WO2001055427A1 - Nouveau polypeptide, proteine humaine kelch 19, et polynucleotide codant pour ce polypeptide - Google Patents
Nouveau polypeptide, proteine humaine kelch 19, et polynucleotide codant pour ce polypeptide Download PDFInfo
- Publication number
- WO2001055427A1 WO2001055427A1 PCT/CN2001/000057 CN0100057W WO0155427A1 WO 2001055427 A1 WO2001055427 A1 WO 2001055427A1 CN 0100057 W CN0100057 W CN 0100057W WO 0155427 A1 WO0155427 A1 WO 0155427A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- polypeptide
- polynucleotide
- protein
- human
- sequence
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
Definitions
- the present invention belongs to the field of biotechnology. Specifically, the present invention describes a new polypeptide, a human kelch protein 19, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a method and application for preparing such polynucleotides and polypeptides. Background technique
- Intercellular communication plays an important role in multicellular organisms. Because of the delicate division of labor between cells, some cell populations depend on other cell populations and require other cell populations to respond to them. This sophisticated intercellular communication network can control cell growth, division, death, differentiation to form tissues, and various other life processes.
- the formation of loops is related to actin fibers. It is now known that there are a number of genes involved in the assembly and function of the loop, one of which is a family of genes containing the Kelch domain.
- the Kelch protein family contains two common structures, with a BTB / P0Z region at the end of N and a kelch repeat at the end of C [Sol tys ik-Espanola M et al, Mol biol Cel l 1999 Jul].
- the Kelch domain is a 50 amino acid residue domain that was first discovered in mutants of Drosophila. This domain appears six times in Drosophila egg compartment regulatory proteins and is also found in the murine protein MIPP and some pox viruses. [CELL 72 681-693 (1993)] In addition, Kelch repeats in ⁇ , ⁇ -scruin [L CELL SCIENCE 108 3155-3162 (1995) ⁇ ] [L CELL BIOL. 128 51-60 (1995)] and fungal It is found in galactose oxidase [J. MOL. BIOL. 236 1277-1282 (1994).].
- the Kelch protein family plays an important role in the physiological processes related to the cytoskeleton during development, such as loop formation, nerve fiber localization, cell fusion, and cell morphogenesis [Sol tys ik-espanola M, Mol biol Cel l 1999; Phi l ips J, J Cel l biol 1998;].
- the kelch protein is located on the inner side of the loop, which keeps the side of the loop tightly bound.
- Kelch protein mutations can prevent the process by which guard trophoblast cells around the egg can transport cytoplasm to the egg through the loop [Xue F, Coo ley L, Cel l 1993 Mar 12].
- Kel-1 protein causes early growth arrest in larvae [Ohmachi M, genes Cel ls 1999]. Since the loop structure and kelch structure protein were found in the sperm and egg formation of many organisms including humans, it can be considered that the effect of kelch protein on sperm and egg formation is universal. Another example is that the kelch protein Mayven found in the brain may play a role in the dynamic organization of the brain cell actin cytoskeleton [Sol tys ik-Espanola M, ⁇ Biol Cel l 1999].
- Kelch domain-containing protein is not exactly the same: in addition to its role in the cytoskeleton in tubulin, it has also been found in some other proteins:
- scruin is a motor protein cross-linking protein, which is located at the top of the sperm Plays an important role in somatic formation; galactose oxidase found in fungi catalyzes the oxidation of the hydroxyl group at the C6 position of D-galactose; neuraminidase (sialidase) hydrolyzes the sialic acid residues of glycoproteins, which are generally present It is found in lysosomes, but also exists in secreted form. It also exists on the surface of some viruses, bacteria, fungi and protozoa. For example, this enzyme is necessary for influenza virus infection.
- the polypeptide of the present invention contains a kelch domain, and thus is considered to be a new kelch protein, and is presumed to have similar biological functions, and is named human kelch protein XX.
- the human kelch protein 19 protein plays an important role in important functions in the body, and it is believed that a large number of proteins are involved in these regulatory processes, so there has been a need in the art to identify more human kelch protein 19 proteins involved in these processes, especially Is to identify the amino acid sequence of this protein. Isolation of the new human kelch protein 19 protein coding gene also provides a basis for research to determine the role of the protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for the disease, so it is important to isolate its coding DNA. Disclosure of invention
- Another object of the present invention is to provide a polynucleotide encoding the polypeptide.
- Another object of the present invention is to provide a method for producing human kelch protein 19.
- Another object of the present invention is to provide an antibody against the polypeptide of the present invention-human kelch protein 19.
- Another object of the present invention is to provide mimetic compounds, antagonists, agonists, and inhibitors directed to the human kelch protein 19 of the polypeptide of the present invention.
- Another object of the present invention is to provide a method for diagnosing and treating diseases associated with human kelch protein 19-abnormality.
- the present invention relates to an isolated polypeptide, the polypeptide is of human origin, and comprises: an amino acid having SEQ ID No. 2 Peptides of amino acid sequences, or conservative variants, biologically active fragments or derivatives thereof.
- the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
- the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
- sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 691-1221 in SEQ ID NO: 1; and (b) a sequence having 1-1945 in SEQ ID NO: 1 Sequence of bits.
- the invention further relates to a vector, in particular an expression vector, containing the polynucleotide of the invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; and a method comprising culturing said Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
- a vector in particular an expression vector, containing the polynucleotide of the invention
- a host cell genetically engineered with the vector including a transformed, transduced or transfected host cell
- a method comprising culturing said Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
- the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
- the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of the human kelch protein 19 protein, which comprises utilizing the polypeptide of the invention.
- the invention also relates to compounds obtained by this method.
- the invention also relates to a method for detecting a disease or susceptibility to disease associated with abnormal expression of human kelch protein 19 protein in vitro, which comprises detecting a mutation in the polypeptide or a sequence encoding a polynucleotide thereof in a biological sample, or detecting a mutation in a biological sample The amount or biological activity of a polypeptide of the invention.
- the present invention also relates to a pharmaceutical composition
- a pharmaceutical composition comprising a polypeptide of the present invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
- the present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention in the preparation of a medicament for treating cancer, developmental disease or immune disease or other diseases caused by abnormal expression of human kelch protein 19.
- Nucleic acid sequence refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
- amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
- amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule
- polypeptide or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
- a protein or polynucleotide “variant” refers to an amino acid sequence having one or more amino acids or nucleotide changes, or a polynucleotide sequence encoding it. The changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence.
- Variants may have "conservative" changes in which the substituted amino acid has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine. Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
- “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
- “Insertion” or “addition” refers to an alteration in the amino acid sequence or nucleotide sequence that results in an increase in one or more amino acids or nucleotides compared to a naturally occurring molecule.
- “Replacement” refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
- Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
- immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response and to bind to specific antibodies in a suitable animal or cell.
- An "agonist” refers to a molecule that, when combined with human kelch protein 19, causes a change in the protein to regulate the activity of the protein.
- An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that can bind to human kelch protein 19.
- Antagonist refers to a molecule that, when combined with human kelch protein 19, can block or modulate the biological or immunological activity of human kelch protein 19.
- Antagonists and inhibitors can include proteins, nucleic acids, carbohydrates, or any other molecule that can bind human kelch protein 19.
- Regular refers to a change in the function of human kelch protein 19, including an increase or decrease in protein activity, a change in binding properties, and any other biological, functional, or immune properties of human kelch protein 19.
- substantially pure ' means substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated.
- Those skilled in the art can purify human kelch protein 19 using standard protein purification techniques. Essentially pure Human kelch protein 19 can generate a single main band on a non-reducing polyacrylamide gel. The purity of human kelch protein 19 polypeptide can be analyzed by amino acid sequence.
- Complementary refers to the natural binding of a polynucleotide by base-pairing under conditions of acceptable salt concentration and temperature.
- sequence "C-T-G-A” can be combined with the complementary sequence "G-A-C-T”.
- the complementarity between two single-stranded molecules can be partial or complete.
- the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
- “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
- Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. The inhibition of such hybridization can be detected by performing hybridization (Southern blotting or Northern blotting, etc.) under conditions of reduced stringency. Substantially homologous sequences or hybridization probes can compete and inhibit completely homologous sequences from target sequences Binding under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.
- Percent identity refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALIGN program (Lasergene software package, DNASTAR, Inc., Madison Wis.). The MEGALIGN program can compare two or more sequences according to different methods such as the Cluster method (Higgins, DG and PM Sharp (1988) Gene 73: 237-244). 0 The Clus ter method compares groups of sequences by checking the distance between all pairs. Arranged in clusters. The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula:
- the assay may be Jotun Hein percent identity between nucleic acid sequences Clus ter or a method well known in the art (Hein J., (1990) Methods in emzuraology 183: 625-645) 0
- Similarity refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
- Amino acids used for conservative substitutions for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
- Antisense refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence.
- Antisense strand refers to a nucleic acid strand that is complementary to the “sense strand”.
- Derivative refers to a chemical modification of HFP or a nucleic acid encoding it. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the primary biological properties of natural molecules.
- Antibody refers to a complete antibody molecule and its fragments, such as Fa,? ( ⁇ ') 2 and?, which can specifically bind to the epitope of human kelch protein 19.
- a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
- isolated refers to the removal of a substance from its original environment (for example, its natural environment if it occurs naturally).
- a naturally occurring polynucleotide or polypeptide is not isolated when it is present in a living animal, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
- Such a polynucleotide may be part of a vector, or it may be such a polynucleotide
- the acid or polypeptide is part of a certain composition. Since the carrier or composition is not a component of its natural environment, they are still isolated.
- isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
- polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances existing in the natural state. .
- isolated human ke lch protein 19 means that human kelch protein 19 is substantially free of other proteins, lipids, sugars, or other substances with which it is naturally associated. Those skilled in the art can purify human kelch protein 19 using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of human kel ch protein 19 polypeptide can be analyzed by amino acid sequence.
- the present invention provides a new polypeptide, human kelch protein 19, which basically consists of the amino acid sequence shown in SEQ ID NO: 2.
- the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
- the polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques. Depending on the host used in the recombinant production protocol, the polypeptides of the invention may be glycosylated or may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
- the invention also includes fragments, derivatives and analogs of human kelch protein 19.
- fragment refers to a polypeptide that substantially retains the same biological function or activity of the human kelch protein 19 of the present invention.
- a fragment, derivative or analog of the polypeptide of the present invention may be: U) a kind in which one or more amino acid residues are replaced with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substituted
- the amino acid may or may not be encoded by the genetic code; or ( ⁇ ) such that a group on one or more amino acid residues is substituted by another group to include a substituent; or ( ⁇ ⁇ )
- One, in which the mature polypeptide is fused to another compound such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol
- such a polypeptide sequence in which the additional amino acid sequence is fused into the mature polypeptide Such as the leader sequence or secreted sequence or the sequence used to purify this polypeptide or protease sequence
- such fragments, derivatives and analogs are considered to be within the knowledge of those skilled in the art.
- the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
- the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
- the polynucleotide of the present invention is found from a CDM library of human fetal brain tissue. It contains a polynucleotide sequence of 1945 bases in length and its open reading frame 691-1221 encodes 176 amino acids.
- This polypeptide has the characteristic sequence of a member of the kelch protein family, and it can be deduced that the human kelch protein 19 has a member of the kelch protein family. Representing structure and function.
- the polynucleotide of the present invention may be in the form of DNA or RNA.
- DNA forms include cDNA, genomic DM, or synthetic DNA.
- DNA can be single-stranded or double-stranded.
- DNA can be coding or non-coding.
- the coding region sequence encoding the mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
- a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
- the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
- polynucleotide encoding a polypeptide refers to a polynucleotide that encodes the polypeptide and a polynucleotide that includes additional coding and / or non-coding sequences.
- the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
- Variants of this polynucleotide may be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
- an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
- the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity between the two sequences).
- the present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions.
- "strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.13 ⁇ 4SDS, 60 ° C; or (2) during hybridization Add denaturants, such as 50% (v / v) formamide, 0.1 republic
- hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
- nucleic acid fragments that hybridize to the sequences described above.
- a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 cores. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques (such as PCR) to identify and / or isolate polynucleotides encoding human kelch protein 19.
- polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
- the specific polynucleotide sequence encoding the human ke l ch protein 19 of the present invention can be obtained by various methods.
- polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridizing a probe to a genomic or cDNA library to detect homologous polynucleotide sequences, and 2) expressing the resistance of the library In vivo screening to detect cloned polynucleotide fragments having common structural characteristics.
- the DM fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DM sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DM of the polypeptide.
- genomic DM is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences.
- the standard method for isolating the cDM of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library.
- Various methods have been used to extract mRNA, and kits are also commercially available (Qiagene).
- the construction of cDNA libraries is also a common method (Sambrook, et al., Moleclonal Cloning, A Laboratory Manua, Cold Spring Harbor Laboratory. New York, 1989).
- Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When combined with polymerase reaction technology, even very small expression products can be cloned.
- the genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DNA-RNA hybridization; (2) the presence or absence of marker gene functions; (3) measuring the level of human ke l ch protein 19 transcripts; (4) ) Detection of protein products expressed by genes through immunological techniques or determination of biological activity. The above methods can be used singly or in combination.
- the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
- the length of the probe is usually within 2000 nucleotides, preferably within 1 000 nucleotides.
- the probe used here is generally a DNA sequence chemically synthesized based on the gene sequence information of the present invention.
- the genes or fragments of the present invention can of course be used as probes.
- DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
- immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) can be used to detect the protein product of human ke l ch protein 19 gene expression.
- ELISA enzyme-linked immunosorbent assay
- a method for amplifying DNA / RNA using PCR technology is preferably used to obtain the gene of the present invention.
- the RACE method RACE-cDM terminal rapid amplification method
- the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein.
- the amplified DNA / RNA fragments can be separated and purified by conventional methods such as by gel electrophoresis.
- polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. To obtain the full-length CDM sequence, sequencing needs to be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence. Column.
- the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using a human kelch protein 19 coding sequence, and a method for producing a polypeptide of the present invention by recombinant technology.
- a polynucleotide sequence encoding the human kelch protein 19 may be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
- vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
- Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors expressed in bacteria (Rosenberg, et al.
- any plasmid and vector can be used to construct a recombinant expression vector.
- An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
- Methods known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding human ke lch protein 19 and appropriate transcription / translation regulatory elements. These methods include in vitro recombinant DNA technology, DNA synthesis technology, in vivo recombination technology, etc. (Sambroook, et al. Molecular Cloning, a Laboratory Manua, cold Spring Harbor Laboratory. New York, 1989).
- the DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis. Representative examples of these promoters are: the lac or trp promoter of E.
- the expression vector also includes a ribosome binding site and a transcription terminator for translation initiation. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, and act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers on the late side of the origin of replication, and adenoviral enhancers.
- the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
- selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
- GFP fluorescent protein
- tetracycline or ampicillin resistance for E. coli.
- a polynucleotide encoding human kelch protein 19 or a recombinant vector containing the polynucleotide The host cell can be transformed or transduced to constitute a genetically engineered host cell containing the polynucleotide or a recombinant vector.
- the term "host cell” refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E. coli, Streptomyces; bacterial cells such as Salmonella typhimurium; fungal cells such as yeast; plant cells; insect cells such as flies
- S2 or Sf9 animal cells such as CH0, COS or Bowes melanoma cells.
- Transformation of a host cell with a DM sequence according to the present invention or a recombinant vector containing the DNA sequence can be performed by conventional techniques well known to those skilled in the art.
- the host is a prokaryote such as E. coli
- competent cells capable of DNA uptake can be in the exponential growth phase were harvested, treated with (] 12 method, the steps used in well known in the art. Alternatively, it is a M g Cl 2. If necessary, transformation can also be performed by electroporation.
- the host is a eukaryotic organism, the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and lipid Plastid packaging, etc.
- polynucleotide sequence of the present invention can be used to express or produce recombinant human kelch protein 19 (Science, 1984; 224: 1431). Generally there are the following steps:
- the medium used in the culture may be selected from various conventional mediums according to the host cells used. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
- a suitable method such as temperature conversion or chemical induction
- the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell.
- recombinant proteins can be isolated and purified by various separation methods using their physical, chemical, and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
- conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromat
- Figure 1 is the amino acid sequence of the inventor's kelch protein 19 and functional domains of kelch protein family members Comparison chart.
- Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of human kelch protein 19 isolated.
- 19KDa is the molecular weight of the protein.
- the arrow indicates the isolated protein band.
- Total RM of human fetal brain was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform.
- Poly (A) mRM was isolated from total RNA using Quik mRNA Isolat ion Kit (product of Qiegene). 2ug poly (A) mRNA forms cDM through reverse transcription.
- the Smart cDNA cloning kit purchased from Clontech was used to insert the cDNA fragments into the multiple cloning site of the pBSK (+) vector (Clontech) to transform DH5 ⁇ .
- the bacteria formed a cDM library.
- Dye terminate cycle reaction ion sequencing kit Perkin-Elmer
- ABI 377 automatic sequencer Perkin-Elmer
- the determined cDNA sequence was compared with the existing public DNA sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 0030h05 was new DNA.
- the cloned insert cDNA fragment was bidirectionally determined by synthesizing a series of primers.
- the sequence of the human kelch protein 19 and the encoded protein sequence of the present invention were profiled by the GCF prof le scan program (Basiclocal Information search tool) [Altschul, SF et al. J. Mol. Biol. 1990; 215: 403-10], performing domain analysis in a database such as ProSite.
- the human kelch protein 19 of the present invention is homologous to members of the domain kelch protein family, and the homology results are shown in FIG. 1.
- Example 3 Cloning of a gene encoding human kelch protein 19 by RT-PCR
- CDNA was synthesized using fetal brain cell total RNA as a template and oi igo-dT as a primer. After purification of Qiagene's kit, PCR amplification was performed with the following primers:
- Primer2 5'- CGGGCAAAGTATTACAAAGTGTTC -3 '(SEQ ID NO: 4)
- Primerl is a forward sequence starting at lbp of the 5th end of SEQ ID NO: 1;
- Priraer2 is the 3 'end reverse sequence in SEQ ID NO: 1.
- Amplification conditions 50 mmol / L KC1, 10 mmol / L Tris-CI, (pH 8.5), 1.5 mmol / L MgCl 2 , 200 ⁇ mol / L dNTP, lOpmol primer, 1U in a reaction volume of 50 ⁇ 1 Taq DM polymerase (Clontech).
- the reaction was performed on a PE9600 DM thermal cycler (Perkin-Elmer) for 25 cycles under the following conditions: 94. C 30sec; 55 ° C 30sec; 72 ° C 2min.
- ⁇ -act in was set as a positive control and template blank was set as a negative control.
- the amplified product was purified using a QIAGEN kit and ligated to a pCR vector using a TA cloning kit (Invitrogen).
- the DNA sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as the 1-1945bp shown in SEQ ID NO: 1.
- Example 4 Northern blot analysis of human kelch protein 19 gene expression:
- RNA extraction in one step [Anal. Biochem 1987, 162, 156-159] 0
- This method involves acid guanidinium thiocyanate-chloroform extraction. That is, the tissue is homogenized with 4M guanidinium isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1) are added. ), Mix and centrifuge. The aqueous phase was aspirated, isopropanol (0.8 vol) was added and the mixture was centrifuged to obtain a MA precipitate. The resulting RNA was precipitated with 70 »/. Wash with ethanol, dry and dissolve in water.
- Primer3 5- CCCCATATGATGCTCCCACTATCTCATCCAGGT -3 '(Seq ID No: 5)
- Primer4 5'- CCCGAATTCTCAGATGGTGCCAATCCTGTGATG -3 '(Seq ID No: 6)
- the 5 'ends of these two primers contain Ndel and EcoRI digestion sites, respectively, followed by the coding sequences of the 5, and 3' ends of the target gene, respectively.
- the Ndel and EcoRI digestion sites correspond to the expression vector plasmid pET 28b (+ ) (Novagen product, Cat. No. 69865. 3).
- the PCR reaction was performed using the pBS-0030h05 plasmid containing the full-length target gene as a template.
- the PCR reaction conditions were as follows: a total volume of 50 ⁇ 1 containing 10 pg of pBS- 0030h05 plasmid, primers Primer-3 and Primer- 4 points; and 10 ⁇ mol, Advantage polymerase Mix (product of Ciontech) 1 ⁇ 1. Cycle parameters: 94. C 20s, 60 ° C 30s, 68 ° C 2 min, a total of 25 cycles. Ndel and EcoRI were used to double digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase. The ligated product was transformed into E. coli DH5 0C using the calcium chloride method.
- BL21 (DE3) plySs (product of Novagen).
- the host bacteria BL21 (pET-0030h05) was cultured at 37 ° C to the logarithmic growth phase, and IPTG was added to a final concentration of 1 ol / L, continue to cultivate for 5 hours.
- the cells were collected by centrifugation, and the supernatant was collected by centrifugation.
- the supernatant was collected by centrifugation. Chromatography was performed using an affinity chromatography column His s. Bind Quick Cartridge (product of Novagen) capable of binding to 6 histidines (6His-Tag).
- the purified human kelch protein 19 was obtained.
- NH 2-Me t-Leu- Pro-Leu-Ser-H is-Pro-Gly-Gly-Val-Thr-A sn-Thr-Al a-G 1 n-COOH (SEQ ID NO: 7).
- the polypeptide was coupled to hemocyanin and bovine serum albumin to form a complex.
- hemocyanin and bovine serum albumin for the method, see: Avrameas, et al. Immunochemi s try, 1969; 6: 43 StammUse 4mg of the above hemocyanin polypeptide complex with complete Freund's adjuvant. Immunize rabbits and boost the immunity with hemocyanin-polypeptide complex and incomplete Freund's adjuvant after 15 days.
- oligonucleotide fragments from the polynucleotides of the present invention for use as hybridization probes is versatile For example, if the probe can be used to hybridize to a genomic or cDNA library of normal tissue or pathological tissue from different sources to identify whether it contains the polynucleotide sequence of the present invention and detect a homologous polynucleotide sequence, it can be further used. The probe detects whether the polynucleotide sequence of the present invention or a homologous polynucleotide sequence thereof is abnormally expressed in cells of normal tissue or pathological tissue.
- the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by using a filter hybridization method.
- Filter hybridization methods include dot blotting, Southern blotting, Northern blotting, and copying methods. They are all used to fix the polynucleotide sample to be tested on the filter and then hybridize using basically the same steps.
- the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer to saturate the non-specific binding site of the sample on the filter with the carrier and synthetic polymer.
- the pre-hybridization solution is then replaced with a hybridization buffer containing labeled probes and incubated to hybridize the probes to the target nucleic acid.
- the unhybridized probes are removed by a series of membrane washing steps. In this embodiment, higher-intensity washing conditions (such as lower salt concentration and higher temperature) are used to reduce the hybridization background and retain only strong specific signals.
- the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the invention; the second type of probes are partially related to the invention
- the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
- the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
- the selection of oligonucleotide fragments for use as hybridization probes from the polynucleotide SEQ ID NO: 1 of the present invention should follow the following principles and several aspects to be considered:
- the preferred range of probe size is 18-50 nucleotides
- the GC content is 30% -70%, and the non-specific hybridization increases when it exceeds;
- Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements The regions are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, then the primary probe should not be used;
- Probe 1 (probel), which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt): 5'- TGCTCCCACTATCTCATCCAGGTGGAGTAACTAATACGGCA -3 '(SEQ ID NO: 8)
- Probe 2 (probe2), which belongs to the second type of probe, is equivalent to the replacement mutation sequence (41Nt) of the gene fragment or its complementary fragment of SEQ ID NO: 1:
- PBS phosphate buffered saline
- step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
- NC membranes nitrocellulose membranes
- Two NC membranes are required for each probe, so that they can be used in the following experimental steps.
- the film was washed with high-strength conditions and strength conditions, respectively.
- the 32 P-Probe (the second peak is free ⁇ - 32 P_dATP) to be prepared after the collection solution of the first peak is combined.
- Pre-hybridization The sample membrane was placed in a plastic bag, and 3-l Offlg pre-hybridization solution (l OxDenhardt's; 6xSSC, 0. Irng / ml CT DNA (calf thymus DNA)) was added. After sealing the bag, 68 ° C water Rock shake for 2 hours.
- probe 1 can be used to qualitatively and quantitatively analyze the presence and differential expression of the polynucleotide of the present invention in different tissues.
- Gene microarrays or DNA microarrays are new technologies currently being developed by many national laboratories and large pharmaceutical companies. It refers to the orderly and high-density arrangement of a large number of target gene fragments on glass, The data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software to achieve the purpose of rapid, efficient, and high-throughput analysis of biological information.
- the polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research of new gene functions; search for and screen new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases .
- the specific method steps have been reported in the literature, for example, see the literature DeR i s i, J. L., Lyer, V. & Brown, P. 0.
- a total of 4,000 polynucleotide sequences of various full-length cDNAs are used as target DNA, including the polynucleotide of the present invention. They were amplified by PCR respectively. After purification, the amplified product was adjusted to a concentration of about 500 ng / ul, and spotted on a glass medium with a Cartesian 7500 spotter (purchased from Cartesian Company, USA). The distance between them is 280 ⁇ ⁇ ⁇ . The spotted slides were hydrated, dried, and cross-linked in a UV cross-linker. After elution, the slides were fixed to fix the DNA on the glass slides to prepare chips. The specific method steps are widely reported in the literature. The post-spot processing steps of this embodiment are:
- the total m-pass was extracted from normal liver and liver cancer in one step, and mRNA was purified with Oligotex mRNA Midi Kit (purchased from QiaGen).
- the fluorescent reagent Cy3dUTP (5-Amino- propargyl-2 ' -deoxyuridine 5'-triphate coupled to Cy3 f luorescent dye (purchased from Amersham Phamacia Biotech) was used to label the mRNA of normal liver tissue, and the fluorescent reagent Cy 5 dUTP (5-Am i no-pr opar gy 1 -2 ⁇ -deoxyur idi ne 5 '-triphate cou led to Cy5 f luorescent dye (purchased from Amersham Phamacia Biotech) was used to label liver cancer tissue mRNA, and the probe was prepared after purification.
- Cy3dUTP 5-Amino- propargyl-2 ' -deoxyuridine 5'-triphate coupled to Cy
- the probes from the above two tissues and the chips were respectively hybridized in a UniHyb TM Hybridization Solution (purchased from TeleCheni) hybridization solution for 16 hours, washed with a washing solution (lx SSC, 0.2% SDS) at room temperature and then used.
- the ScanArray 3000 scanner purchased from General Scanning Company, USA was used for scanning.
- the scanned image was analyzed and processed with Imagene software (Biodiscovery Company, USA), and the Cy3 / Cy5 ratio of each point was calculated. The ratio was less than 0.5 and greater than 2. Points are considered poorly expressed Different genes.
- polypeptides of the present invention as well as antagonists, agonists and inhibitors of the polypeptides, can be directly used in the treatment of diseases, for example, they can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection, and immune diseases.
- Kelch protein family plays an important role in the physiological processes related to the cytoskeleton during development, such as loop formation, nerve fiber localization, cell fusion, and cell morphogenesis.
- the loss of Kel-1 protein causes early growth arrest in larvae.
- the loop structure and the protein with kelch structure were found during the sperm and egg formation of many organisms, including humans, it can be considered that the effect of kelch protein on sperm and egg formation is universal.
- the kelch protein Mayven found in the brain, which may play a role in the dynamic organization of the actin cytoskeleton in brain cells.
- a protein containing a Kelch domain is a motor protein cross-linking protein that plays an important role in sperm acrosome formation; neuraminidase (sialidase) hydrolyzes the sialic acid residues of glycoproteins, generally It exists in the lysosome, but it also exists in secreted form.
- the characteristic sequences of the Kelch protein family are necessary for its biological activity.
- the polypeptide of the present invention is a polypeptide containing a Kelch domain, a characteristic sequence of the Kelch protein family. Abnormal expression of the polypeptide will lead to impaired sperm and egg formation, abnormal embryo development, and can affect the differentiation of the nervous system. It also affects tumor formation. Cause related diseases.
- the abnormal expression of the human kelch protein 19 of the present invention will produce various diseases, especially gonad diseases, various tumors, embryonic developmental disorders, and growth disorders. These diseases include, but are not limited to:
- Gonad disorders testicular and epididymal inflammation, testicular tumors, epididymal tumors, hydatidiform mole, chorionic carcinoma, fallopian tube cancer, ovarian tumors and tumor-like lesions, infertility
- Tumors of various tissues stomach cancer, liver cancer, lung cancer, esophageal cancer, breast cancer, leukemia, lymphoma, thyroid tumor, uterine fibroids, neuroblastoma, astrocytoma, ependymoma, glioblastoma, nerve Fiber Tumor, colon cancer, melanoma, adrenal cancer, bladder cancer, bone cancer, uterine cancer, endometrial cancer, gallbladder cancer, colon cancer, thymic tumor, nasopharyngeal cancer, laryngeal cancer, tracheal tumor, fibroma, fibrosarcoma, Lipoma, liposarcoma, leiomyoma
- Embryonic disorders neural tube insufficiency, brain dysplasia, neuronal migration disorders, aqueduct malformations, cerebellar dysplasia, Gase syndrome, congenital abortion, cleft palate, limb absentness, limb differentiation disorder, hyalinoma, Pulmonary insufficiency, polycystic kidney, cryptorchidism, congenital inguinal hernia, double uterus, vaginal atresia, hypospadias, hermaphroditism, atrial septal defect, ventricular septal defect, pulmonary stenosis, arterial duct occlusion, neural tube defect, congenital Hydrocephalus, iris defect, congenital glaucoma or cataract, congenital deafness
- Growth and development disorders mental retardation, cerebral palsy, brain development disorders, mental retardation, strabismus, skin, fat and muscular dysplasia such as congenital skin sagging, albinism, presenile, congenital keratosis, Bone and joint dysplasia diseases such as cartilage hypoplasia, epiphyseal dysplasia, metabolic bone disease, stunting, dwarfism, Cushing syndrome, sexual retardation
- polypeptide of the present invention can be directly used in the treatment of diseases, for example, it can treat various diseases, especially gonad diseases, various tumors, embryonic development disorders, growth disorders, etc. .
- the invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) human kelch protein 19.
- Agonists enhance human ke lch protein 19 to stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
- mammalian cells or a membrane preparation expressing human kel ch protein 19 can be cultured with labeled human kel ch protein 19 in the presence of a drug. The ability of the drug to increase or block this interaction is then determined.
- Antagonists of human ke lch protein 19 include antibodies, compounds, receptor deletions, and analogs. Antagonists of human ke l ch protein 19 can bind to human ke l ch protein 19 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot perform biological functions.
- human ke lch protein 19 can be added to bioanalytical assays to determine whether a compound is an antagonist by measuring the effect of the compound on the interaction between human kel ch protein 19 and its receptor.
- Receptor deletions and analogs that act as antagonists can be selected in the same way as for screening compounds described above.
- Polypeptide molecules capable of binding to human ke lch protein 19 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. When screening, the human ke l ch protein 19 molecule should generally be labeled.
- the present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens.
- antibodies can be polyclonal or monoclonal antibodies.
- the invention also provides a needle Antibody to human kelch protein 19 epitope.
- These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by Fab expression libraries.
- Polyclonal antibodies can be produced by injecting human kelch protein 19 directly into immunized animals (such as rabbits, mice, rats, etc.).
- immunized animals such as rabbits, mice, rats, etc.
- a variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's adjuvant.
- Techniques for preparing monoclonal antibodies to human kelch protein 19 include, but are not limited to, hybridoma technology (Kohler and Mistein. Nature, 1975, 256: 495-497), triple tumor technology, human beta-cell hybridoma technology, and EBV- Hybridoma technology, etc.
- Anti-human kelch protein 19 antibodies can be used in immunohistochemical techniques to detect human kelch protein 19 in biopsy specimens.
- Monoclonal antibodies that bind to human kelch protein 19 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
- Antibodies can also be used to design immunotoxins that target a particular part of the body.
- human kelch protein 19 high affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
- a common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
- This hybrid antibody can be used to kill human kelch protein 19 positive cells.
- the antibodies of the present invention can be used to treat or prevent diseases associated with human kelch protein 19.
- Administration of appropriate doses of antibodies can stimulate or block the production or activity of human kelch protein 19.
- the invention also relates to a diagnostic test method for quantitative and localized detection of human kelch protein 19 levels.
- tests are well known in the art and include FISH assays and radioimmunoassays.
- the level of human kelch protein 19 detected in the test can be used to explain the importance of human kelch protein 19 in various diseases and to diagnose diseases in which human kelch protein 19 plays a role.
- polypeptide of the present invention can also be used for peptide mapping analysis.
- the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry.
- the polynucleotide encoding human kelch protein 19 can also be used for a variety of therapeutic purposes.
- Gene therapy technology can be used to treat abnormal cell proliferation, development, or metabolism caused by the non-expression or abnormal / inactive expression of human kelch protein 19.
- Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated human kelch protein 19 to inhibit endogenous human kelch protein 19 activity.
- a mutated human kelch protein 19 may be a shortened human kelch protein 19 lacking a signaling domain. Substrate binding, but lacks signaling activity. Therefore, recombinant gene therapy vectors can be used to treat diseases caused by abnormal expression or activity of human kelch protein 19.
- Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to transfer a polynucleotide encoding human kel ch protein 1 into cells.
- Methods for constructing recombinant viral vectors carrying a polynucleotide encoding human kelch protein 19 can be found in the existing literature (Sambrook, et al.).
- a recombinant polynucleotide encoding human kelch protein 1 can be packaged into liposomes and transferred into cells.
- Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
- a vector such as a virus, phage, or plasmid
- Oligonucleotides including antisense RNA and DNA
- ribozymes that inhibit human kelch protein 19 raRNA are also within the scope of the present invention.
- a ribozyme is an enzyme-like RNA molecule that specifically decomposes specific RNA. Its mechanism is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation.
- Antisense RNA, DNA, and ribozymes can be obtained using any existing RNA or DNA synthesis technology, such as solid-phase phosphate amide chemical synthesis to synthesize oligonucleotides.
- Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA.
- This DM sequence has been integrated downstream of the RNA polymerase promoter of the vector.
- it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the linkage between ribonucleosides using phosphate thioester or peptide bonds instead of phosphodiester bonds.
- the polynucleotide encoding human kelch protein 19 can be used for the diagnosis of diseases related to human kelch protein 19.
- a polynucleotide encoding human kelch protein 19 can be used to detect the expression of human kelch protein 19 or the abnormal expression of human kelch protein 19 in a disease state.
- the DNA sequence encoding human kelch protein 19 can be used to hybridize biopsy specimens to determine the expression of human kelch protein 19.
- Hybridization techniques include Southern blotting, Northern blotting, in situ hybridization, and the like. These techniques and methods are publicly available and mature, and related kits are commercially available.
- polynucleotides of the present invention can be used as probes to be fixed on a microarray or a DNA chip (also referred to as a "gene chip") for analyzing differential expression analysis and gene diagnosis of genes in tissues.
- Human kelch protein 19-specific primers can be used for RNA-polymerase chain reaction (RT-PCR) in vitro amplification to detect human kelch protein 19 transcripts.
- Detection of mutations in the human kelch protein 19 gene can also be used to diagnose human kelch protein 19-related diseases.
- Human kelch protein 19 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type human kelch protein 19 DNA sequence. Mutations can be detected using existing techniques such as Southern imprinting, DNA sequence analysis, PCR, and in situ hybridization. In addition, mutations may affect protein expression. Therefore, Northern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
- sequences of the invention are also valuable for chromosome identification. This sequence will be specific to someone The chromosome is in a specific location and can be crossed with it. Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for labeling chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DNA sequences on a chromosome.
- PCR primers (preferably 15-35bp) are prepared based on cDNA, and the sequences can be mapped on chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those hybrid cells containing human genes corresponding to the primers will produce amplified fragments.
- PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
- oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
- Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.
- Fluorescent in situ hybridization of cDM clones with metaphase chromosomes allows precise chromosomal localization in one step.
- FISH Fluorescent in situ hybridization
- the physical location of the sequence on the chromosome can be correlated with the genetic map data. These data can be found in, for example, V. Mckusick, Mendelian Inherance in Man (available online with Johns Hopkins University Wetch Medical Library). Linkage analysis can then be used to determine the relationship between genes and diseases that have been mapped to chromosomal regions.
- the difference in cDNA or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).
- the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
- suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
- the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients that do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
- the invention also provides a kit or kit containing one or more containers, the containers containing one or more Ingredients of the pharmaceutical composition of the present invention.
- the containers containing one or more Ingredients of the pharmaceutical composition of the present invention.
- the polypeptides of the invention can be used in combination with other therapeutic compounds.
- the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
- Human ke l ch protein 19 is administered in an amount effective to treat and / or prevent a specific indication.
- the amount and range of human kel ch protein 19 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician.
Landscapes
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Gastroenterology & Hepatology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Medicinal Chemistry (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Toxicology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Peptides Or Proteins (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
AU2001229993A AU2001229993A1 (en) | 2000-01-26 | 2001-01-15 | Novel polypeptide---human kelch protein 19 and polynucleotide encoding it |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN00111516.2 | 2000-01-26 | ||
CN 00111516 CN1307020A (zh) | 2000-01-26 | 2000-01-26 | 一种新的多肽——人ke1ch蛋白19和编码这种多肽的多核苷酸 |
Publications (1)
Publication Number | Publication Date |
---|---|
WO2001055427A1 true WO2001055427A1 (fr) | 2001-08-02 |
Family
ID=4581426
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/CN2001/000057 WO2001055427A1 (fr) | 2000-01-26 | 2001-01-15 | Nouveau polypeptide, proteine humaine kelch 19, et polynucleotide codant pour ce polypeptide |
Country Status (3)
Country | Link |
---|---|
CN (1) | CN1307020A (fr) |
AU (1) | AU2001229993A1 (fr) |
WO (1) | WO2001055427A1 (fr) |
-
2000
- 2000-01-26 CN CN 00111516 patent/CN1307020A/zh active Pending
-
2001
- 2001-01-15 WO PCT/CN2001/000057 patent/WO2001055427A1/fr active Application Filing
- 2001-01-15 AU AU2001229993A patent/AU2001229993A1/en not_active Abandoned
Non-Patent Citations (2)
Title |
---|
DATABASE GENBANK [online] 21 December 1999 (1999-12-21), HOLMES A. ET AL., Database accession no. AAF03529 * |
DATABASE GENBANK [online] UNIVERSITY OF MINNESOTA; 5 July 2000 (2000-07-05), Database accession no. AAF81719 * |
Also Published As
Publication number | Publication date |
---|---|
AU2001229993A1 (en) | 2001-08-07 |
CN1307020A (zh) | 2001-08-08 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
WO2001055189A1 (fr) | NOUVEAU POLYPEPTIDE, SECp43, 32 S'ASSOCIANT AVEC L'ARNt DE LA SELENOCYSTEINE HUMAINE, ET POLYNUCLEOTIDE CODANT POUR CE POLYPEPTIDE | |
WO2001083538A1 (fr) | Nouveau polypeptide, proteine humaine 36 du gene k-ras, et polynucleotide codant pour ce polypeptide | |
WO2001066730A1 (fr) | Nouveau polypeptide, proteine humaine rs3 12, et polynucleotide codant pour ce polypeptide | |
WO2001055427A1 (fr) | Nouveau polypeptide, proteine humaine kelch 19, et polynucleotide codant pour ce polypeptide | |
WO2001055195A1 (fr) | Nouveau polypeptide, proteine de type an1 humaine, et polynucleotide codant pour ce polypeptide | |
WO2001075048A2 (fr) | Nouveau polypeptide, proteine ribosomale humaine s11 23, et polynucleotide codant pour ce polypeptide | |
WO2001072793A1 (fr) | Nouveau polypeptide, proteine humaine de regulation 12 de la proteine hydrolase, et polynucleotide codant pour ce polypeptide | |
WO2001075085A1 (fr) | Nouveau polypeptide, serine hydrolase humaine atp-dependante 11.3, et polynucleotide codant pour ce polypeptide | |
WO2001062782A1 (fr) | Nouveau polypeptide, famille proteique 11 de la rhodopsine, et polynucleotide codant pour ce polypeptide | |
WO2001085752A1 (fr) | Polynucleotide codant un peptide de myosine | |
WO2001048006A1 (fr) | Nouveau polypeptide, proteine de liaison de la cobalamine 10, et polynucleotide codant pour ce polypeptide | |
WO2001094371A1 (fr) | Nouveau polypeptide, proteine ribosomale humaine s4-10, et polynucleotide codant ce polypeptide | |
WO2001070956A1 (fr) | Nouveau polypeptide, proteine humaine de reparation 8 du mesappariement de l'adn, et polynucleotide codant pour ce polypeptide | |
WO2001087949A1 (fr) | Nouveau polypeptide, proteine pax humaine 9, et polynucleotide codant pour ce polypeptide | |
WO2001090171A1 (fr) | Nouveau polypeptide, proteine humaine ribosomale sii 12, et polynucleotide codant ce polypeptide | |
WO2001087966A1 (fr) | Nouveau polypeptide, proteine pax humaine 22, et polynucleotide codant pour ce polypeptide | |
WO2001046241A1 (fr) | Nouveau polypeptide, proteine 12 gvpa, et polynucleotide codant pour ce polypeptide | |
WO2001073041A1 (fr) | Nouveau polypeptide, adn ligase humaine 15, et polynucleotide codant pour ce polypeptide | |
WO2001079508A1 (fr) | Nouveau polypeptide, proteine porteuse mitochondriale humaine 18, et polynucleotide codant pour ce polypeptide | |
WO2001075024A2 (fr) | Nouveau polypeptide, facteur humain 13 associe a nf-e2, et polynucleotide codant pour ce polypeptide | |
WO2001055194A1 (fr) | Nouveau polypeptide, proteine humaine 34 de type ankyrine, et polynucleotide codant pour ce polypeptide | |
WO2001074867A1 (fr) | Nouveau polypeptide, proteine humaine 11 regulant la protease, et polynucleotide codant pour ce polypeptide | |
WO2001047973A1 (fr) | Nouveau polypeptide, proteine 14 associee a la vesicule a gaz, et polynucleotide codant pour ce polypeptide | |
WO2001087951A1 (fr) | Nouveau polypeptide, helicase humaine 11, et polynucleotide codant pour ce polypeptide | |
WO2001079436A2 (fr) | Nouveau polypeptide, facteur humain de transcription de la differentiation cellulaire 10, et polynucleotide codant pour ce polypeptide |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A1 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
DFPE | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101) | ||
REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
122 | Ep: pct application non-entry in european phase | ||
NENP | Non-entry into the national phase |
Ref country code: JP |