagen, Cat. No. 69865.3). Site.
  • the pBS-0488H11 plasmid containing the full-length target gene was used as a template for the PCR reaction.
  • the PCR reaction conditions were as follows: a total volume of 50 ⁇ 1 containing 10 PBS-0488H11 plasmid, primers Primer-3 and Primer-4 were lOpmol, Advantage polymerase Mix (Clontech) 1 ⁇ 1, respectively. Cycle parameters: 94 ° C 20s, 60 ° C 30s, 68 ° C 2 min, a total of 25 cycles. Nhel and Hindlll were used to double-digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase.
  • Ligation products were transformed by the calcium chloride method bacteria Escherichia coli DH5cc, after (final concentration of 30 ⁇ 8 / ⁇ 1) grown overnight in LB plates containing kanamycin, positive clones were screened by colony PCR method, and sequenced. A positive clone (pET-0488H11) with the correct sequence was selected, and the recombinant plasmid was transformed into E. coli BL21 (DE3) plySs (product of Novagen) using the calcium chloride method.
  • the following peptides specific for Ras GTPase activating protein 12 were synthesized using a peptide synthesizer (product of PE company): NH 2 -Met-Leu-Thr-Glu-Ser-Cys-Ser-I le-Ala-Gln-Ala-Ala -Thr-Gly-Val-C00H (SEQ ID NO: 7).
  • the polypeptide was coupled to hemocyanin and bovine serum albumin to form a complex, respectively. For methods, see: Avrameas, et al. Immunochemi s try, 1969; 6: 43.
  • Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
  • the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
  • the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
  • the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method.
  • Filter hybridization methods include dot blotting, Southern blotting, Nor thern blotting, and copying methods. They are all used to fix the polynucleotide sample to be tested on the filter and then hybridize using basically the same steps.
  • the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer, so that the non-specific binding site of the sample on the filter is saturated with the carrier and the synthetic polymer.
  • the pre-hybridization solution is then replaced with a hybridization buffer containing the labeled probe and incubated to hybridize the probe to the target nucleic acid.
  • the unhybridized probes are removed by a series of membrane washing steps.
  • This embodiment utilizes higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals.
  • the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; A needle is an oligonucleotide fragment that is partially identical or complementary to the polynucleotide SEQ ID NO: 1 of the present invention.
  • the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
  • oligonucleotide fragments for use as hybridization probes from the polynucleotide SEQ ID NO: 1 of the present invention should follow the following principles and several aspects to be considered:
  • the preferred range of probe size is 18-50 nucleotides
  • GC content is 30% -70%, if it exceeds, non-specific hybridization increases
  • Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements The regions are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, the primary probe should not be used;
  • Probe 1 (probel), which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt)
  • Probe 1 which belongs to the second type of probe, is equivalent to the replacement mutation sequence (41Nt) of the gene fragment or its complementary fragment of SEQ ID NO: 1
  • PBS phosphate buffered saline
  • step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
  • NC membranes nitrocellulose membranes
  • the 32 P-Probe (the second peak is free ⁇ - 32 P-dATP) to be prepared.
  • the sample membrane was placed in a plastic bag, and 3-lOmg prehybridization solution (10xDenhardt-s; 6xSSC, 0.1 mg / ml CT DM (calf thymus DNA)) was added. After sealing the mouth of the bag, shake at 68 ° C for 2 hours.
  • 3-lOmg prehybridization solution (10xDenhardt-s; 6xSSC, 0.1 mg / ml CT DM (calf thymus DNA)
  • Gene chip or gene microarray is a new technology currently being developed by many national laboratories and large pharmaceutical companies.
  • the data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software to achieve the purpose of rapid, efficient, and high-throughput analysis of biological information.
  • the polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research of new gene functions; search for and screen new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases .
  • the specific methods and steps have been reported in the literature for various references.
  • a total of 4,000 polynucleotide sequences of various full-length cDNAs are used as the target DM, including the polynucleotide of the present invention. They were respectively amplified by PCR, and the concentration of the amplified product was adjusted to about 500ng / l after purification, and spotted on a glass medium with a Cartesian 7500 spotter (purchased from Cartesian, USA). The distance between points is 280 ⁇ m. The spotted slides were hydrated, dried, and cross-linked in a purple diplomatic coupling instrument. After elution, the DNA was fixed on a glass slide to prepare a chip. The specific method steps have been reported in the literature. The sample post-processing steps in this embodiment are:
  • Total mRNA was extracted from normal liver and liver cancer by one-step method, and mRNA was purified using Oligotex mRNA Midi Kit (purchased from QiaGen).
  • the fluorescent reagent Cy3dUTP (5- Amino- propargy 1-2 '-deoxyuri dine) was separately reverse-transcribed.
  • Probes from the above two types of tissues were hybridized with the chip in a UniHyb TM Hybridization Solution (purchased from TeleChem) hybridization solution for 16 hours, washed with a washing solution (lx SSC, 0.2% SDS) at room temperature and scanned with ScanArray 3000. Instrument (purchased from General Scanning Company, USA) for scanning. The scanned image is processed with Imagene software (Biodiscovery Company, USA) for data analysis, and the Cy3 / Cy5 ratio of each point is calculated. The point whose ratio is less than 0.5 and greater than 2 is considered as Differentially expressed genes.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Peptides Or Proteins (AREA)

Abstract

L'invention concerne un nouveau polypeptide, une protéine activant la Ras GTPase 12, et un polynucléotide codant pour ce polypeptide ainsi qu'un procédé d'obtention de ce polypeptide par des techniques recombinantes d'ADN. L'invention concerne en outre les applications de ce polypeptide dans le traitement de maladies, notamment des tumeurs malignes, de l'hémopathie, de l'infection par VIH, de maladies immunitaires et de diverses inflammations. L'invention concerne aussi l'antagoniste agissant contre le polypeptide et son action thérapeutique ainsi que les applications de ce polynucléotide codant pour la protéine activant la Ras GTPase 12.
PCT/CN2000/000680 1999-12-27 2000-12-25 Nouveau polypeptide, proteine activant la ras gtpase 12, et polynucleotide codant pour ce polypeptide WO2001047998A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU23411/01A AU2341101A (en) 1999-12-27 2000-12-25 A novel polypeptide - ras gtpase-activating protein 12 and polynucleotide encoding the same

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN99125367.1 1999-12-27
CN 99125367 CN1301712A (zh) 1999-12-27 1999-12-27 一种新的多肽——Ras GTP酶激活蛋白12和编码这种多肽的多核苷酸

Publications (1)

Publication Number Publication Date
WO2001047998A1 true WO2001047998A1 (fr) 2001-07-05

Family

ID=5283894

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2000/000680 WO2001047998A1 (fr) 1999-12-27 2000-12-25 Nouveau polypeptide, proteine activant la ras gtpase 12, et polynucleotide codant pour ce polypeptide

Country Status (3)

Country Link
CN (1) CN1301712A (fr)
AU (1) AU2341101A (fr)
WO (1) WO2001047998A1 (fr)

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1992010572A1 (fr) * 1990-12-07 1992-06-25 Cetus Oncology Corporation Gap natif de type ii, procedes de purification de differents gap et leurs utilisations pour diagnostiquer le cancer
WO1993020201A1 (fr) * 1992-03-31 1993-10-14 Whitehead Institute For Biomedical Research PROTEINE p190 ASSOCIEE AU GAP ET TRANSDUCTION DE SIGNAUX
US5639651A (en) * 1994-08-09 1997-06-17 The General Hospital Corporation Gap-related gene, human IQGAP1
WO1998037196A1 (fr) * 1997-02-25 1998-08-27 Ludwig Institute For Cancer Research Parg, proteine d'activation de gtpase exerçant une interaction avec ptpl1

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1992010572A1 (fr) * 1990-12-07 1992-06-25 Cetus Oncology Corporation Gap natif de type ii, procedes de purification de differents gap et leurs utilisations pour diagnostiquer le cancer
WO1993020201A1 (fr) * 1992-03-31 1993-10-14 Whitehead Institute For Biomedical Research PROTEINE p190 ASSOCIEE AU GAP ET TRANSDUCTION DE SIGNAUX
US5639651A (en) * 1994-08-09 1997-06-17 The General Hospital Corporation Gap-related gene, human IQGAP1
WO1998037196A1 (fr) * 1997-02-25 1998-08-27 Ludwig Institute For Cancer Research Parg, proteine d'activation de gtpase exerçant une interaction avec ptpl1

Also Published As

Publication number Publication date
CN1301712A (zh) 2001-07-04
AU2341101A (en) 2001-07-09

Similar Documents

Publication Publication Date Title
WO2001068694A1 (fr) Nouveau polypeptide, proteine humaine d'hexokinase 10, et polynucleotide codant pour ce polypeptide
WO2001047998A1 (fr) Nouveau polypeptide, proteine activant la ras gtpase 12, et polynucleotide codant pour ce polypeptide
WO2001072793A1 (fr) Nouveau polypeptide, proteine humaine de regulation 12 de la proteine hydrolase, et polynucleotide codant pour ce polypeptide
WO2001070800A1 (fr) Nouveau polypeptide, proteine humaine 11 helicase atp-dependante, et polynucleotide codant pour ce polypeptide
WO2001066770A1 (fr) Nouveau polypeptide, signal peptidase humaine 15, et polynucleotide codant pour ce polypeptide
WO2001079429A2 (fr) Nouveau polypeptide, facteur humain d'echange guanine nucleotide 10, et polynucleotide codant pour ce polypeptide
WO2001072796A1 (fr) Nouveau polypeptide, facteur humain de transcription de la differentiation cellulaire 11, et polynucleotide codant pour ce polypeptide
WO2001048004A1 (fr) Nouveau polypeptide, proteine de liaison de l'heparine 10, et polynucleotide codant pour ce polypeptide
WO2001062782A1 (fr) Nouveau polypeptide, famille proteique 11 de la rhodopsine, et polynucleotide codant pour ce polypeptide
WO2001079432A2 (fr) Nouveau polypeptide, facteur humain de transcription de la differentiation cellulaire 58, et polynucleotide codant pour ce polypeptide
WO2001083687A2 (fr) Nouveau polypeptide, proteine pax humaine 23, et polynucleotide codant pour ce polypeptide
WO2001081594A1 (fr) Nouveau polypeptide, proteine pax humaine 17, et polynucleotide codant pour ce polypeptide
WO2001087949A1 (fr) Nouveau polypeptide, proteine pax humaine 9, et polynucleotide codant pour ce polypeptide
WO2001046409A1 (fr) Nouveau polypeptide, proteine ribosomale s7 9, et polynucleotide codant pour ce polypeptide
WO2001070965A1 (fr) Nouveau polypeptide, facteur humain de regulation de la transcription 15, et polynucleotide codant pour ce polypeptide
WO2001049724A1 (fr) Nouveau polypeptide, proteine lissencephale humaine 43, et polynucleotide codant pour ce polypeptide
WO2001090171A1 (fr) Nouveau polypeptide, proteine humaine ribosomale sii 12, et polynucleotide codant ce polypeptide
WO2001046241A1 (fr) Nouveau polypeptide, proteine 12 gvpa, et polynucleotide codant pour ce polypeptide
WO2001074895A1 (fr) Nouveau polypeptide, facteur humain de transcription de la differentiation cellulaire 12.1, et polynucleotide codant pour ce polypeptide
WO2001081399A1 (fr) Nouveau polypeptide, proteine pax humaine 14, et polynucleotide codant pour ce polypeptide
WO2001073063A1 (fr) Nouveau polypeptide, proteine humaine hexokinase 13, et polynucleotide codant pour ce polypeptide
WO2001072809A1 (fr) Nouveau polypeptide, facteur humain de transcription de la differentiation cellulaire 9, et polynucleotide codant pour ce polypeptide
WO2001072806A1 (fr) Nouveau polypeptide, facteur humain de transcription de la differentiation cellulaire 8, et polynucleotide codant pour ce polypeptide
WO2001081535A2 (fr) Nouveau polypeptide, proteine pax humaine 9.9, et polynucleotide codant pour ce polypeptide
WO2001087951A1 (fr) Nouveau polypeptide, helicase humaine 11, et polynucleotide codant pour ce polypeptide

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
122 Ep: pct application non-entry in european phase
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP