WO2001049725A1 - NOUVEAU POLYPEPTIDE, FACTEUR σ-54 13, ET POLYNUCLEOTIDE CODANT POUR CE POLYPEPTIDE - Google Patents

NOUVEAU POLYPEPTIDE, FACTEUR σ-54 13, ET POLYNUCLEOTIDE CODANT POUR CE POLYPEPTIDE Download PDF

Info

Publication number
WO2001049725A1
WO2001049725A1 PCT/CN2000/000658 CN0000658W WO0149725A1 WO 2001049725 A1 WO2001049725 A1 WO 2001049725A1 CN 0000658 W CN0000658 W CN 0000658W WO 0149725 A1 WO0149725 A1 WO 0149725A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
factor
polynucleotide
sequence
seq
Prior art date
Application number
PCT/CN2000/000658
Other languages
English (en)
Chinese (zh)
Inventor
Yumin Mao
Yi Xie
Original Assignee
Fudan University
Shanghai Bio Door Gene Technology Ltd.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Fudan University, Shanghai Bio Door Gene Technology Ltd. filed Critical Fudan University
Priority to AU23405/01A priority Critical patent/AU2340501A/en
Publication of WO2001049725A1 publication Critical patent/WO2001049725A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • the present invention belongs to the field of biotechnology. Specifically, the present invention describes a new polypeptide, ⁇ -54 factor 1 3, and a polynucleotide sequence encoding the polypeptide. The invention also relates to methods and applications for preparing such polynucleotides and polypeptides.
  • regulatory proteins can activate the expression of promoter genes recognized by the core RM polymerase in combination with the ⁇ -54 factor. This process relies on hydrolysis of ATP to provide energy. About half of these regulatory proteins belong to the signaling binary system and all contain a site whose N-terminus can be phosphorylated by a transactivating enzyme protein. The C-terminus of almost all of this protein contains a helix-folding-helix ( ⁇ ) binding region. The region that interacts with the ⁇ -54 factor on regulatory proteins contains approximately 230 amino acid residues.
  • the region interacting with the sigma -54 factor has ATPase activity itself, which can promote conformational changes during the interaction phase. It contains the atypical ATP binding domain A (Pl oop) and domain B. These two ATP binding The domain is located at the N-terminal portion of the protein. Except for some eukaryotic GTP-binding protein families, most proteins have such a conserved sequence: [LI VMFY] (3) — X— G— [DEQ] ⁇ [STE] ⁇ G— [STAV] — G— K— X (2) — [LIVMFY] 0 In addition, some parts are also more conservative.
  • ⁇ -54 factor After the ⁇ -54 factor is bound to the core enzyme, a stable, closed promoter complex is formed.
  • the activating protein is bound to the ⁇ -54 factor, the entire complex undergoes an isomerization reaction to form an open-chain promoter.
  • the energy required for this process is supplied by ATP hydrolysis catalyzed by an activating protein with ATPase activity.
  • the ⁇ -54 binding system can also recognize enhancer DNA at the -12 and -24 sites away from the start of transcription, replacing the -10 and -35 sites under normal circumstances.
  • ⁇ -54 factor 1 3 protein plays an important role in important functions of the body as described above, and it is believed that a large number of proteins are involved in these regulatory processes, there has been a need in the art to identify more ⁇ -54 factors 1 3 involved in these processes. Protein, especially the amino acid sequence of this protein. Isolation of the new sigma-54 factor 13 protein coding gene also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so it is important to isolate its coding for DM. Object of the invention
  • Another object of the invention is to provide a polynucleotide encoding the polypeptide.
  • Another object of the present invention is to provide antibodies against the polypeptide of the present invention, sigma-54 factor 13.
  • Another object of the present invention is to provide mimic compounds, antagonists, agonists, and inhibitors against the polypeptide of the present invention, ⁇ -54 factor 13.
  • Another object of the present invention is to provide a method for diagnosing and treating diseases related to abnormalities of sigma-54 factor 13.
  • the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
  • the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
  • sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 108-452 in SEQ ID NO: 1; and (b) a sequence having 1-1174 in SEQ ID NO: 1 Sequence of bits.
  • the invention further relates to a vector, in particular an expression vector, containing the polynucleotide of the invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; and a method comprising culturing said Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
  • a vector in particular an expression vector, containing the polynucleotide of the invention
  • a host cell genetically engineered with the vector including a transformed, transduced or transfected host cell
  • a method comprising culturing said Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
  • the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
  • the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of sigma-54 factor 13 protein, which comprises utilizing the polypeptide of the invention.
  • the invention also relates to compounds obtained by this method.
  • the present invention also relates to a method for detecting a disease or susceptibility to disease associated with abnormal expression of sigma-54 factor 13 protein in vitro, comprising detecting a mutation in the polypeptide or a sequence encoding a polynucleotide thereof in a biological sample, Alternatively, the amount or biological activity of a polypeptide of the invention in a biological sample is detected.
  • the present invention also relates to a medicament, which contains a polypeptide of the present invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
  • the present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention in the preparation of a medicament for treating cancer, developmental disease or immune disease or other diseases caused by abnormal expression of sigma-54 factor 13.
  • Fig. 1 is a comparison diagram of amino acid sequence homology of 79-amino acid and domain ⁇ -54 factor family proteins of ⁇ -54 factor 1 3 in 2 3-1 01 of the present invention.
  • the upper sequence is the ⁇ -54 factor 1 3, and the lower sequence is the ⁇ -54 factor family protein domain.
  • ⁇ "and”: "" and ".” Indicate that the probability of the same amino acid appearing between two sequences decreases in sequence.
  • Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of the isolated ⁇ -54 factor 1 3.
  • 1 3kda is the molecular weight of the protein.
  • the arrow indicates the isolated protein band.
  • Nucleic acid sequence refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
  • amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
  • amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
  • a protein or polynucleotide “variant” refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it. The changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence. Variants can have "conservative" changes in which the substituted amino acid has a structural or chemical property similar to the original amino acid, such as the replacement of isoleucine with leucine. Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
  • “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
  • Insert refers to a change in the amino acid sequence or nucleotide sequence that results in Compared to the molecule, one or more amino acids or nucleotides are increased.
  • Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
  • Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
  • immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response and to bind specific antibodies in a suitable animal or cell.
  • An "agonist” refers to a molecule that, when combined with sigma-54 factor 13, can cause the protein to change, thereby regulating the activity of the protein.
  • An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that can bind to sigma-54 factor 13.
  • Antagonist refers to a molecule that, when combined with sigma-54 factor 13, can block or regulate the biological or immunological activity of sigma-54 factor 13.
  • Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates or any other molecule that can bind to sigma-54 factor 13.
  • Regular refers to a change in the function of sigma-54 factor 13, including an increase or decrease in protein activity, a change in binding properties, and any other biological, functional, or immune properties of sigma-54 factor 13.
  • Substantially pure ' means essentially free of other proteins, lipids, sugars or other substances with which it is naturally associated. Those skilled in the art can purify ⁇ -54 factor 13 using standard protein purification techniques. Substantially pure The ⁇ -54 factor 13 can generate a single main band on a non-reducing polyacrylamide gel. The purity of the ⁇ -54 factor 13 polypeptide can be analyzed by amino acid sequence.
  • Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
  • sequence C-T-G-A
  • complementary sequence G-A-C-T
  • the complementarity between two single-stranded molecules can be partial or complete.
  • the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
  • “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
  • Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Southern or Northern blotting, etc.) under conditions of reduced stringency. Substantially homologous sequences or hybridization probes can compete and inhibit the binding of completely homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.
  • Percent identity refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALIGN program (Lasergene software package, DNASTAR, Inc., Madison Wis.). The MEGALIGN program can compare two or more sequences according to different methods such as the Cluster method (Higgins, DG and PM Sharp (1988) Gene 73: 237-244) The Cluster method arranges groups of sequences into clusters by checking the distance between all pairs. The clusters are then assigned in pairs or groups. Two amino acid sequences such as sequence A and The percent identity between sequences B is calculated by:
  • the percent identity between nucleic acid sequences can also be determined by the Cluster method or by methods known in the art such as Jotun He in (He in J., (1990) Methods in enzymo ogy 183: 625-645).
  • Similarity refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
  • Amino acids used for conservative substitution for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
  • Antisense refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence.
  • the "antisense strand” refers to a nucleic acid strand that is complementary to the “sense strand”.
  • Derivative refers to HFP or a chemical modification of its nucleic acid. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
  • Antibody refers to a complete antibody molecule and its fragments, such as Fa,? ( ⁇ ,) 2 and? It can specifically bind the epitope of ⁇ -54 factor 13.
  • a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
  • isolated refers to the removal of matter from its original environment (for example, its natural environment if it is naturally occurring).
  • a naturally occurring polynucleotide or polypeptide is not isolated when it is present in a living animal, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist in the natural system.
  • Such a polynucleotide may be part of a vector, or such a polynucleotide or polypeptide may be part of a composition. Since the carrier or composition is not part of its natural environment, they are still isolated.
  • isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
  • polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances existing in the natural state. .
  • isolated ⁇ -54 factor 1 3 means that ⁇ -54 factor 1 3 is substantially free of natural Other proteins, lipids, sugars or other substances related to it.
  • Those skilled in the art can purify sigma-54 factor 13 using standard protein purification techniques.
  • Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel.
  • the purity of the ⁇ -54 factor 13 peptide can be analyzed by amino acid sequence.
  • the present invention provides a new polypeptide, ⁇ -54 factor 1 3, which is basically composed of the amino acid sequence shown in SEQ ID NO: 2.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
  • the polypeptides of the present invention may be naturally purified products or chemically synthesized products, or produced using recombinant technology from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells). Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
  • the invention also includes fragments, derivatives and analogs of ⁇ -54 factor 1 3.
  • fragment refers to a polypeptide that substantially maintains the same biological function or activity of the sigma-54 factor 1 3 of the present invention.
  • a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution
  • the amino acid may or may not be encoded by a genetic codon; or ( ⁇ ) such a type in which one or more amino acid residues are substituted with other groups to include a substituent; or (III) such A type in which a mature polypeptide is fused to another compound (such as a compound that extends the half-life of a polypeptide, such as polyethylene glycol); or (IV) a type of polypeptide sequence in which an additional amino acid sequence is fused into a mature polypeptide ( Such as a leader sequence or a secreted sequence or a sequence used to purify this polypeptide or a protein sequence).
  • such fragments, derivatives and analogs are considered to be within the knowledge of those skilled in the art.
  • the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the polynucleotide sequence of the present invention includes a nucleotide sequence of SEQ ID NO: 1.
  • the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a polynucleotide sequence of 1174 bases in length and its open reading frame 108-452 encodes 114 amino acids.
  • This polypeptide has the characteristic sequence of the ⁇ -54 factor family protein, and it can be deduced that the ⁇ -54 factor 13 has the structure and function represented by the ⁇ -54 factor family protein.
  • the polynucleotide of the present invention may be in the form of DNA or RNA.
  • DNA forms include cDNA, genomic DNA, or synthetic DNA.
  • DNA can be single-stranded or double-stranded.
  • DNA can be coding or non-coding.
  • the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
  • a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
  • the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence,
  • polynucleotide encoding a polypeptide refers to a polynucleotide that includes the polypeptide and a polynucleotide that includes additional coding and / or non-coding sequences.
  • the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
  • This polynucleotide variant can be a naturally occurring allelic variant or a non-naturally occurring variant.
  • These nucleotide variants include substitution variants, deletion variants, and insertion variants.
  • an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
  • the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity between the two sequences).
  • the present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions.
  • “strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60 ° C; or (2) Add denaturants during hybridization, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% Fi co ll, 42 ° C, etc .; or (3) only between two sequences Hybridization occurs only when the identity is at least 95%, and more preferably 97%.
  • the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
  • nucleic acid fragments that hybridize to the sequences described above.
  • a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 nucleotides. Nucleotides or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques, such as PCR, to identify and / or isolate polynucleotides encoding sigma-54 factor 13.
  • polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
  • the specific polynucleotide sequence encoding the ⁇ -54 factor 13 of the present invention can be obtained by various methods.
  • polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
  • the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.
  • genomic DM is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences.
  • the standard method for isolating the cDNA of interest is to isolate the mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid Or phage cDNA library. There are many mature techniques for extracting mRNA, and kits are also commercially available (Qiagene).
  • the construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989).
  • Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
  • genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DNA-RNA hybridization; (2) the presence or absence of marker gene functions; (3) determination of the transcript level of sigma-54 factor 13; (4) Detection of gene-expressed protein products by immunological techniques or determination of biological activity. The above methods can be used singly or in combination.
  • the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
  • the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
  • the probe used here is usually a DNA sequence chemically synthesized based on the gene sequence information of the present invention.
  • the genes or fragments of the present invention can of course be used as probes.
  • DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
  • immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) can be used to detect protein products expressed by the ⁇ -54 factor 13 gene.
  • a method of applying a PCR technique to amplify DNA / RNA is preferably used to obtain the gene of the present invention.
  • the RACE method RACE-Rapid Amplification of cDNA Ends
  • the primers for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein Select and synthesize using conventional methods.
  • the amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
  • polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be measured by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, sequencing needs to be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
  • the present invention also relates to a vector comprising a polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using a sigma-54 factor 13 coding sequence, and a method for producing a polypeptide of the present invention by recombinant technology .
  • a polynucleotide sequence encoding a sigma-54 factor 13 may be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
  • vector refers to bacterial plasmids, Bacteriophage, yeast plasmid, plant cell virus, mammalian cell virus such as adenovirus, retrovirus or other vectors.
  • Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al. Gene, 19114, 56: 125) expressed in bacteria; pMSXND expression vectors expressed in mammalian cells ( Lee and Nathans, J Bio Chem.
  • any plasmid and vector can be used to construct a recombinant expression vector.
  • An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
  • Methods known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding a sigma-54 factor 13 and appropriate transcriptional / translational regulatory elements. These methods include in vitro recombinant DM technology, DNA synthesis technology, and in vivo recombination technology (Sambroook, et al. Molecular Cloning, a Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989).
  • the DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis. Representative examples of these promoters are: the lac or trp promoter of E.
  • the expression vector also includes a ribosome binding site for translation initiation, a transcription terminator, and the like. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors expressed by DM, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers and adenovirus enhancers on the late side of the origin of replication.
  • the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • GFP fluorescent protein
  • tetracycline or ampicillin resistance for E. coli.
  • a polynucleotide encoding a sigma-54 factor 13 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to form a genetically engineered host cell containing the polynucleotide or the recombinant vector.
  • host cell refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E.
  • Transformation of a host cell with a DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art.
  • the host is a prokaryote such as E. coli
  • competent cells capable of DNA uptake can be in the exponential growth phase were harvested, treated with (1 2 method used in the step are well known in the art. Alternatively, it is a MgCl 2. If If necessary, transformation can also be performed by electroporation.
  • the host is a eukaryotic organism, the following DM transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging Wait.
  • the polynucleotide sequence of the present invention can be used to express or produce recombinant ⁇ -54 factor 13 (Science, 1984; 224: 1431). Generally there are the following steps:
  • the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
  • a suitable method such as temperature conversion or chemical induction
  • the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If necessary, the recombinant protein can be isolated and purified by various separation methods using its physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
  • conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid
  • polypeptides of the present invention can be directly used in the treatment of diseases, for example, they can be used to treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection, and immunological diseases.
  • the energy required for this process is supplied by ATP hydrolysis catalyzed by an activating protein with ATPase activity.
  • the ⁇ -54 combination system can also The enhancer DNA is recognized at the -12 and -24 positions away from the start of transcription, replacing the -10 and -35 positions in general.
  • Site-directed mutagenesis and specific chemical probes of some key sites show that the binding and interaction of ⁇ -54 factor with the core enzyme controls the speed of transcription initiation and the conformation of the polymerase, thus indirectly affecting the rate of RNA synthesis And the speed and expression of future protein synthesis.
  • the abnormal expression of the mot if in the specific sigma-54 factor action region will cause the function of the polypeptide containing the motif of the present invention to be abnormal, thereby causing abnormalities in RNA synthesis and protein expression, and related diseases.
  • diseases such as tumors, embryonic development disorders, growth and development disorders.
  • the abnormal expression of the ⁇ -54 factor 1 3 of the present invention will produce various diseases, especially various tumors, embryonic development disorders, and growth disorders. These diseases include, but are not limited to:
  • Tumors of various tissues gastric cancer, liver cancer, lung cancer, esophageal cancer, breast cancer, leukemia, lymphoma, thyroid tumor, uterine fibroids, neuroblastoma, astrocytoma, ependymoma, glioblastoma, Colon cancer, melanoma, adrenal cancer, bladder cancer, bone cancer, osteosarcoma, myeloma, bone marrow cancer, brain cancer, uterine cancer, endometrial cancer, gallbladder cancer, colon cancer, thymic tumor, nasal cavity and sinus tumor, nose Pharyngeal cancer, Laryngeal cancer, Tracheal tumor, Fibroma, Fibrosarcoma, Lipoma, Liposarcoma, Leiomyoma
  • Embryonic disorders congenital abortion, cleft palate, limb loss, limb differentiation disorder, hyaline membrane disease, atelectasis, polycystic kidney, double ureter, cryptorchidism, congenital inguinal hernia, double uterus, vaginal atresia, suburethral Fissure, hermaphroditism, atrial septal defect, ventricular septal defect, pulmonary stenosis, arterial duct occlusion, neural tube defect, congenital hydrocephalus, iris defect, congenital cataract, congenital glaucoma or cataract, congenital deafness
  • Growth and development disorders mental retardation, cerebral palsy, brain development disorders, mental retardation, familial cerebral nucleus dysplasia syndrome, strabismus, skin, fat and muscular dysplasia such as congenital skin laxity, premature aging Disease, congenital keratosis, various metabolic defects such as various amino acid metabolic defects, stunting, dwarfism, sexual retardation
  • ⁇ -54 factor 1 3 of the present invention will also generate certain inflammations, certain hereditary, hematological diseases, and immune system diseases.
  • polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat various diseases, especially various tumors, embryonic developmental disorders, growth and development disorders, and some Inflammation, some hereditary, hematological and immune system diseases.
  • the invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) sigma 54-factor 13.
  • Agonists increase sigma-54 factor 13 to stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
  • mammalian cells or membrane preparations expressing ⁇ -54 factor 1 3 can be labeled with ⁇ -54 factor 1 3 in the presence of drugs. Cultivate together. The ability of the drug to increase or block this interaction is then determined.
  • Antagonists of sigma-54 factor 13 include antibodies, compounds, receptor deletions, and the like that have been screened.
  • the antagonist of ⁇ -54 factor 13 can bind to ⁇ -54 factor 13 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot perform biological functions.
  • ⁇ -54 factor 13 When screening compounds as antagonists, ⁇ -54 factor 13 can be added to the bioanalytical assay to determine whether the compound is an antagonist by measuring the effect of the compound on the interaction between ⁇ -54 factor 13 and its receptor. Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds.
  • Polypeptide molecules capable of binding to ⁇ -54 factor 13 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. When screening, generally 13 molecules of ⁇ -54 factor should be labeled.
  • the present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies.
  • the invention also provides antibodies against the ⁇ -54 factor 13 epitope. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by Fab expression libraries.
  • Polyclonal antibodies can be produced by direct injection of sigma-54 factor 13 into immunized animals (such as rabbits, mice, rats, etc.).
  • immunized animals such as rabbits, mice, rats, etc.
  • adjuvants can be used to enhance the immune response, including but not limited to Freund's adjuvant.
  • Techniques for preparing ⁇ -54 factor 13 monoclonal antibodies include, but are not limited to, hybridoma technology (Kohler and Milstein. Nature, 1975, 256: 495-497), triple tumor technology, and human beta-cell hybridoma technology. (Morrison et al, PNAS, 1985, 81: 6851).
  • the existing technology for producing single-chain antibodies (U.S. Pat No. 4946778) can also be used to produce single-chain antibodies against ⁇ -54 factor 13.
  • Antibodies against sigma-54 factor 13 can be used in immunohistochemical techniques to detect sigma-54 factor 13 in biopsy specimens.
  • Monoclonal antibodies that bind to ⁇ -54 factor 13 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
  • Antibodies can also be used to design immunotoxins that target a particular part of the body.
  • sigma-54 factor 13 high affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
  • a common method is to attack the amino group of the antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
  • This hybrid antibody can be used to kill ⁇ -54 factor 13 positive cells.
  • the antibodies in the present invention can be used to treat or prevent diseases related to sigma-54 factor 13. Administration of an appropriate dose of antibody can stimulate or block the production or activity of sigma-54 factor 13.
  • the invention also relates to a diagnostic test method for quantitative and localized detection of ⁇ -54 factor 13 levels.
  • tests are well known in the art and include FISH assays and radioimmunoassays.
  • the level of sigma-54 factor 13 detected in the test can be used to explain the importance of sigma-54 factor 13 in various diseases and to diagnose diseases in which sigma-54 factor 13 plays a role.
  • polypeptide of the present invention can also be used for peptide mapping analysis.
  • the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
  • the polynucleotide encoding sigma-54 factor 13 can also be used for a variety of therapeutic purposes.
  • Gene therapy technology can be used to treat abnormal cell proliferation, development or metabolism caused by the non-expression or abnormal / inactive expression of ⁇ -54 factor 13.
  • Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated sigma-54 factor 13 to inhibit endogenous sigma-54 factor 13 activity.
  • a mutated ⁇ -54 factor 13 may be a shortened ⁇ -54 factor 13 without a signaling domain. Although it can be combined with downstream substrates, it lacks signaling activity. Therefore, recombinant gene therapy vectors can be used to treat diseases caused by abnormal expression or activity of sigma-54 factor 13.
  • Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to transfer a polynucleotide encoding a sigma-54 factor 13 into a cell.
  • Methods for constructing recombinant viral vectors carrying a polynucleotide encoding a sigma-54 factor 13 can be found in the existing literature (Sambrook, et al.).
  • the polynucleotide encoding the ⁇ -54 factor 13 can be packaged into liposomes and transferred into cells.
  • Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
  • a vector such as a virus, phage, or plasmid
  • Oligonucleotides including antisense RNA and DNA
  • ribozymes that inhibit sigma-54 factor 13 mRNA are also within the scope of the present invention.
  • a ribozyme is an enzyme-like RNA molecule that specifically decomposes specific RNA. Its mechanism is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation.
  • Antisense RNA, DNA, and ribozymes can be obtained using any existing RNA or DNA synthesis techniques, such as solid-phase phosphate amide chemical synthesis to synthesize oligonucleotides.
  • Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RM.
  • This DNA sequence has been integrated downstream of the RNA polymerase promoter of the vector.
  • it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the phosphorothioate or peptide bond instead of the phosphodiester bond is used for the ribonucleoside linkage.
  • the polynucleotide encoding sigma-54 factor 13 can be used for the diagnosis of diseases related to sigma-54 factor 13.
  • the polynucleotide encoding sigma-54 factor 13 can be used to detect the expression of sigma-54 factor 13 or the abnormal expression of sigma-54 factor 13 in a disease state.
  • the DNA sequence encoding ⁇ -54 factor 13 can be used to hybridize biopsy specimens to determine the expression of ⁇ -54 factor 13.
  • Hybridization techniques include Southern blotting, Northern blotting, and in situ hybridization. These techniques and methods are publicly available and mature, and related kits are commercially available.
  • a part or all of the polynucleotides of the present invention can be used as probes to be fixed on a microarray (Microarray) or a DM chip (also known as a "gene chip") for analyzing differential expression analysis and gene diagnosis of genes in tissues.
  • Sigma-54 factor 13 specific primers can also be used for RNA-polymerase chain reaction (RT-PCR) in vitro amplification to detect sigma-54 factor 13 transcripts.
  • Detection of mutations in the ⁇ -54 factor 13 gene can also be used to diagnose ⁇ -54 factor 13-related diseases.
  • Forms of ⁇ -54 factor 13 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to normal wild-type ⁇ -54 factor 13 DM sequences. Mutations can be detected using existing techniques such as Southern blotting, DM sequence analysis, PCR and in situ hybridization. In addition, mutations may affect the expression of proteins, so Northern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
  • sequences of the invention are also valuable for chromosome identification. This sequence will specifically target a specific position on a human chromosome and can hybridize to it. Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for marking chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DNA sequences on a chromosome.
  • PCR primers (preferably 15-35bp) are prepared based on cDNA, and the sequences can be located on chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
  • PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
  • oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
  • Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct a chromosome-specific cDNA library.
  • Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step.
  • FISH Fluorescent in situ hybridization
  • the difference in cDNA or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution Capacity and each 20kb corresponds to a gene).
  • the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
  • suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
  • the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
  • the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell.
  • the polypeptides of the invention can be used in combination with other therapeutic compounds.
  • the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
  • sigma-54 factor 13 is administered in an amount effective to treat and / or prevent a specific indication.
  • the amount and range of sigma-54 factor 13 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician.
  • Total RM of human fetal brain was extracted by one step method with guanidine isothiocyanate / phenol / chloroform.
  • Poly (A) mRNA was isolated from total RNA using Quik mRNA Isolation Kit (Qiegene). 2ug poly (A) mRNA is reverse transcribed to form cDNA. Directional insertion of the 00 fragment into pBSK using the Smart cDNA Cloning Kit (purchased from Clontech) (+) The vector (Clontech) was transformed into DH5a at multiple cloning sites, and the bacteria formed a cDNA library.
  • Dye terminate cycle reaction ion sequencing kit Perkin-Elmer
  • ABI 377 automatic sequencer Perkin-Elmer
  • the determined cDNA sequence was compared with the existing public DNA sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 1169c09 was new DNA.
  • a series of primers were synthesized to determine the inserted cDNA fragments of the clone in both directions.
  • the sequence of the ⁇ -54 factor 13 of the present invention and the protein sequence encoded by the present invention were analyzed by the profile scan program (Basic local alignment search tool) in GCG [Al tschul, SF et a 1. J. Mol. Biol. 1990; 215 : 403-10], perform domain analysis in databases such as prosite.
  • the ⁇ _54 factor 13 of the present invention is homologous to the domain ⁇ -54 factor family protein at 23-101.
  • the homology result is shown in Fig. 1.
  • the homology rate is 0.29, the score is 16.29; the threshold is 16.10.
  • Example 3 Cloning of the gene encoding ⁇ -54 factor 13 by RT-PCR
  • CDNA was synthesized using fetal brain total RNA as a template and oligo-dT as a primer for reverse transcription reaction. After purification using Qiagene's kit, the following primers were used for PCR amplification:
  • Primerl 5'- GGAGTGAAGACTGGGTTTAGGGGC -3 '(SEQ ID NO: 3)
  • Primer2 5'- GATTTCAAAGTAGTATGTTTGTAG -3 '(SEQ ID NO: 4)
  • Primerl is a forward sequence located at the 5th end of SEQ ID NO: 1, starting at lbp;
  • Primer2 is the 3 'end reverse sequence in SEQ ID NO: 1.
  • Amplification conditions 50 ⁇ l of reaction volume in 50 ⁇ l KC1, 10 ⁇ l / L Tris-HCl, pH 8.5, 1.5 mmol / L MgCl 2 , 200 ⁇ 1 / L dNTP, lOpmol primer, 1U Taq DNA polymerase (Clontech).
  • the reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) for 25 cycles under the following conditions: 94. C 30sec; 55 ° C 30sec; 72 ° C 2min 0
  • set ⁇ -actin as a positive control and template blank as a negative control during RT-PCR.
  • the amplified product was purified using a QIAGEN kit, and linked to a pCR vector using a TA cloning kit (Unvitrogen product).
  • the DNA sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as the 1-11174bp shown in SEQ ID NO: 1.
  • Example 4 Northern blot analysis of ⁇ -54 factor 13 gene expression
  • RNA extraction in one step [Anal. Biochem 19114, 162, 156-159] 0
  • This method involves acid guanidinium thiocyanate-chloroform extraction. That is, the tissue is homogenized with 4M guanidine isothiocyanate-25m sodium citrate, 0.2M sodium acetate (pH4.0), and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1) are added. ), Mix and centrifuge. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. The obtained RM precipitate was washed with 70% ethanol, dried and dissolved in water.
  • the 32P- labeled probes (about 2 x l0 6 cpm / ml) and transferred to a nitrocellulose membrane RM is hybridized overnight at 42 ° C in a solution, the solution comprising 50% formamide -25mM KH 2 P0, (pH 7.4) -5 x SSC- 5 x Denhardt's solution and 200 ⁇ ⁇ / ⁇ 1 salmon sperm DNA. After hybridization, the filter was washed in 1 x SSC-0.1% SDS at 55 ° C for 30 min. Then, Phosphor Imager was used for analysis and quantification.
  • Example 5 In vitro expression, isolation and purification of recombinant sigma-54 factor 13
  • Primer3 5'- CCCCATATGATGCCCTATGGCATCTGCCACCAC -3 '(Seq ID No: 5)
  • Primer4 5'- CATGGATCCTTACAAGCATCCCAACGGAACCTT -3' (Seq ID No: 6)
  • Ndel and BamHI restriction sites correspond to the selectivity within the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865.3). Digestion site.
  • the PCR reaction was performed using the pBS-1169c09 plasmid containing the full-length target gene as a template.
  • the PCR reaction conditions were as follows: 10 pg of pBS-1169c09 plasmid was contained in a total volume of 50 ⁇ 1, and primers Primer-3 and Primer-4 were lOpmol and Advantage polymerase Mix (Clontech) 1 ⁇ 1, respectively. Cycle parameters: 94 ° C 20s, 60 ° C 30s, 68. C 2 min, a total of 25 cycles. Ndel and BamHI were used to double-digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase.
  • the ligation product was transformed into coliform bacteria DH5 CC using the calcium chloride method. After being cultured overnight on LB plates containing kanamycin (final concentration 30 ⁇ ⁇ / ⁇ 1), positive clones were selected by colony PCR method and sequenced. A positive clone (PET-1169c09) with the correct sequence was selected, and the recombinant plasmid was transformed into E. coli BL21 (DE3) plySs (product of Novagen) using the calcium chloride method.
  • a peptide synthesizer (product of PE Company) was used to synthesize the following ⁇ -54 factor 13-specific peptides:
  • the polypeptide is coupled with hemocyanin and bovine serum albumin to form a complex, respectively.
  • hemocyanin and bovine serum albumin For the method, see: Avrameas, et al. I. unochemistry, 1969; 6: 43. Rabbits were immunized with 4 mg of the i-cyanin polypeptide complex plus complete Freund's adjuvant, and 15 days later, the hemocyanin polypeptide complex plus incomplete Freund's adjuvant was used to boost the immunity once.
  • a titer plate coated with a 15 g / ml bovine serum albumin peptide complex was used as an ELISA to determine antibody titers in rabbit serum.
  • Total IgG was isolated from antibody-positive rabbit sera using protein A-Sepharose.
  • the peptide was bound to a cyanogen bromide-activated Sepharose4B column, and anti-peptide antibodies were separated from the total IgG by affinity chromatography.
  • the immunoprecipitation method proved that the purified antibody could specifically bind to sigma-54 factor 13.
  • Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
  • the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
  • the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
  • the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method.
  • Filter hybridization methods include dot blotting, Southern blotting, Northern blotting, and copying methods. They all use the same steps of hybridization after fixing the polynucleotide sample to be tested on the filter.
  • the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer, so that the non-specific binding site of the sample on the filter is saturated with the carrier and the synthetic polymer.
  • the pre-hybridization solution is then replaced with a hybridization buffer containing the labeled probe and incubated to hybridize the probe to the target nucleic acid.
  • the unhybridized probes are removed by a series of membrane washing steps. This embodiment makes use of higher intensity membrane washing conditions (such as lower salt concentration and higher temperature) to enable hybridization
  • the background is reduced and only strong specific words are retained.
  • the probes used in the examples include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
  • the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
  • the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
  • oligonucleotide fragments for use as hybridization probes from the polynucleotide SEQ ID NO: 1 of the present invention should follow the following principles and several aspects to be considered:
  • the preferred range of probe size is 18-50 nucleotides
  • Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements For homology comparison of the regions, if the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, the primary probe should not be used generally;
  • Probe 1 (probel), which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt)
  • Probe 1 which belongs to the second type of probe, is equivalent to the replacement mutant sequence (41Nt) of the gene fragment or its complementary fragment of SEQ ID NO: 1:
  • PBS phosphate buffered saline
  • step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
  • NC membranes nitrocellulose membranes
  • Two NC membranes are required for each probe for subsequent experiments.
  • the film is washed with high-strength conditions and strength conditions, respectively.
  • the sample membrane was placed in a plastic bag, and 3 to 10 mg of prehybridization solution (10xDenhardt's; 6xSSC, 0.1 mg / ml CT DNA (calf thymus DNA)) was added. After sealing the mouth of the bag, shake at 68 ° C for 2 hours.
  • prehybridization solution 10xDenhardt's; 6xSSC, 0.1 mg / ml CT DNA (calf thymus DNA)

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Toxicology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Peptides Or Proteins (AREA)

Abstract

L'invention concerne un nouveau polypeptide, un facteur σ-54 13, et un polynucléotide codant pour ce polypeptide ainsi qu'un procédé d'obtention de ce polypeptide par des techniques recombinantes d'ADN. L'invention concerne en outre les applications de ce polypeptide dans le traitement de maladies, notamment des tumeurs malignes, de l'hémopathie, de l'infection par VIH, de maladies immunitaires et de diverses inflammations. L'invention concerne aussi l'antagoniste agissant contre le polypeptide et son action thérapeutique ainsi que les applications de ce polynucléotide codant pour le facteur σ-54 13.
PCT/CN2000/000658 1999-12-29 2000-12-25 NOUVEAU POLYPEPTIDE, FACTEUR σ-54 13, ET POLYNUCLEOTIDE CODANT POUR CE POLYPEPTIDE WO2001049725A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU23405/01A AU2340501A (en) 1999-12-29 2000-12-25 A novel polypeptide-sigma-54 factor 13 and the polynucleotide encoding said polypeptide

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN99127211.0 1999-12-29
CN 99127211 CN1301749A (zh) 1999-12-29 1999-12-29 一种新的多肽——σ－54因子13和编码这种多肽的多核苷酸

Publications (1)

Publication Number Publication Date
WO2001049725A1 true WO2001049725A1 (fr) 2001-07-12

Family

ID=5284799

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2000/000658 WO2001049725A1 (fr) 1999-12-29 2000-12-25 NOUVEAU POLYPEPTIDE, FACTEUR σ-54 13, ET POLYNUCLEOTIDE CODANT POUR CE POLYPEPTIDE

Country Status (3)

Country Link
CN (1) CN1301749A (fr)
AU (1) AU2340501A (fr)
WO (1) WO2001049725A1 (fr)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1997035611A1 (fr) * 1996-03-27 1997-10-02 The Johns-Hopkins University Facteur sigma du mycobacterium tuberculosis en phase stationnaire, reagissant aux agressions et regulation de celui-ci
JPH10201475A (ja) * 1997-01-22 1998-08-04 Hokko Chem Ind Co Ltd 植物のｒｎａポリメラーゼのシグマ因子遺伝子

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1997035611A1 (fr) * 1996-03-27 1997-10-02 The Johns-Hopkins University Facteur sigma du mycobacterium tuberculosis en phase stationnaire, reagissant aux agressions et regulation de celui-ci
JPH10201475A (ja) * 1997-01-22 1998-08-04 Hokko Chem Ind Co Ltd 植物のｒｎａポリメラーゼのシグマ因子遺伝子

Also Published As

Publication number Publication date
AU2340501A (en) 2001-07-16
CN1301749A (zh) 2001-07-04

Similar Documents

Publication Publication Date Title
WO2002051867A1 (fr) Nouveau facteur 8.8 polypeptidique liberant de la corticotrophine et polynucleotide codant ledit polypeptide
WO2002026972A1 (fr) Nouveau polypeptide, proteine humaine 20.13 de liaison de l'acide polyadenylique, et polynucleotide codant ce polypeptide
WO2001090169A1 (fr) Nouveau polypeptide, antigene nucleaire de proliferation cellulaire (pcna) 13, et polynucleotide codant ce polypeptide
WO2001047968A1 (fr) Nouveau polypeptide, hexokinase 12, et polynucleotide codant pour ce polypeptide
WO2001049725A1 (fr) NOUVEAU POLYPEPTIDE, FACTEUR σ-54 13, ET POLYNUCLEOTIDE CODANT POUR CE POLYPEPTIDE
WO2001047983A1 (fr) Nouveau polypeptide, facteur de liberation de la corticotrophine 13, et polynucleotide codant pour ce polypeptide
WO2001048195A1 (fr) Nouveau polypeptide, proteine rcc1 10, et polynucleotide codant pour ce polypeptide
WO2001048000A1 (fr) Nouveau polypeptide, fibronectine 10 de type ii, et polynucleotide codant pour ce polypeptide
WO2001046409A1 (fr) Nouveau polypeptide, proteine ribosomale s7 9, et polynucleotide codant pour ce polypeptide
WO2001046437A1 (fr) Nouveau polypeptide, region de liaison d'arn-eucaryote rnp-1-21, et polynucleotide codant pour ce polypeptide
WO2001062783A1 (fr) Nouveau polypeptide, compose de clivage 69, et polynucleotide codant pour ce polypeptide
WO2001049723A1 (fr) Nouveau polypeptide, atp synthetase 9, et polynucleotide codant pour ce polypeptide
WO2002026810A1 (fr) Nouveau polypeptide, substance proteique p125-77.22, et polynucleotide codant ce polypeptide
WO2001072796A1 (fr) Nouveau polypeptide, facteur humain de transcription de la differentiation cellulaire 11, et polynucleotide codant pour ce polypeptide
WO2001073068A1 (fr) Nouveau polypeptide, l1-12, et polynucleotide codant pour ce polypeptide
WO2001072793A1 (fr) Nouveau polypeptide, proteine humaine de regulation 12 de la proteine hydrolase, et polynucleotide codant pour ce polypeptide
WO2001049731A1 (fr) Nouveau polypeptide, proteine de regulation 9 de la protease humaine, et polynucleotide codant pour ce polypeptide
WO2001046242A1 (fr) NOUVEAU POLYPEPTIDE, GENE σ-54 9, ET POLYNUCLEOTIDE CODANT POUR CE POLYPEPTIDE
WO2001047988A1 (fr) Nouveau polypeptide, proteine de reparation 11 de l'adn, et polynucleotide codant pour ce polypeptide
WO2001047965A1 (fr) Nouveau polypeptide, proteine rcc1 11, et polynucleotide codant pour ce polypeptide
WO2001049853A1 (fr) Phosphoribosyle glycinamide synthase 9 et polynucleotide codant ce polypeptide
WO2001087960A1 (fr) Nouveau polypeptide, proteine humaine 10 de liaison a l'adn associee a kruppel, et polynucleotide codant pour ce polypeptide
WO2001083541A1 (fr) Nouveau polypeptide, proteine humaine 42 de liaison a l'adn associee a kruppel, et polynucleotide codant pour ce polypeptide
WO2001048001A1 (fr) Nouveau polypeptide, quinone-proteine reductase 7, et polynucleotide codant pour ce polypeptide
WO2001049862A1 (fr) Nouveau polypeptide, famille proteique 10 d'hormones de croissance, et polynucleotide codant pour ce polypeptide

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP