WO2001070800A1 - Nouveau polypeptide, proteine humaine 11 helicase atp-dependante, et polynucleotide codant pour ce polypeptide - Google Patents

Nouveau polypeptide, proteine humaine 11 helicase atp-dependante, et polynucleotide codant pour ce polypeptide Download PDF

Info

Publication number
WO2001070800A1
WO2001070800A1 PCT/CN2001/000186 CN0100186W WO0170800A1 WO 2001070800 A1 WO2001070800 A1 WO 2001070800A1 CN 0100186 W CN0100186 W CN 0100186W WO 0170800 A1 WO0170800 A1 WO 0170800A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
polynucleotide
dependent helicase
human atp
helicase protein
Prior art date
Application number
PCT/CN2001/000186
Other languages
English (en)
Chinese (zh)
Inventor
Yumin Mao
Yi Xie
Original Assignee
Shanghai Biowindow Gene Development Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shanghai Biowindow Gene Development Inc. filed Critical Shanghai Biowindow Gene Development Inc.
Priority to AU44038/01A priority Critical patent/AU4403801A/en
Publication of WO2001070800A1 publication Critical patent/WO2001070800A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/90—Isomerases (5.)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • the present invention belongs to the field of biotechnology. Specifically, the present invention describes a novel polypeptide, human ATP-dependent helicase protein 11, and a polynucleotide sequence encoding the polypeptide. The invention also relates to methods and applications for preparing such polynucleotides and polypeptides. Background
  • RNA structure In many activities of the cell, the regulation of RNA structure, such as the splicing of precursor RNA, the assembly of spliceosome, and protein translation are all necessary regulatory steps. These processes are usually regulated by various helicases. Helicases are detected in many biological systems where RNA plays an important role. They are widely distributed in various tissues and organs from prokaryotes (including viruses) to lower and higher organisms. They are involved in cell and mitochondrial division, RNA editing, rRNA processing, transcription initiation, nuclear mRNA transport and mRNA. Degradation and other processes. Helicases are considered to be important factors in cell development and differentiation, and some of them also play a role in the transcription and replication of viral single-stranded RNA [Arri Eisen, John C. Lucchesi, Bioessays, 1998, 20: 634— 641]. It provides effective means for the diagnosis, prevention and treatment of cancer, nervous system diseases and immune system diseases in vivo.
  • members of the ATP-dependent helicase superfamily contain multiple conserved sequence motifs, some of which are specific to members of the family; while others exist not only in the family members but also in some ATP-binding proteins Also exists.
  • One of these sequence motifs is the "D-E-A-D box” and is present in the B motif of the ATP-binding protein.
  • Other members of the helicase superfamily contain a "D-E- AH box", which has histidine residues in place of asparagine in the "DEA-D box”.
  • the structural motif of the box is Specific to the helicase superfamily.
  • Both the "DEAD box” and the “D-E-AH box” are present in the B structure-motif of the ATP-dependent helicase.
  • the B structure motifs of all members of this family contain the consensus sequence fragments as shown below:
  • This sequence fragment is a key site for regulating the hydrolysis of ATP. Mutation of this motif will lead to the inhibition of ATP hydrolysis, which will affect the normal physiological function of the enzyme. ATP-dependent helicase It is an important regulator in the process of development and differentiation, which is usually related to the occurrence of some diseases of the nervous system, immune system, tumors and cancer in the body.
  • the expression profile of the polypeptide of the present invention is very similar to the expression profile of the human ATP-dependent helicase protein 68, so their functions may also be similar.
  • the invention is named human ATP-dependent helicase protein 1 1.
  • the human ATP-dependent helicase protein 1 1 protein plays an important role in regulating important functions of the body such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes. Therefore, there is always a need to identify more proteins in the art. Many human ATP-dependent helicase proteins, proteins involved in these processes, especially the amino acid sequence of this protein. Isolation of the newcomer's ATP-dependent helicase protein 1 1 protein also provides a basis for research to determine its role in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so it is important to isolate its coding DNA. Object of the invention
  • Another object of the invention is to provide a polynucleotide encoding the polypeptide.
  • Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding a human ATP-dependent helicase protein 1 1.
  • Another object of the present invention is to provide a method for producing a human ATP-dependent helicase protein 1 1.
  • Another object of the present invention is to provide an antibody against the polypeptide of the present invention, human ATP-dependent helicase protein 1 1.
  • Another object of the present invention is to provide mimic compounds, antagonists, agonists, and inhibitors against the polypeptide of the present invention, human ATP-dependent helicase protein 11.
  • Another object of the present invention is to provide a method for diagnosing and treating diseases associated with abnormalities of human ATP-dependent helicase protein 1 1. Summary of invention
  • the present invention relates to an isolated polypeptide, which is of human origin, and includes: a polypeptide having the amino acid sequence of SEQ ID D. 2, or a conservative variant, biologically active fragment, or derivative thereof.
  • the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
  • sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 627 to 935 in SEQ ID NO: 1; and (b) a sequence having positions 1 to 1550 in SEQ ID NO: 1 Sequence of bits.
  • the present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
  • the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
  • the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of human ATP-dependent helicase protein 11 protein, which comprises utilizing the polypeptide of the invention.
  • the invention also relates to compounds obtained by this method.
  • the present invention also relates to a method for in vitro detection of a disease or disease susceptibility associated with abnormal expression of a human ATP-dependent helicase protein 1 1 protein, which comprises detecting a mutation in the polypeptide or a coding polynucleotide sequence thereof in a biological sample Or detecting the amount or biological activity of a polypeptide of the invention in a biological sample.
  • the invention also relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
  • the present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention in the preparation of a medicament for treating cancer, developmental disease or immune disease or other diseases caused by abnormal expression of human ATP-dependent helicase protein 1 1 .
  • FIG. 1 is a comparison diagram of gene chip expression profiles of human ATP-dependent helicase protein 11 and human ATP-dependent helicase protein 68 in the present invention.
  • the upper graph is a graph of the expression profile of human ATP-dependent helicase protein 1 1
  • the lower graph is the graph of expression profile of human ATP-dependent helicase protein 68.
  • Figure 2 is a polyacrylamide gel electrophoresis image (SDS-PAGE) of an isolated human ATP-dependent helicase protein 1 1.
  • l l kDa is the molecular weight of the protein.
  • the arrow indicates the isolated protein band.
  • Nucleic acid sequence refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DM or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
  • amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
  • amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
  • a “variant" of a protein or polynucleotide refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it.
  • the changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence.
  • Variants can have "conservative" changes, in which the amino acid substituted has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine.
  • Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
  • “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
  • Insertion means that a change in the amino acid sequence or nucleotide sequence results in an increase in one or more amino acids or nucleotides compared to a molecule that exists in nature.
  • Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
  • Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
  • immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response and to bind specific antibodies in a suitable animal or cell.
  • An "agonist” refers to a molecule that, when combined with a human ATP-dependent helicase protein 1 1, can cause the protein to change, thereby regulating the activity of the protein.
  • An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that can bind to a human ATP-dependent helicase protein 1 1.
  • Antagonist refers to a biological or immunological activity that can block or regulate human ATP-dependent helicase protein 1 1 when combined with human ATP-dependent helicase protein 1 1 of Molecule.
  • Antagonists and inhibitors can include proteins, nucleic acids, carbohydrates, or any other molecule that can bind to human ATP-dependent helicase protein 11.
  • Regular refers to changes in the function of human ATP-dependent helicase protein 11, including increased or decreased protein activity, changes in binding characteristics, and any other biological properties and functions of human ATP-dependent helicase protein 11. Or changes in immune properties.
  • substantially pure ' means essentially free of other proteins, lipids, sugars or other substances with which it is naturally associated.
  • Those skilled in the art can purify human ATP-dependent helicase protein 11 using standard protein purification techniques.
  • the substantially pure human ATP-dependent helicase protein 11 can generate a single main band on a non-reducing polyacrylamide gel.
  • the purity of the human ATP-dependent helicase protein 11 polypeptide can be analyzed by amino acid sequence.
  • Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
  • sequence C-T-G-A
  • complementary sequence G-A-C-T.
  • the complementarity between two single-stranded molecules may be partial or complete.
  • the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
  • “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
  • Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Southern imprinting or Northern blotting, etc.) under conditions of reduced stringency. Substantially homologous sequences or hybridization probes can compete and inhibit the binding of fully homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.
  • Percent identity refers to the percentage of sequences that are the same or similar in a comparison of two or more amino acid or nucleic acid sequences. Percent identity can be determined electronically, such as through the MEGALIGN program
  • the MEGALIGN program can compare two or more sequences (Higgins, D. G., and
  • the Cluster method arranges groups of sequences into clusters by checking the distance between all pairs. The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula:
  • the percent identity between nucleic acid sequences can also be determined by the Cluster method or by methods known in the art, such as Jotun Hein (Hein L, (1990) Methods in enzytnology 183: 625-645).
  • Similarity refers to the identity of amino acid residues at corresponding positions when aligning amino acid sequences. Or the extent of conservative substitution.
  • Amino acids used for conservative substitution for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
  • Antisense refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence.
  • Antisense strand refers to a nucleic acid strand that is complementary to a “sense strand.”
  • Derivative refers to HFP or a chemical modification of its nucleic acid. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
  • Antibody refers to a complete antibody molecule and its fragments, such as Fa,? ( ⁇ ') 2 and? It can specifically bind to the human ATP-dependent helicase protein 1 1 epitope.
  • a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
  • isolated refers to the removal of matter from its original environment (for example, its natural environment if it is naturally occurring).
  • a naturally occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
  • Such a polynucleotide may be part of a vector, or such a polynucleotide or polypeptide may be part of a composition. Since the carrier or composition is not a component of its natural environment, they are still isolated.
  • isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
  • polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances in the natural state .
  • isolated human ATP-dependent helicase protein 1 1 refers to human ATP-dependent helicase protein 1 1 that is substantially free of other proteins, lipids, carbohydrates, or other substances with which it is naturally associated. Those skilled in the art can purify human ATP-dependent helicase protein 1 1 using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of the human ATP-dependent helicase protein 1 1 polypeptide can be analyzed by amino acid sequence.
  • the present invention provides a new polypeptide, human ATP-dependent helicase protein 1 1, which is basically composed of the amino acid sequence shown in SEQ ID NO: 2.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
  • the polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be obtained from prokaryotic or eukaryotic hosts (such as bacteria, yeast, higher plants, insects and insects) using recombinant technology. Mammalian cells). Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
  • the invention also includes fragments, derivatives, and analogs of human ATP-dependent helicase protein 1 1.
  • fragment refers to a polypeptide that substantially maintains the same biological function or activity of the human ATP-dependent helicase protein 11 of the present invention.
  • a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution
  • the amino acid may or may not be encoded by a genetic codon; or ( ⁇ ) such a type in which one or more amino acid residues are substituted with other groups to include a substituent; or (III) such One, in which the mature polypeptide is fused to another compound (such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol); or (IV) such a polypeptide sequence in which the additional amino acid sequence is fused into the mature polypeptide ( Such as leader sequences or secreted sequences or sequences used to purify this polypeptide or protease sequences).
  • such fragments, and their derivatives and analogs are considered to be within the knowledge of those skilled in the art.
  • the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
  • the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a polynucleotide sequence with a total length of 1550 bases, and its open reading frame 627-935 encodes 102 amino acids.
  • this polypeptide has a similar expression profile with human ATP-dependent helicase protein 68, and it can be inferred that the human ATP-dependent helicase protein 11 is similar to human ATP-dependent helicase protein 68. Functions.
  • the polynucleotide of the present invention may be in the form of DM or RNA.
  • DNA forms include cDNA, genomic DNA, or synthetic DNA.
  • DNA can be single-stranded or double-stranded.
  • DNA can be coding or non-coding.
  • the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
  • a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
  • the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
  • polynucleotide encoding a polypeptide means including a polynucleotide encoding the polypeptide and including additional Coding and / or non-coding polynucleotides.
  • the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
  • Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
  • an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
  • the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity, between the two sequences).
  • the present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions.
  • “strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 6 (TC; or (2) added during hybridization) Use a denaturant, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% Ficoll, 42 ° C, etc .; or (3) the identity between the two sequences is at least 95% Above, it is more preferable that the hybridization occurs only when it is 97 or more. Moreover, the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
  • nucleic acid fragments that hybridize to the sequences described above.
  • a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-6G nucleotides, and most preferably at least 100 cores. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques such as PCR to identify and / or isolate polynucleotides encoding human ATP-dependent helicase protein 11.
  • polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
  • the specific polynucleotide sequence encoding the human ATP-dependent helicase protein 11 of the present invention can be obtained by various methods.
  • polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
  • the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) separating the double-stranded DM sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.
  • genomic DNA isolation is the least commonly used.
  • Direct chemical synthesis of DM sequence is a commonly used method.
  • the more commonly used method is the isolation of cDNA sequences.
  • the standard method for isolating the cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library.
  • the construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989).
  • Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
  • genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DNA-RNA hybridization; (2) the presence or absence of marker gene functions; (3) determination of the level of human ATP-dependent helicase protein 11 transcripts (4) Detecting protein products expressed by genes through immunological techniques or measuring biological activity. The above methods can be used alone or in combination.
  • the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
  • the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
  • the probe used here is usually a DNA sequence chemically synthesized based on the gene sequence information of the present invention.
  • the genes or fragments of the present invention can of course be used as probes.
  • DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
  • immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) can be used to detect protein products expressed by the human ATP-dependent helicase protein 11 gene.
  • ELISA enzyme-linked immunosorbent assay
  • a method using PCR technology to amplify DNA / RM (Saiki, et al. Science 1985; 230: 1350-1354) is preferably used to obtain the gene of the present invention.
  • the RACE method RACE-rapid cDNA end rapid amplification method
  • the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Select and synthesize using conventional methods.
  • the amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
  • polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be measured by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, sequencing needs to be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
  • the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell that is genetically engineered using the vector of the present invention or directly using a human ATP-dependent helicase protein 11 coding sequence, and that the present invention is produced by recombinant technology Polypeptide method.
  • a polynucleotide sequence encoding a human ATP-dependent helicase protein 11 can be inserted into a vector to form a recombinant vector containing the polynucleotide of the present invention.
  • carrier refers to the art Well-known bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses or other vectors.
  • Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors expressed in bacteria (Rosenberg, et al.
  • any plasmid and vector can be used to construct a recombinant expression vector.
  • An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
  • Methods known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding human ATP-dependent helicase protein 11 and appropriate transcription / translation regulatory elements. These methods include in vitro recombinant DNA technology, DNA synthesis technology, and in vivo recombination technology (Sambroook, et al. Molecular Cloning, a Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989).
  • the DNA sequence can be operably linked to an appropriate promoter in the expression vector to guide mRNA synthesis. Representative examples of these promoters are: the lac or trp promoter of E.
  • the expression vector also includes a ribosome binding site for translation initiation and a transcription terminator. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers and adenovirus enhancers on the late side of the origin of replication.
  • the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • GFP fluorescent protein
  • tetracycline or ampicillin resistance for E. coli.
  • a polynucleotide encoding a human ATP-dependent helicase protein 11 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to form a genetically engineered host containing the polynucleotide or the recombinant vector.
  • the term "host cell” refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E.
  • coli Streptomyces
  • bacterial cells such as Salmonella typhimurium
  • fungal cells such as yeast
  • Animal cells insect cells
  • fly S2 or Sf 9 animal cells
  • animal cells such as CH0, COS or Bowes melanoma cells.
  • Transformation of a host cell with a DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art.
  • the host is a prokaryote such as E. coli
  • competent cells capable of DNA uptake can be in the exponential growth phase were harvested, treated with CaC l 2 method used in steps well known in the art. Alternatively, MgCl 2 is used.
  • transformation can also be performed by electroporation.
  • the host is a eukaryotic organism, the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
  • the polynucleotide sequence of the present invention can be used to express or produce recombinant human ATP-dependent helicase protein 11 (Scence, 1984; 224: 1431). Generally, the following steps are taken:
  • the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
  • a suitable method such as temperature conversion or chemical induction
  • the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If necessary, the recombinant protein can be isolated and purified by various separation methods using its physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
  • conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid
  • polypeptides of the present invention can be directly used in the treatment of diseases, for example, they can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection, and immune diseases.
  • the ATP-dependent helicase superfamily is a large family of proteins. ATP-dependent helicases play an important role in many cell activities, such as cell and mitochondrial division, RNA editing, rRM processing, transcription initiation, nuclear mRM transport, and mRNA degradation. .
  • the ATP-dependent helicase family has structural sequences characteristic of DEAD and DEAH boxes. Helicase is considered It is an important factor in the process of cell development and differentiation, and some of them also play a role in the transcription and replication of viral single-stranded RNA [Arr i E. etal., 1 998].
  • the abnormal expression of the human ATP-dependent helicase protein 1 1 of the present invention will produce various diseases, especially various tumors, embryonic developmental disorders, and disorders of growth and development. These diseases include, but are not limited to:
  • Carcinogenesis of various tissues gastric cancer, liver cancer, lung cancer, esophageal cancer, breast cancer, leukemia, lymphoma, thyroid tumor, uterine fibroid, ovarian tumor, neuroblastoma, astrocytoma, ependymoma, glial Cell tumor, colon cancer, malignant histiocytosis, melanoma, teratoma, sarcoma, adrenal cancer, bladder cancer, bone cancer, osteosarcoma, myeloma, bone marrow cancer, brain cancer, uterine cancer, endometrial cancer, gallbladder Cancer, thymic tumor, nasal cavity and sinus tumor, nasopharyngeal cancer, laryngeal cancer, tracheal tumor, pleural mesothelioma, fibroid, fibrosarcoma, lipoma, liposarcoma, leiomyoma
  • Growth and development disorders mental retardation, cerebral palsy, brain development disorders, mental retardation, familial cerebral nucleus dysplasia syndrome, strabismus, skin, fat and muscular dysplasia such as congenital skin laxity, premature aging Disease, congenital keratosis, various metabolic defects such as various amino acid metabolic defects, stunting, dwarfism, sexual retardation
  • Fetal developmental disorders congenital abortion, cleft palate, limb loss, limb differentiation disorder, congenital umbilical hernia, hyaline membrane disease, congenital pulmonary cyst, atelectasis, polycystic kidney disease, double ureter, umbilical fistula, cryptorchidism, Congenital inguinal hernia, double uterus, vaginal atresia, hermaphroditism, atrial septal defect, ventricular septal defect, abnormal arterial stem separation, aortic or pulmonary stenosis, pulmonary stenosis, open ductus arteriosus, neural tube defects, congenital hydrocephalus , Iris defect, congenital cataract, congenital glaucoma or cataract, congenital deafness
  • Abnormal expression of the human ATP-dependent helicase protein 11 of the present invention will also cause certain hereditary, hematological and immune system diseases.
  • the invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) human ATP-dependent helicase protein 11.
  • Agonists enhance human ATP-dependent helicase protein 11 to stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to cell proliferation, such as various cancers.
  • mammalian cells or human ATP-dependent snails can be expressed.
  • Membrane preparations of gyrase 11 were cultured with labeled human ATP-dependent helicase protein 11. The ability of the drug to increase or block this interaction is then determined.
  • Antagonists of human ATP-dependent helicase protein 11 include screened antibodies, compounds, receptor deletions, and the like. Antagonists of human ATP-dependent helicase protein 11 can bind to human ATP-dependent helicase protein 11 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide to make the polypeptide Cannot perform biological functions.
  • human ATP-dependent helicase protein 11 When screening compounds as antagonists, human ATP-dependent helicase protein 11 can be added to a bioanalytical assay by measuring the effect of the compound on the interaction between human ATP-dependent helicase protein 11 and its receptor. Determine if the compound is an antagonist. Receptor deletions and analogs that act as antagonists can be screened in the same way as for screening compounds described above. Polypeptide molecules capable of binding to human ATP-dependent helicase protein 11 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. In screening, human ATP-dependent helicase protein 11 molecules should generally be labeled.
  • the present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies.
  • the invention also provides antibodies against human ATP-dependent helicase protein 11 epitopes. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by Fab expression libraries.
  • Polyclonal antibodies can be produced by injecting human ATP-dependent helicase protein 11 directly into immunized animals (such as rabbits, mice, rats, etc.).
  • immunized animals such as rabbits, mice, rats, etc.
  • a variety of adjuvants can be used to enhance the immune response, including but not limited to 'S adjuvant and so on.
  • Techniques for preparing monoclonal antibodies to human ATP-dependent helicase protein 11 include, but are not limited to, hybridoma technology (Kohler and Milstein. Nature, 1975, 256: 495-497), triple tumor technology, and human B-cell hybridoma technology , EBV-hybridoma technology, etc.
  • Chimeric antibodies that bind human constant regions to non-human-derived variable regions can be produced using existing techniques (Morrison et al, PNAS, 1985, 81: 6851).
  • the existing technology for producing single chain antibodies U. S. Pat No. 4946778, can also be used to produce single chain antibodies against human ATP-dependent helicase protein 11.
  • Antibodies against human ATP-dependent helicase protein 11 can be used in immunohistochemical techniques to detect human ATP-dependent helicase protein 11 in biopsy specimens.
  • Monoclonal antibodies that bind to human ATP-dependent helicase protein 11 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
  • Antibodies can also be used to design immunotoxins that target a particular part of the body.
  • Human ATP-dependent solution Helix enzyme protein 11 high affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
  • a common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
  • This hybrid antibody can be used to kill human ATP-dependent helicase protein 11 Positive cells.
  • the antibodies of the present invention can be used to treat or prevent diseases associated with human ATP-dependent helicase protein 11.
  • Administration of appropriate doses of antibodies can stimulate or block the production or activity of human ATP-dependent helicase protein 11.
  • the invention also relates to a diagnostic test method for quantitative and localized detection of human ATP-dependent helicase protein 11 levels. These tests are well known in the art and include FISH assays and radioimmunoassays. The level of human ATP-dependent helicase protein 11 detected in the test can be used to explain the importance of human ATP-dependent helicase protein 11 in various diseases and to diagnose human ATP-dependent helicase protein 11 A working disease.
  • polypeptide of the present invention can also be used for peptide mapping analysis.
  • the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, more preferably mass spectrometry analysis.
  • Polynucleotides encoding human ATP-dependent helicase protein 11 can also be used for a variety of therapeutic purposes. Gene therapy technology can be used to treat abnormal cell proliferation, development or metabolism caused by the non-expression or abnormal / inactive expression of human ATP-dependent helicase protein 11.
  • Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated human ATP-dependent helicase protein 11 to inhibit endogenous human ATP-dependent helicase protein 11 activity.
  • a mutant human ATP-dependent helicase protein 11 may be shortened and lack a signal transduction domain of human ATP-dependent helicase protein 11. Although it can bind to downstream substrates, it lacks signal transduction activity. .
  • recombinant gene therapy vectors can be used to treat diseases caused by abnormal expression or activity of human ATP-dependent helicase protein 11.
  • Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, and parvovirus can be used to transfer the polynucleotide encoding human ATP-dependent helicase protein 11 into cells.
  • Methods for constructing recombinant viral vectors carrying polynucleotides encoding human ATP-dependent helicase protein 11 can be found in the literature (Sambrook, et al.).
  • a polynucleotide encoding human ATP-dependent helicase protein 11 can be packaged into liposomes and transferred into cells.
  • Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
  • a vector such as a virus, phage, or plasmid
  • Oligonucleotides including antisense RNA and DNA
  • ribozymes that inhibit human ATP-dependent helicase protein 11 mRNA are also within the scope of the present invention.
  • a ribozyme is an enzyme-like RNA that specifically breaks down specific RNAs Molecules, whose mechanism of action is endonucleation after specific hybridization of ribozyme molecules with complementary target RNAs.
  • Antisense RNA, DNA, and ribozymes can be obtained by any existing RNA or DNA synthesis technology, such as the technology for the synthesis of oligonucleotides by solid-phase phosphoramidite chemical synthesis has been widely used.
  • Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA. This DM sequence has been integrated downstream of the vector's RNA polymerase promoter. In order to increase the stability of a nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the ribonucleoside linkages should use phosphate thioester or peptide bonds instead of phosphodiester bonds.
  • the polynucleotide encoding human ATP-dependent helicase protein 1 1 can be used for diagnosis of diseases related to human ATP-dependent helicase protein 1 1.
  • Polynucleotides encoding human ATP-dependent helicase protein 1 1 can be used to detect the expression of human ATP-dependent helicase protein 1 1 or abnormal expression of human ATP-dependent helicase protein 1 1 in disease states .
  • a DNA sequence encoding human ATP-dependent helicase protein 1 1 can be used to hybridize biopsy specimens to determine the expression of human ATP-dependent helicase protein 1 1.
  • Hybridization techniques include Sout hern blotting, Nor t hern blotting, in situ hybridization, and the like.
  • Human ATP-dependent helicase protein 1 1 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to normal wild-type human ATP-dependent helicase protein 1 1 DNA sequences. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect the expression of proteins. Therefore, Nor thern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
  • sequences of the invention are also valuable for chromosome identification. This sequence will specifically target a specific position on a human chromosome and can hybridize to it. Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for marking chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DNA sequences on a chromosome.
  • PCR primers (preferably 15-35 bp) are prepared based on cDNA, and the sequences can be mapped on chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those hybrid cells that contain the human gene corresponding to the primer will produce amplified fragments.
  • PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
  • oligonucleotide primers of the present invention by a similar method, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
  • Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and hybrid pre-selection to build chromosome-specific CDM libraries.
  • Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step.
  • FISH Fluorescent in situ hybridization
  • the difference in cDNA or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).
  • the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
  • suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
  • the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
  • the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell.
  • the polypeptides of the invention can be used in combination with other therapeutic compounds.
  • the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
  • Human ATP-dependent helicase protein 11 is administered in an amount effective to treat and / or prevent a specific indication. Human ATP-dependent helicase egg The amount and dosage range of White 11 will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician. Examples
  • Total human fetal brain RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform.
  • Poly (A) mRNA was isolated from total RNA using Quik mRNA Isolation Kit (Qiegene). 2ug poly (A) mRNA is reverse transcribed to form cDNA.
  • the Smart cDNA cloning kit purchased from Clontech was used to insert the cDNA fragment into the multiple cloning site of the pBSK (+) vector (Clontech) to transform DH5a. The bacteria formed a cDNA library.
  • Dye terminate cycle react ion sequencing kit Perkin-Elmer
  • ABI 377 automatic sequencer Perkin-Elmer
  • the determined cDNA sequence was compared with the existing public DNA sequence database (Genebank).
  • Genebank public DNA sequence database
  • a series of primers were synthesized to determine the inserted cDNA fragments of the clone in both directions. The results showed that, 0416g03 length cDNA clone of 1550 bp contained (e.g.
  • Seq IDN0: 1 shown from 6 2 7bp a 309bp to 935bp open reading frame (ORF), encoding a novel protein (e.g. Seq ID NO: 2).
  • This clone pBS-0416g03 and named the encoded protein as human ATP-dependent helicase protein 11.
  • Example 2 The gene encoding human ATP-dependent helicase protein 11 was cloned by RT-PCR method. The total RNA from fetal brain cells was used as a template, and oligo-dT was used as a primer for reverse transcription reaction to synthesize cDNA. After purification using Qiagene's kit, , Using the following primers for PCR amplification:
  • Primer2 5,-ACAGTCTCGCTCTGCCATTCAGGC-3, (SEQ ID NO: 4)
  • Primerl is a forward sequence located at the 5th end of SEQ ID NO: 1, starting at lbp;
  • Primer2 is the 3, terminal reverse sequence of SEQ ID NO: 1.
  • Amplification reaction conditions 50 ⁇ l / L KC1, 10 ⁇ l / L Tris-HCl, pH8.5, 1.5mmol / L MgCl 2) 200 ⁇ ⁇ 1 / ⁇ dNTP, lOpmol Primer, 1U Taq DNA Polymerase (Clontech).
  • the reaction was performed on a PE9600 DM thermal cycler (Perkin-Elmer) for 25 cycles under the following conditions: 94. C 30sec; 55 ° C 30sec; 72 ° C 2min.
  • p-actin was set as a positive control and template blank was set as a negative control.
  • the tissue is homogenized with 4M guanidine isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1) are added. ), Mix and centrifuge. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water.
  • a 32P-labeled probe (about 2 x 10 6 cpra / ml) was hybridized with a nitrocellulose membrane to which RNA was transferred at 42 ° C overnight in a solution containing 50% formamide-25mM KH 2 P0 4 (pH7.4)-5 ⁇ SSC-5 ⁇ Denhardt's solution and 20 ⁇ g / ml salmon sperm DNA. After hybridization, the filter was washed in 1 X SSC-0.1 ° /. SDS at 55 ° C for 30 minutes. Then Phosphor Imager was used for analysis and quantification.
  • Example 4 In vitro expression, isolation and purification of recombinant human ATP-dependent helicase protein 11 Based on the sequence of the coding region shown in SEQ ID NO: 1 and Figure 1, a pair of specific sexual amplification primer, the sequence is as follows:
  • Primer3 5'- CATGCTAGCATGCAAGAGACAGAGACGCTCTGC -3 '(Seq ID No: 5)
  • Primer4 5,-CCCGAATTCTTAAAGGGGAAGTGAACTCTTACC -3, (Seq ID No: 6)
  • the 5' ends of these two primers contain Nhel and EcoRI restriction sites, respectively.
  • the coding sequences of the 5 'and 3' ends of the gene of interest are followed, respectively.
  • the Nhel and EcoRI restriction sites correspond to the selectivity within the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865.3). Digestion site.
  • PCR reaction conditions were: 1 in a total volume of 50 ⁇ plasmid pBS-0416g03 containing 10pg, primers Pr imer-3, and other points Pr imer-4 j is 1 Opmol, Advantage polymerase Mix (Clontech Products) 1 ⁇ 1!.
  • Cycle parameters 94. C 20s, 60 ° C 30s, 68. C 2 min, a total of 25 cycles.
  • Nhel and EcoRI were used to double digest the amplified product and plasmid pET-28 (+), respectively. Do not recover large fragments and ligate with T4 ligase.
  • the ligation product was transformed into the colibacillus DH5 G using the calcium chloride method. After culturing overnight on LB plates containing kanamycin (final concentration 3 (g / ral)), positive clones were screened by colony PCR method and sequenced. Positive clones with correct sequence (PET-0416g03) were transformed into E. coli BL21 (DE3) plySs (product of Novagen) with calcium chloride method.
  • NH2-Met-Gln-Glu-Thr-Glu-Thr-Leu-Cys-Pro-Lys-Gln-Gly-Ile-Trp-Asp-C00H (SEQ ID NO: 7).
  • the polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex.
  • hemocyanin and bovine serum albumin For methods, see: Avrameas, et al. Immunochemistry, 1969; 6: 43. Rabbits were immunized with 4 mg of the hemocyanin-polypeptide complex plus complete Freund's adjuvant, and 15 days later, the hemocyanin-polypeptide complex plus incomplete Freund's adjuvant was used to boost immunity once.
  • a titer coated with a 15 g / ml bovine serum albumin peptide complex was used as an ELISA to determine antibody titers in rabbit serum.
  • Total IgG was isolated from antibody-positive rabbit serum using protein A-Sepharose.
  • the peptide was bound to a cyanogen bromide-activated Sepharose4B column, and anti-peptide antibodies were separated from the total IgG by affinity chromatography.
  • the immunoprecipitation method proved that the purified antibody could specifically bind to human ATP-dependent snail enzyme protein 11.
  • Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
  • the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is identified whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
  • the probe can also be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissues or ⁇ Whether the expression in tissue cells is abnormal.
  • the purpose of this example is to select a suitable oligonucleoside from the polynucleotide SEQ ID NO: 1 of the present invention
  • the acid fragment is used as a hybridization probe, and the membrane hybridization method is used to identify whether some tissues contain the polynucleotide sequence of the present invention or a homologous polynucleotide sequence.
  • Filter hybridization methods include dot blotting, Sou thern blotting, Nor thern blotting, and copying methods. They are all used to fix the polynucleotide sample to be tested on the filter and then hybridize using basically the same steps.
  • the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer, so that the non-specific binding site of the sample on the filter is saturated with the carrier and the synthetic polymer.
  • the pre-hybridization solution is then replaced with a hybridization buffer containing the labeled probe and incubated to hybridize the probe to the target nucleic acid.
  • the unhybridized probes are removed by a series of membrane washing steps.
  • This embodiment utilizes higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals.
  • the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
  • the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
  • the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
  • oligonucleotide fragments for use as hybridization probes from the polynucleotide SEQ ID NO: 1 of the present invention should follow the following principles and several aspects to be considered:
  • the preferred range of probe size is 18-50 nucleotides
  • Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements For homology comparison of the regions, if the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, the primary probe should not be used generally;
  • Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
  • Probe 2 which belongs to the second type of probe, is equivalent to the replacement mutant sequence of the gene fragment of SEQ ID NO: 1 or its complementary fragment (41Nt):
  • PBS phosphate buffered saline
  • step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
  • NC membranes nitrocellulose membranes
  • the sample membrane was placed in a plastic bag, and 3-1 Omg pre-hybridization solution (lOxDenhardt's; 6xSSC, 0.1 mg / ml CT DNA (calf thymus DM)) was added. After sealing the bag, shake at 68 ° C for 2 hours.
  • 3-1 Omg pre-hybridization solution (lOxDenhardt's; 6xSSC, 0.1 mg / ml CT DNA (calf thymus DM)
  • Gene chip or DNA microarray is a new technology that many national laboratories and large pharmaceutical companies are currently developing and developing. It refers to the orderly and high-density arrangement of large numbers of target gene fragments on glass, The data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software to achieve the purpose of rapid, efficient, and high-throughput analysis of biological information.
  • the polynucleoside hinge of the present invention can be used as a target DM for gene chip technology for high-throughput research of new gene functions; searching for and screening new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases .
  • the specific method steps have been reported in the literature. For example, see DeRisi, JL, Lyer, V. & Brown, P.0. (1997) Science 278, 680-686. And Helle, RA, Schema, M. ., Chai, A., Shalom, D., (1997) PNAS 94: 2150-2155.
  • a total of 4,000 polynucleotide sequences of various full-length cDNAs are used as target DNA, including the polynucleotide of the present invention. They were respectively amplified by PCR. After purification, the concentration of the amplified product was adjusted to about 500 ng / ul, and spotted on a glass medium with a Cartesian 7500 spotter (purchased from Cartesian Company, USA), between the points. The distance is 280yrn. The spotted slides were hydrated and dried, cross-linked in a UV cross-linker, and dried after elution to fix the DNA on the glass slides to prepare chips. The specific method steps have been reported in the literature. The sample post-processing steps in this embodiment are:
  • Total mRNA was extracted from human mixed tissues and specific tissues (or stimulated cell lines) in one step, and the mRNA was purified using Oligotex mRNA Midi Kit (purchased from QiaGen), and the fluorescent reagent was separated by reverse transcription.
  • Cy3dUTP (5-Araino-propargyl-2'-deoxyuridine 5'-triphate coupled to Cy3 fluorescent dye, purchased from Amersham Phamacia Biotech) was used to label mRNA of human mixed tissues, and the fluorescent reagent Cy5dUTP (5- Amino-propargyl- 2'- Deoxyuridine 5'-triphate coupled to Cy5 fluorescent dye, purchased from Amersham Phamacia Biotech, labeled the body's specific tissue (or stimulated cell line) mRNA, and purified the probe to prepare a probe.
  • Cy3dUTP (5-Araino-propargyl-2'-deoxyuridine 5'-triphate coupled to Cy3 fluorescent dye, purchased from Amersham Phamaci
  • the probes from the two types of tissues and the chips were hybridized in a UniHyb TM Hybridization Solution (purchased from TeleChem) hybridization solution for 16 hours, washed with a washing solution (1> ⁇ SSC, 0.2% SDS) at room temperature, and then scanned with ScanArray.
  • 3000 scanner purchased from General Scanning, USA for scanning, and the scanned images were processed with Imagene software (Biodiscovery, USA) for data Analyze and calculate the Cy3 / Cy5 ratio of each point.
  • the above specific tissues are thymus, testis, muscle, spleen, lung, skin, thyroid, liver, PMA + Ecv304 cell line, PMA-Ecv304 cell line, non-starved L02 cell line, Arsenic stimulated the L02 cell line and prostate tissue for 1 hour. Based on these 13 Cy3 / Cy5 ratios, draw a bar graph ( Figure 1). It can be seen from the figure that the expression profiles of human ATP-dependent helicase protein 11 and human ATP-dependent helicase protein 68 according to the present invention are very similar.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Enzymes And Modification Thereof (AREA)

Abstract

L'invention concerne un nouveau polypeptide, une protéine humaine 11 hélicase ATP-dépendante, et un polynucléotide codant pour ce polypeptide ainsi qu'un procédé d'obtention de ce polypeptide par des techniques recombinantes d'ADN. L'invention concerne en outre les applications de ce polypeptide dans le traitement de maladies, notamment des tumeurs malignes, de l'hémopathie, de l'infection par VIH, de maladies immunitaires et de diverses inflammations. L'invention concerne aussi l'antagoniste agissant contre le polypeptide et son action thérapeutique ainsi que les applications de ce polynucléotide codant pour la protéine humaine 11 hélicase ATP-dépendante.
PCT/CN2001/000186 2000-03-10 2001-02-26 Nouveau polypeptide, proteine humaine 11 helicase atp-dependante, et polynucleotide codant pour ce polypeptide WO2001070800A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU44038/01A AU4403801A (en) 2000-03-10 2001-02-26 A novel polypeptide-human atp-dependent helicase protein 11 and a polynucleotidesequence encoding the same

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN00111976.1 2000-03-10
CN 00111976 CN1313397A (zh) 2000-03-10 2000-03-10 一种新的多肽——人atp依赖的解螺旋酶蛋白11和编码这种多肽的多核苷酸

Publications (1)

Publication Number Publication Date
WO2001070800A1 true WO2001070800A1 (fr) 2001-09-27

Family

ID=4581872

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2001/000186 WO2001070800A1 (fr) 2000-03-10 2001-02-26 Nouveau polypeptide, proteine humaine 11 helicase atp-dependante, et polynucleotide codant pour ce polypeptide

Country Status (3)

Country Link
CN (1) CN1313397A (fr)
AU (1) AU4403801A (fr)
WO (1) WO2001070800A1 (fr)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111349169A (zh) * 2018-12-21 2020-06-30 艾比玛特医药科技（上海）有限公司 Werner综合征ATP依赖性解旋酶的单克隆抗体及其应用

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
J. BIOL. CHEM., vol. 268, no. 22, 1993, pages 16822 - 16830 *
J. BIOL. CHEM., vol. 269, no. 47, 1994, pages 29838 - 29845 *
J. BIOL. CHEM., vol. 270, no. 27, 1995, pages 16422 - 16427 *
J. BIOL. CHEM., vol. 272, no. 17, 1997, pages 11487 - 11494 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111349169A (zh) * 2018-12-21 2020-06-30 艾比玛特医药科技（上海）有限公司 Werner综合征ATP依赖性解旋酶的单克隆抗体及其应用
CN111349169B (zh) * 2018-12-21 2023-06-16 艾比玛特医药科技（上海）有限公司 Werner综合征ATP依赖性解旋酶的单克隆抗体及其应用

Also Published As

Publication number Publication date
AU4403801A (en) 2001-10-03
CN1313397A (zh) 2001-09-19

Similar Documents

Publication Publication Date Title
WO2001070800A1 (fr) Nouveau polypeptide, proteine humaine 11 helicase atp-dependante, et polynucleotide codant pour ce polypeptide
WO2001081594A1 (fr) Nouveau polypeptide, proteine pax humaine 17, et polynucleotide codant pour ce polypeptide
WO2001079434A2 (fr) Nouveau polypeptide, signal peptidase humaine 10, et polynucleotide codant pour ce polypeptide
WO2001079432A2 (fr) Nouveau polypeptide, facteur humain de transcription de la differentiation cellulaire 58, et polynucleotide codant pour ce polypeptide
WO2001062782A1 (fr) Nouveau polypeptide, famille proteique 11 de la rhodopsine, et polynucleotide codant pour ce polypeptide
WO2001049724A1 (fr) Nouveau polypeptide, proteine lissencephale humaine 43, et polynucleotide codant pour ce polypeptide
WO2001066770A1 (fr) Nouveau polypeptide, signal peptidase humaine 15, et polynucleotide codant pour ce polypeptide
WO2001046409A1 (fr) Nouveau polypeptide, proteine ribosomale s7 9, et polynucleotide codant pour ce polypeptide
WO2001079429A2 (fr) Nouveau polypeptide, facteur humain d'echange guanine nucleotide 10, et polynucleotide codant pour ce polypeptide
WO2001049737A1 (fr) Nouveau polypeptide, latexine proteine humaine 46, et polynucleotide codant pour ce polypeptide
WO2001072801A1 (fr) Nouveau polypeptide, proteine ribosomale humaine s11 12, et polynucleotide codant pour ce polypeptide
WO2001072794A1 (fr) Nouveau polypeptide, helicase 16, et polynucleotide codant pour ce polypeptide
WO2001081399A1 (fr) Nouveau polypeptide, proteine pax humaine 14, et polynucleotide codant pour ce polypeptide
WO2001047998A1 (fr) Nouveau polypeptide, proteine activant la ras gtpase 12, et polynucleotide codant pour ce polypeptide
WO2001087951A1 (fr) Nouveau polypeptide, helicase humaine 11, et polynucleotide codant pour ce polypeptide
WO2001072817A1 (fr) Nouveau polypeptide, serine hydrolase humaine atp-dependante 11, et polynucleotide codant pour ce polypeptide
WO2001048199A1 (fr) Nouveau polypeptide, proteine ribosomale s10 14, et polynucleotide codant pour ce polypeptide
WO2001047967A1 (fr) Nouveau polypeptide, famille des proteines 11 du groupe de haute mobilite, et polynucleotide codant pour ce polypeptide
WO2001079437A2 (fr) Nouveau polypeptide, facteur humain de transcription de la differentiation cellulaire 14, et polynucleotide codant pour ce polypeptide
WO2001073063A1 (fr) Nouveau polypeptide, proteine humaine hexokinase 13, et polynucleotide codant pour ce polypeptide
WO2001090171A1 (fr) Nouveau polypeptide, proteine humaine ribosomale sii 12, et polynucleotide codant ce polypeptide
WO2001071000A1 (fr) Nouveau polypeptide, znt-1-22, et polynucleotide codant pour ce polypeptide
WO2001090168A1 (fr) Nouveau polypeptide, une proteine humaine 10 de l'helicase atp-dependante, et polynucleotide codant ce polypeptide
WO2001081386A1 (fr) Nouveau polypeptide, proteine pax humaine 12.5, et polynucleotide codant pour ce polypeptide
WO2001047964A1 (fr) Nouveau polypeptide, helicase atp-dependante 68, et polynucleotide codant pour ce polypeptide

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP