WO2001083541A1 - Nouveau polypeptide, proteine humaine 42 de liaison a l'adn associee a kruppel, et polynucleotide codant pour ce polypeptide - Google Patents

Nouveau polypeptide, proteine humaine 42 de liaison a l'adn associee a kruppel, et polynucleotide codant pour ce polypeptide Download PDF

Info

Publication number
WO2001083541A1
WO2001083541A1 PCT/CN2001/000661 CN0100661W WO0183541A1 WO 2001083541 A1 WO2001083541 A1 WO 2001083541A1 CN 0100661 W CN0100661 W CN 0100661W WO 0183541 A1 WO0183541 A1 WO 0183541A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
polynucleotide
binding protein
human
dna
Prior art date
Application number
PCT/CN2001/000661
Other languages
English (en)
Chinese (zh)
Inventor
Yumin Mao
Yi Xie
Original Assignee
Shanghai Biowindow Gene Development Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shanghai Biowindow Gene Development Inc. filed Critical Shanghai Biowindow Gene Development Inc.
Priority to AU70440/01A priority Critical patent/AU7044001A/en
Publication of WO2001083541A1 publication Critical patent/WO2001083541A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • the present invention belongs to the field of biotechnology. Specifically, the present invention describes a novel polypeptide-human Kruppe 1-associated DNA-binding protein 42, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and polypeptide.
  • the regulation of transcription is controlled by the interaction of a mixture of DNA and proteins, which include protein domains with highly conserved sequences.
  • the most typical domains are helix-turn-helix structure, helix-cyclization-helix structure and zinc finger structure.
  • each of these domains participates in the response of transcription factors to their corresponding DNA recognition sites, resulting in specific activation or repression of gene expression (Klug, A., and Schwabe, JWR, 1995).
  • the zinc finger gene family belongs to the largest gene family in humans and plays an important role in transcription regulation. It can be subdivided into many gene subfamilies, one of which is the Cys2 / Hi s2 type zinc finger gene.
  • the zinc finger domain There is a highly conserved sequence TGEPKYX (X represents any one of the amino acids). Cys2 / H i s2 zinc finger protein contains a specific structure ⁇ Kruppe l zinc finger protein, first found in Drosophila Kruppe l protein.
  • Hematopoiesis is a complex physiological process that requires accurate regulation of gene expression during embryogenesis, fetal period, and various stages after birth. The disruption of this regulatory process may lead to disturbances in the production of blood cells.
  • Some zinc finger proteins can regulate the differentiation of hematopoietic cells into red blood cells (GAGA-1 and EKLF), megakaryocytes (GAGA-1 and GAGA-2), and lymphocytes.
  • many zinc finger proteins are also closely related to the embryogenesis of hematological malignancies.
  • the Cys2 / H i s2 zinc finger gene family has duplicate zinc finger domains, including finger structures formed by the binding of two Cys and two Hi s to a zinc ion (Jacos, G. H., 1992).
  • Kruppel's zinc finger-like gene is a key transcriptional repressor during Drosophila growth. In mammals and humans, these genes are involved in embryonic development and blood cell production.
  • the Krox20 gene in mice and the PL2F gene shared by mice and humans are related to the development of the rhabdoganglia in the hindbrain (Cook, M., Gou ld, A., Brand, N. et a l.);
  • the EKLF protein acts through binding to cis Factors regulate globulin expression, thereby regulating hemoglobin from fetal Y-globulin to adult globulin Change.
  • the polypeptide of the present invention has 96% identity and 98% similarity with the aforementioned Kruppel-associated DNA binding protein, and contains a conserved sequence characteristic of the Kmppe l zinc finger protein family, so this protein is considered to be a new type of DNA
  • the binding protein has a biological function similar to that of Kruppel zinc finger protein, and is named as a human Kruppel-associated DNA binding protein 42.
  • the human Kruppel-associated DNA-binding protein 42 protein plays an important role in regulating important functions of the body such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes, so there is always a need to identify more participants in this field. These processes are related to the human Kruppel-associated DNA-binding protein 42 protein, and in particular the amino acid sequence of this protein is identified. Isolation of the new human Kruppe l-associated DNA-binding protein 42 protein-encoding gene also provides a basis for research to determine its role in health and disease states. This protein may form the basis for developing diagnostic and / or therapeutic drugs for diseases, so isolating its coding DNA is important. Object of the invention
  • Another object of the invention is to provide a polynucleotide encoding the polypeptide.
  • Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding a human Kruppe l related DNA-binding protein 42.
  • Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding a human Kruppe l-related DNA binding protein 42.
  • Another object of the present invention is to provide a method for producing human Kruppel-associated DNA binding protein 42.
  • Another object of the present invention is to provide antibodies against the polypeptide of the present invention, human Kruppel-associated DNA binding protein 42.
  • Another object of the present invention is to provide mimetic compounds, antagonists, agonists, and inhibitors against the human ruppe l related DNA binding protein 42 of the polypeptide of the present invention.
  • Another object of the present invention is to provide a method for diagnosing and treating diseases associated with abnormalities in human Kruppel-associated D-binding protein 42. Summary of invention
  • the invention relates to an isolated polypeptide, which is of human origin, and which comprises: SEQ ID No. 2 Amino acid sequence of a polypeptide, or a conservative variant, biologically active fragment or derivative thereof.
  • the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
  • sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 330-1475 in SEQ ID NO: 1; and (b) a sequence having 1-1873 in SEQ ID NO: 1 Sequence of bits.
  • the present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
  • the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
  • the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of human Kmppel-associated D-binding protein 42 protein, which comprises utilizing the polypeptide of the invention.
  • the invention also relates to compounds obtained by this method.
  • the present invention also relates to a method for detecting a disease or susceptibility to disease associated with abnormal expression of human Kruppel-associated DNA-binding protein 42 protein in vitro, comprising detecting a mutation in the polypeptide or a sequence encoding a polynucleotide thereof in a biological sample, or Detection of the amount or biological activity of a polypeptide of the invention in a biological sample.
  • the invention also relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
  • the present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention in the preparation of a medicament for treating cancer, developmental disease or immune disease or other diseases caused by abnormal expression of human Kruppel-associated DNA binding protein 42.
  • FIG. 1 is a comparison diagram of amino acid sequence homology of the Kruppel-related DNA binding protein 42 and Kruppel-related DNA binding protein of the present inventor.
  • the sequence above is human Kruppel-associated DNA-binding protein 42
  • Below is the Kruppe l related D-binding protein.
  • Identical amino acids are represented by single-character amino acids between the two sequences, and similar amino acids are represented by "+”.
  • Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of the isolated human Kruppe l-associated DNA-binding protein 42.
  • 42KDa is the molecular weight of the protein.
  • the arrow indicates the isolated protein band.
  • Nucleic acid sequence refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
  • amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
  • amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
  • a protein or polynucleotide “variant” refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it. The changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or the nucleotide sequence. Variants can have "conservative" changes in which the substituted amino acid has a structural or chemical property similar to the original amino acid, such as the replacement of isoleucine with leucine. Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
  • “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
  • Insertion means that a change in the amino acid sequence or nucleotide sequence results in an increase in one or more amino acids or nucleotides compared to a molecule that exists in nature.
  • Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
  • Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
  • immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response and to bind specific antibodies in a suitable animal or cell.
  • An "agonist” refers to a molecule that, when associated with human Kruppe 1-associated DNA-binding protein 42, can cause the protein to change, thereby regulating the activity of the protein.
  • An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that can bind to human Kruppe 1 related DNA binding protein 42.
  • Antagonist refers to a molecule that can block or regulate the biological or immunological activity of human Kruppe l-associated DNA binding protein 42 when bound to human Kruppe l-associated DNA binding protein 42 .
  • Antagonists and inhibitors can include proteins, nucleic acids, carbohydrates or any other A molecule associated with human Kruppel-associated DNA-binding protein 42.
  • Regular refers to a change in the function of human Kruppe l-associated DNA binding protein 42, including an increase or decrease in protein activity, a change in binding characteristics, and any other biological properties, functions, or Changes in immune properties.
  • “Substantially pure” means substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated. Those skilled in the art can purify human Kruppel-associated DNA binding protein 42 using standard protein purification techniques. The substantially pure human Kruppel-associated DNA binding protein 42 produces a single main band on a non-reducing polyacrylamide gel. The purity of human Kruppel-related DNA-binding protein 42 peptide can be analyzed by amino acid sequence.
  • Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
  • sequence C-T-G-A
  • complementary sequence G-A-C-T.
  • the complementarity between two single-stranded molecules may be partial or complete.
  • the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
  • “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
  • Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Southern imprinting or Nor thern blotting, etc.) under conditions of reduced stringency.
  • Substantially homologous sequences or hybridization probes can compete and inhibit the binding of fully homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.
  • Percent identity refers to the percentage of sequences that are the same or similar in a comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as through the MEGALIGN program (Lasergene sof tware package, DNASTAR, Inc., Madi son Wis.). The MEGALIGN program can compare two or more sequences according to different methods such as the Clus ter method (Hi gg ins, DG and PM Sharp (1988) Gene 73: 237-244). The Clus ter method checks the distance between all pairs by Each group of sequences is arranged into clusters. Each cluster is then assigned in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula:
  • the percent identity between nucleic acid sequences can also be determined by the Clus ter method or by methods known in the art such as Jotun Hein (Hein J., (1990) Methods in enzymology 183: 625-645). 0
  • Similarity refers to the identity of amino acid residues at corresponding positions when aligning amino acid sequences. Or the extent of conservative substitution.
  • Amino acids used for conservative substitution for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
  • Antisense refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence.
  • Antisense strand refers to a nucleic acid strand that is complementary to a “sense strand.”
  • Derivative refers to HFP or a chemical modification of its nucleic acid. This chemical modification may be a substitution of a hydrogen atom with a fluorenyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules. '
  • Antibody refers to a complete antibody molecule and its fragments, such as Fa,? ( ⁇ ') 2 and? ⁇ It can specifically bind to the human Kruppel-associated DNA-binding protein 42 epitope.
  • a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
  • isolated refers to the removal of a substance from its original environment (for example, its natural environment if it is naturally occurring).
  • a naturally-occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
  • Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not part of its natural environment, they are still isolated.
  • isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
  • polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances in the natural state .
  • isolated human Kruppel-associated DNA binding protein 42 refers to human Kruppel-associated D-binding protein 42 that is substantially free of other proteins, lipids, sugars, or other substances with which it is naturally associated. Those skilled in the art can purify human Kruppe l related D-binding protein 42 using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of the human Kruppel-associated DNA-binding protein 42 peptide can be analyzed by amino acid sequence.
  • the present invention provides a novel polypeptide-human Kruppel-associated DNA binding protein 42, which is basically composed of the amino acid sequence shown in SEQ ID NO: 2.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
  • the polypeptide of the present invention may be a naturally purified product, or a chemically synthesized product, or a recombinant technology from a prokaryotic or eukaryotic host (for example, bacteria, yeast, higher plants, Insect and mammalian cells).
  • the polypeptide of the invention may be glycosylated, or it may be non-glycosylated.
  • Polypeptides of the invention may also include or exclude starting methionine residues.
  • the invention also includes fragments, derivatives, and analogs of human Kruppe l-related DNA-binding protein 42.
  • fragment refers to a polypeptide that substantially retains the same biological function or activity of the human Kruppe 1-related DNA-binding protein 42 of the present invention.
  • a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution
  • the amino acid may or may not be encoded by a genetic codon; or ( ⁇ ) such a type in which one or more amino acid residues are substituted with other groups to include a substituent; or (III) such A type in which a mature polypeptide is fused to another compound (such as a compound that extends the half-life of a polypeptide, such as polyethylene glycol); or (IV) a type of polypeptide sequence in which an additional amino acid sequence is fused into a mature polypeptide ( Such as leader sequences or secreted sequences or sequences used to purify this polypeptide or protease sequences).
  • such fragments, derivatives and analogs are considered to be within the knowledge of those skilled in the art.
  • the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
  • the polynucleotide of the present invention is found from a cD library of human fetal brain tissue. It contains a polynucleotide sequence of 1873 bases in length and its open reading frame 330-1475 encodes 381 amino acids. According to the amino acid sequence homology comparison, it was found that this polypeptide has 75% homology with the Kruppe l-related DNA binding protein. It can be inferred that the human Kruppe l-related DNA binding protein 42 has a similar structure to the Kruppe l-related DNA binding protein and function.
  • the polynucleotide of the present invention may be in the form of DNA or RNA.
  • DNA forms include cDNA, genomic DNA, or synthetic DNA.
  • DNA can be single-stranded or double-stranded.
  • DNA can be coding or non-coding.
  • the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
  • a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
  • the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
  • polynucleotide encoding a polypeptide means including a polynucleotide encoding the polypeptide and including additional Coding and / or non-coding polynucleotides.
  • the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
  • Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
  • an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
  • the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity, between the two sequences).
  • the present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions.
  • “strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60 ° C; or (2) Add a denaturant during hybridization, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% F i co ll, 42 ° C, etc .; or (3) only between the two sequences Crosses occur at least 95% or more, and more preferably 97% or more.
  • the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
  • nucleic acid fragments that hybridize to the sequences described above.
  • a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 nuclei. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques (such as PCR) to identify and / or isolate polynucleotides encoding human Kruppe 1-associated DNA binding protein 42.
  • polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
  • the specific polynucleotide sequence encoding the human Kruppe 1 related DNA-binding protein 42 of the present invention can be obtained by various methods.
  • polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
  • the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.
  • genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences.
  • the standard method for isolating the cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library.
  • the construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manua, Cold Spring Harbor Laboratory. New York, 1989).
  • Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
  • genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DNA-RNA hybridization; (2) the presence or absence of marker gene functions; (3) determination of the level of transcripts of human Kruppe l-associated DNA-binding protein 42 (4) Detecting protein products expressed by genes through immunological techniques or measuring biological activity. The above methods can be used singly or in combination.
  • the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
  • the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
  • the probe used here is generally a DNA sequence chemically synthesized based on the gene sequence information of the present invention.
  • the genes or fragments of the present invention can of course be used as probes.
  • the D probe can be labeled with a radioisotope, luciferin, or an enzyme (such as alkaline phosphatase).
  • the protein product of the human Kruppel-associated DNA binding protein 42 gene can be detected by immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA).
  • immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA).
  • a method (Sa iki, et al. Science 1985; 230: 1350-1354) using PCR technology to amplify DNA / RNA is preferably used to obtain the gene of the present invention.
  • the RACE method RACE-Rapid Amplification of cDNA Ends
  • the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein Select and synthesize using conventional methods.
  • the amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
  • polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be measured by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, sequencing needs to be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
  • the present invention also relates to a vector comprising a polynucleotide of the present invention, and a host cell that is genetically engineered using the vector of the present invention or directly using a human Kruppel-associated DNA-binding protein 42 coding sequence, and the recombinant technology to produce the polypeptide of the present invention Methods.
  • the polynucleotide sequence encoding the human Kruppel-related DNA binding protein 42 can be inserted Into the vector to form a recombinant vector containing the polynucleotide of the present invention.
  • vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
  • Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al.
  • any plasmid and vector can be used to construct a recombinant expression vector.
  • An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
  • Methods known to those skilled in the art can be used to construct expression vectors containing the D sequence encoding human Kruppe 1-associated DNA binding protein 42 and appropriate transcriptional / translational regulatory elements. These methods include in vitro recombinant DNA technology, DNA synthesis technology, in vivo recombination technology, etc. (Sambroook, et al. Molecular Cloning, a Laboratory Manua, Cold Spooning Harbor Labora tory. New York, 1989).
  • the DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide riiRNA synthesis. Representative examples of these promoters are: the lac or trp promoter of E.
  • the expression vector also includes a ribosome binding site and a transcription terminator for translation initiation. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Examples include 100 to 270 base pairs of the SV40 enhancer on the late side of the origin of replication, polyoma enhancers and adenovirus enhancers on the late side of the origin of replication.
  • the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • GFP fluorescent protein
  • tetracycline or ampicillin resistance for E. coli.
  • a polynucleotide encoding a human Kruppel-related DNA-binding protein 42 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to form a genetically engineered host cell containing the polynucleotide or the recombinant vector.
  • host cell refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell.
  • Escherichia coli, Streptomyces bacterial cells such as Salmonella typhimurium
  • fungal cells such as yeast
  • plant cells insect cells
  • fly S2 or Sf 9 animal cells
  • animal cells such as CH0, COS or Bowes melanoma cells.
  • Transformation of a host cell with a DNA sequence according to the present invention or a recombinant vector containing the D sequence can be performed using conventional techniques well known to those skilled in the art.
  • the host is a prokaryote such as E. coli
  • competent cells capable of DNA uptake can be in the exponential growth phase were harvested, treated with CaC l 2 method used in steps well known in the art. Alternatively, MgCl 2 is used.
  • transformation can also be performed by electroporation.
  • the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
  • the polynucleotide sequence of the present invention can be used to express or produce recombinant human Kruppe 1-associated DNA binding protein 42 (Sc ience, 1984; 224: 1431). Generally speaking, there are the following steps:
  • the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
  • a suitable method such as temperature conversion or chemical induction
  • the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If necessary, the recombinant protein can be isolated and purified by various separation methods using its physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
  • conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid
  • polypeptides of the present invention as well as antagonists, agonists and inhibitors of the polypeptides, can be directly used in the treatment of diseases, for example, they can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection, and immune diseases.
  • the zinc finger protein family mostly participates in transcriptional regulation by binding to DNA.
  • the C2H2 zinc finger protein contains a Kruppe l zinc finger protein with a specific structure.
  • the Kruppe l-type zinc finger proteins containing the KRAB domain constitute a subfamily.
  • the KRAB domain is related to the correct localization and function of the protein.
  • C2H2-type zinc finger domain-containing proteins are associated with the following diseases: hematological malignancies such as leukemia, non-Hodgkin's lymphoma, solid tumors such as thyroid adenoma, uterine fibroids, and neurological diseases such as extrapyramidal Department of dysfunction, Parkinson's syndrome, ataxia, neurocytoma, glioblastoma, developmental disorders such as Williams syndrome, cracked hands and feet, Bayer's syndrome, other tumors such as neuroblasts Cell tumor, colon cancer, breast cancer, etc.
  • hematological malignancies such as leukemia, non-Hodgkin's lymphoma, solid tumors such as thyroid adenoma, uterine fibroids
  • neurological diseases such as extrapyramidal Department of dysfunction, Parkinson's syndrome, ataxia, neurocytoma, glioblastoma, developmental disorders such as Williams syndrome, cracked hands and feet, Bayer's syndrome, other tumors such as neuroblasts Cell tumor, colon cancer, breast cancer, etc.
  • polypeptides of the present invention are highly homologous with known human Kruppel-associated DNA-binding proteins, both of which are members of the human zinc finger protein KRAB subfamily and have similar physiological functions.
  • the abnormal expression of the human Kruppel-associated DNA binding protein 42 of the present invention will produce various diseases, especially various tumors, neurological diseases, hematological malignant diseases, and developmental disorders. These diseases include, but are not limited to:
  • Tumors of various tissues thyroid tumors, uterine fibroids, neuroblastomas, ependymomas, colon cancer, breast cancer, leukemia, lymphoma, malignant histiocytosis, melanoma, sarcoma, gastric cancer, liver cancer, lung cancer, Esophageal cancer, myeloma, teratoma, adrenal cancer, bladder cancer, bone cancer, osteosarcoma, brain cancer, uterine cancer, gallbladder cancer, liver cancer, thymic tumor, uterine fibroids, astrocytoma, ependymoma, Glioblastoma, Neurofibromatosis, Myeloma, Myeloma, Endometrial Cancer, Gallbladder Cancer, Nasal and Sinus Tumors, Nasopharyngeal Cancer, Laryngeal Cancer, Tracheal Tumors, Fibroma, Fibrosarcoma, Lipoma, Liposarcoma, Leio
  • Neurological diseases Parkinson's syndrome, ataxia, neurocytoma, glioblastoma, dementia, depression, amnesia, Huntington's disease, epilepsy, migraine, dementia, multiple sclerosis, Myasthenia gravis, muscular hypertrophy, tonic muscular dystrophy, dystonia, schizophrenia, depression, paranoia, anxiety, obsessive-compulsive disorder, phobia, neurasthenia
  • Hematological malignancies Leukemia, non-Hodgkin's lymphoma
  • Abnormal expression of the human Kruppel-associated DNA-binding protein 42 of the present invention will also produce certain genetic diseases, endocrine system diseases such as endocrine adenoma, and immune system diseases.
  • the polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat various diseases, especially various tumors, nervous system diseases, development disorders, blood Liquid malignant diseases, certain hereditary diseases, endocrine system diseases such as endocrine adenoma, immune system diseases, etc.
  • the invention also provides screening compounds to identify increasing (agonist) or repressing (antagonist) humans.
  • Kruppel-Related D-Binding Protein 42 Agent Method. Agonists enhance human Kruppe 1-associated DNA-binding protein 42 to stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
  • a mammalian cell or a membrane preparation expressing human Kruppe l-associated DNA binding protein 42 can be cultured with labeled human Kruppe l-associated DNA binding protein 42 in the presence of a drug. The ability of the drug to increase or block this interaction is then determined.
  • Antagonists of human Kruppel-related DNA-binding protein 42 include antibodies, compounds, receptor deletions, and the like that have been screened. Antagonists of human Kruppel-associated DNA binding protein 42 can bind to human Kruppel-associated DNA binding protein 42 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot function biological functions.
  • human Kruppel-associated DNA-binding protein 42 can be added to a bioanalytical assay to determine the effect of the compound on the interaction between human Kruppe l-associated D-binding protein 42 and its receptor. Whether the compound is an antagonist. Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds.
  • Peptide molecules capable of binding to human Kruppe l-associated DNA binding protein 42 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. In the screening, human Kruppe l related DNA binding protein 42 molecules should generally be labeled.
  • the present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies.
  • the invention also provides antibodies against human Kruppe l-related DNA-binding protein 42 epitopes. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by Fab expression libraries.
  • Polyclonal antibodies can be produced by injecting human Kruppe l-related DNA-binding protein 42 directly into immunized animals (such as rabbits, mice, rats, etc.).
  • immunized animals such as rabbits, mice, rats, etc.
  • a variety of adjuvants can be used to enhance the immune response, including but not limited to 'S adjuvant and so on.
  • Techniques for preparing monoclonal antibodies to human Kruppe l-related DNA-binding protein 42 include, but are not limited to, hybridoma technology (Kohler and Miste in. Nature, 1975, 256: 495-497), triple tumor technology, human B- Cell hybridoma technology, EBV-hybridoma technology, etc.
  • Chimeric antibodies that bind human constant regions to non-human-derived variable regions can be produced using existing techniques (Morrison et al, PNAS, 1985, 81: 6851).
  • the existing technology for producing single chain antibodies (US Pat No. 4946778) can also be used to produce single chain antibodies against human Kruppel-associated DNA binding protein 42.
  • Antibodies against human Kruppel-associated DNA binding protein 42 can be used in immunohistochemical techniques to detect human Kruppel-associated DNA binding protein 42 in biopsy specimens.
  • Monoclonal antibodies that bind to human Kruppel-associated DNA-binding protein 42 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
  • Antibodies can also be used to design immunotoxins that target a particular part of the body.
  • human Kruppel-associated DNA-binding protein 42 high-affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
  • a common method is to attack the amino group of an antibody with a thiol crosslinker such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
  • This hybrid antibody can be used to kill human Kruppel-associated DNA-binding protein 42.
  • Cell. -The antibodies of the present invention can be used to treat or prevent diseases related to human Kruppe l-associated DNA binding protein 42.
  • Administration of appropriate doses of antibodies can stimulate or block the production or activity of human Kruppe l-associated D-binding protein 42.
  • the invention also relates to a diagnostic test method for quantitative and localized detection of human Kruppel-associated DNA-binding protein 42 levels. These tests are well known in the art and include FISH and radioimmunoassays. The level of human Kruppel-associated DNA-binding protein 42 detected in the test can be used to explain the importance of human Kruppel-associated D-binding protein 42 in various diseases and to play a role in diagnosing human Kruppel-associated D-binding protein 42 disease.
  • polypeptide of the present invention can also be used for peptide mapping analysis.
  • the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
  • the polynucleotide encoding human Kruppel-associated DNA-binding protein 42 can also be used for a variety of therapeutic purposes. Gene therapy technology can be used to treat abnormal cell proliferation, development, or metabolism caused by the non-expression or abnormal / inactive expression of human Kruppel-associated DNA binding protein 42. Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated human Kruppel-associated DNA-binding protein 42 to inhibit endogenous human Kruppel-associated D-binding protein 42 activity.
  • a mutated human Kruppel-associated D-binding protein 42 may be a shortened human Kruppe l-associated DNA-binding protein 42 that lacks a signaling functional domain.
  • the recombinant gene therapy vector can be used for treating diseases caused by abnormal expression or activity of human Kruppel-associated DNA binding protein 42.
  • Virus-derived expression vectors such as retroviruses, adenoviruses, adenovirus-associated viruses, herpes simplex virus, and parvoviruses can be used to transfer polynucleotides encoding human Kruppe 1-associated D-binding protein 42 into cells. Construction of DNA related to encoding Kruppe l Methods for recombinant viral vectors that bind to a protein 42 polynucleotide can be found in the literature (Sambrook, et al.). In addition, a recombinant polynucleotide encoding human Kruppe l-related DNA-binding protein 42 can be packaged into liposomes and transferred into cells.
  • Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
  • a vector such as a virus, phage, or plasmid
  • Oligonucleotides including antisense RNA and DNA
  • ribozymes that inhibit human Kruppel-associated DNA-binding protein 42 mRNA are also within the scope of the present invention.
  • a ribozyme is an enzyme-like RNA molecule that can specifically decompose specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA and performs endonucleation.
  • Antisense RNA, DNA, and ribozymes can be obtained using any existing RNA or DNA synthesis technology, such as solid-phase phosphate amide chemical synthesis to synthesize oligonucleotides.
  • Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA. This DNA sequence has been integrated downstream of the vector's RNA polymerase promoter. In order to increase the stability of the nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the phosphorothioate or peptide bond instead of the phosphodiester bond is used for the ribonucleoside linkage.
  • the polynucleotide encoding human Kruppe l-associated DNA binding protein 42 can be used for the diagnosis of diseases related to human Kruppe l-associated DNA binding protein 42.
  • the polynucleotide encoding human Kruppe l-related DNA binding protein 42 can be used to detect the expression of human Kruppe l-related DNA binding protein 42 or the abnormal expression of human Kruppe l-related DNA binding protein 42 in a disease state.
  • the DNA sequence encoding human Kruppe l-related DNA binding protein 42 can be used to hybridize biopsy specimens to determine the expression of human Kruppe l-related DNA binding protein 42.
  • Hybridization techniques include Southern blotting, Nor thern blotting, and in situ hybridization.
  • a part or all of the polynucleotide of the present invention can be used as a probe and fixed on a microarray or a DNA chip (also referred to as a "gene chip") for analyzing differential expression analysis of genes and genetic diagnosis in tissues.
  • Human Kruppe l-associated DNA binding protein 42 specific primers can be used to perform RNA-polymerase chain reaction (RT-PCR) in vitro amplification to detect human Kruppe l-associated DNA binding protein 42 transcripts.
  • Detection of mutations in the human Kruppe l-associated DNA binding protein 42 gene can also be used to diagnose human Kruppe l-associated DNA binding protein 42-related diseases.
  • Human Kruppe l-related DNA binding protein 42 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type human Kruppe l-related D-binding protein 42 DNA sequence. Mutations can be detected using existing techniques such as Southern blotting, D-sequence analysis, PCR, and in situ hybridization. In addition, mutations may affect eggs Expression of white, so Northern blotting, Western blotting can be used to indirectly determine whether a gene is mutated. The sequences of the invention are also valuable for chromosome identification.
  • This sequence will specifically target a specific position on a human chromosome and can hybridize to it.
  • specific sites for each gene on the chromosome need to be identified.
  • only a few chromosome markers based on actual sequence data are available for labeling chromosome positions.
  • an important first step is to locate these DNA sequences on a chromosome.
  • the PCR primers (preferably 15-35bp) are prepared based on the cDNA, and the sequences can be located on the chromosomes. Then, these bowels were used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
  • PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
  • oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
  • Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.
  • Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step.
  • FISH Fluorescent in situ hybridization
  • the difference in cDNA or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution Capacity and each 20kb corresponds to a gene).
  • the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
  • suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
  • the composition contains a safe and effective amount of the polypeptide or antagonist and does not affect Pharmaceutically effective carriers and excipients. These compositions can be used as drugs for the treatment of diseases.
  • the present invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the present invention.
  • polypeptides of the invention can be used in combination with other therapeutic compounds.
  • the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
  • Human Kruppe l related DNA binding protein 42 is administered in an amount effective to treat and / or prevent a specific indication.
  • the amount and dose range of human Kruppel-associated DNA-binding protein 42 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician. Examples
  • Total human fetal brain RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform.
  • Quik raRNA Isolat ion Kit product of Qiegene was used to isolate poly (A) m legs from total RNA. 2ug poly (A) mRNA is reverse transcribed to form cDNA.
  • Smar t cDNA cloning kit purchased from Citronech was used. The 0 fragment was inserted into the multiple cloning site of the pBSK (+) vector (Clontech), and transformed into DH5 ct. The bacteria formed a cDNA library.
  • Dye terminate cycle react ion sequencing kit Perkin-Elmer
  • ABI 377 automatic sequencer Perkin-Elmer
  • the determined cDNA sequence was compared with the existing public DNA sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 1236a06 was new DNA.
  • a series of primers were synthesized to determine the inserted cDNA fragments of the clone in both directions.
  • the Blast program (Basic local al ignment search tool) [Al tschul, SF et al. J. Mol. Biol. 1990; 215 was used for the sequence of human Kruppel-related DM binding protein 42 and its encoded protein sequence. : 403-10], perform homology search in databases such as Genbank, Switzerland, and so on.
  • the gene with the highest homology to the D-binding protein 42 related to the human Kruppel of the present invention is a known Kruppel-associated DNA-binding protein, and its encoded protein has the accession number U168 4 5 in Genbank.
  • the protein homology results are shown in Figure 1. The two are highly homologous, with an identity of 96% and a similarity of 98%.
  • Example 3 Cloning of a gene encoding human Kruppel-associated DNA-binding protein 42 using RT-PCR method.
  • Total RNA from fetal brain cells was used as a template, and oligo-dT was used as a primer for reverse transcription reaction to synthesize cDNA.
  • Primerl 5'- GGGAGATAATTACGGAGAAGTCAT -3 '(SEQ ID NO: 3)
  • Primer2 5'- CATAGGCCGAGGCGGCCGACATGT -3 '(SEQ ID NO: 4)
  • Pr imerl is a forward sequence located at the 5th end of SEQ ID NO: 1, starting at lbp;
  • Pr imer2 is the 3, terminal reverse sequence of SEQ ID NO: 1.
  • Conditions for the amplification reaction 50 ⁇ mol / LI Cl, 10 ⁇ l / L Tri s-HCl pH 8.5 in a 50 ⁇ 1 reaction volume with ol / L MgCl 2 , 20 ( ⁇ mol / L dNTP , l Opmol primer, 1U of Taq DNA polymerase (Clontech).
  • the reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) for 25 cycles under the following conditions: 94. C 30sec; 55 ° C 30sec; 72 C 2min. Set ⁇ -act in as a positive control and template blank as a negative control at the same time during RT-PCR.
  • Amplification products were purified using a QIAGEN kit and ligated to a pCR vector using a TA cloning kit (Invi trogen). Product).
  • the DNA sequence analysis results show that the DNA sequence of the PCR product is exactly the same as the 1 to 1873 bp shown in SEQ ID NO: 1.
  • Example 4 Northern blot analysis of human Kruppel-associated DNA binding protein 42 gene expression was extracted in one step Total RNA [Anal. Biochem 1987, 162, 156-159]. This method involves acid guanidinium thiocyanate phenol-chloroform extraction. That is, 4M guanidinium isothiocyanate _ 2 5fflM sodium citrate, 0.2M sodium acetate ( .
  • RNA precipitate wash the obtained RNA precipitate with 70% ethanol, dry and dissolve in water.
  • electrophoresis on a 1.2% agarose gel containing 20 mM 3- (N-morpholino) propanesulfonic acid (pH 7.0)-5 mM sodium acetate-ImM EDTA-2. 2M formaldehyde then transferred to nitrocellulose by a -..
  • 32 P dATP Preparation 32 ⁇ - DNA probe labeled by the random primer DNA probes Method used is shown in Figure 1 PCR amplified human Kruppel associated DNA Binding protein 42 Coding region sequence (330bp to 1475bp).
  • a 32P-labeled probe (approximately 2 x 10 6 cpm / ral) was hybridized with a nitrocellulose membrane to which R was transferred at 42 ° C overnight in a solution containing 50% formamide-25mM KH 2 P0 4 (pH7. 4)-5 x SSC-5 x Denhardt's solution and 20 ( ⁇ g / ml salmon sperm DNA. After hybridization, the filter was washed in 1 X SSC-0.
  • Example 5 In vitro expression, isolation and purification of recombinant human Kruppel-associated DNA-binding protein 42 Based on the sequence of the coding region shown in SEQ ID NO: 1 and Figure 1, a pair of specificity was designed Amplification primer, the sequence is as follows:
  • Pr imer3 5'- CCCCATATGATGAACGGAAAAAGAAACGGGGAA -3, (Seq ID No: 5)
  • Pr imer4 5'- CCCGAGCTCTCAAATTTCTGCCCATGAGGCTGT -3 '(Seq ID No: 6)
  • Ndel and Sacl digestion sites respectively Points, followed by the coding sequences of the 5 'and 3' ends of the gene of interest, respectively.
  • the Ndel and Sacl restriction sites correspond to the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865. 3) Selective endonuclease site.
  • PCR was performed using the pBS-1236a06 plasmid containing the full-length target gene as a template.
  • the PCR reaction conditions are: pBS-1236a06 plasmid 10pg, archimer Primer-3 and Primer-4 points in a total volume of 50 ⁇ 1; j is Opraol, Advantage polymerase Mix
  • Cycle parameters 94. C 20s, 60 ° C 30s, 68. C 2 min, a total of 25 cycles.
  • Ndel and Sacl were used to double-digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase.
  • the ligation product was transformed into Ca. bacillus DH5 ct by the calcium chloride method.
  • a peptide synthesizer (product of PE company) was used to synthesize the following human Kruppel-specific DNA-binding protein 42-specific peptides: 0661
  • Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
  • the probes can be used to hybridize to the genome or cD library of normal tissues or pathological tissues from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
  • the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
  • the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method.
  • Filter hybridization methods include dot blotting, Southern imprinting, Northern blotting, and copying methods. They all use the same steps to immobilize the polynucleotide sample to be tested on the filter.
  • the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer to saturate the non-specific binding site of the sample on the filter with the carrier and the synthesized polymer.
  • the pre-hybridization solution is then replaced with a hybridization buffer containing labeled probes and incubated to hybridize the probes to the target nucleic acid.
  • the unhybridized probes are removed by a series of membrane washing steps.
  • This embodiment uses higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals.
  • the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
  • the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
  • the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
  • oligonucleotide fragment selected from the polynucleotide SEQ ID NO: 1 of the present invention for use as a hybridization probe shall be Following the following principles and several aspects to consider:
  • the preferred range of probe size is 18-50 nucleotides
  • Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements For homology comparison of the regions, if the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, the primary probe should not be used generally;
  • Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
  • Probe 2 which belongs to the second type of probe, is equivalent to the replacement mutant sequence of the gene fragment of SEQ ID NO: 1 or its complementary fragment (41Nt):
  • PBS phosphate buffered saline
  • step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
  • NC membrane nitrocellulose membrane
  • the sample membrane was placed in a plastic bag, and 3-10 mg of prehybridization solution (10xDenhardt's; 6xSSC, 0.1 mg / ml CT DM (calf thymus DNA)) was added. After sealing the mouth of the bag, shake at 68 ° C for 2 hours.
  • prehybridization solution 10xDenhardt's; 6xSSC, 0.1 mg / ml CT DM (calf thymus DNA)

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • General Chemical & Material Sciences (AREA)
  • Biochemistry (AREA)
  • Genetics & Genomics (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Molecular Biology (AREA)
  • Zoology (AREA)
  • Toxicology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Biophysics (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

L'invention concerne un nouveau polypeptide, une protéine humaine 42 de liaison à l'ADN associée à Kruppel, et un polynucléotide codant pour ce polypeptide ainsi qu'un procédé d'obtention de ce polypeptide par des techniques recombinantes d'ADN. L'invention concerne en outre les applications de ce polypeptide dans le traitement de maladies, notamment de toutes sortes de tumeurs, des troubles du système nerveux, des troubles du développement, de l'hémopathie maligne, de certaines maladies héréditaires, des maladies liées au système endocrinien et des maladies liées au système immunitaire. L'invention concerne aussi l'antagoniste agissant contre le polypeptide et son action thérapeutique ainsi que les applications de ce polynucléotide codant pour la protéine humaine 42 de liaison à l'ADN associée à Kruppel.
PCT/CN2001/000661 2000-04-29 2001-04-28 Nouveau polypeptide, proteine humaine 42 de liaison a l'adn associee a kruppel, et polynucleotide codant pour ce polypeptide WO2001083541A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU70440/01A AU7044001A (en) 2000-04-29 2001-04-28 A novel polypeptide-human kruppel associated dna binding protein 42 and the polynucleotide encoding said polypeptide

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN00115515A CN1321653A (zh) 2000-04-29 2000-04-29 一种新的多肽——人Kruppel相关的DNA结合蛋白10和编码这种多肽的多核苷酸
CN00115515.6 2000-04-29

Publications (1)

Publication Number Publication Date
WO2001083541A1 true WO2001083541A1 (fr) 2001-11-08

Family

ID=4584961

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2001/000661 WO2001083541A1 (fr) 2000-04-29 2001-04-28 Nouveau polypeptide, proteine humaine 42 de liaison a l'adn associee a kruppel, et polynucleotide codant pour ce polypeptide

Country Status (3)

Country Link
CN (1) CN1321653A (fr)
AU (1) AU7044001A (fr)
WO (1) WO2001083541A1 (fr)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5928941A (en) * 1996-10-07 1999-07-27 President And Fellows Of Harvard College Repressor kruppel-like factor
WO2000000513A1 (fr) * 1998-06-29 2000-01-06 Shanghai Second Medical University Gene humain krab-np (npaawe05)

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5928941A (en) * 1996-10-07 1999-07-27 President And Fellows Of Harvard College Repressor kruppel-like factor
WO2000000513A1 (fr) * 1998-06-29 2000-01-06 Shanghai Second Medical University Gene humain krab-np (npaawe05)

Also Published As

Publication number Publication date
AU7044001A (en) 2001-11-12
CN1321653A (zh) 2001-11-14

Similar Documents

Publication Publication Date Title
WO2002026972A1 (fr) Nouveau polypeptide, proteine humaine 20.13 de liaison de l'acide polyadenylique, et polynucleotide codant ce polypeptide
WO2001072812A1 (fr) Nouveau polypeptide, bromodomaine humain 10, et polynucleotide codant pour ce polypeptide
WO2001083780A1 (fr) Nouveau polypeptide, methylthioadenosine phosphorylase humaine 37, et polynucleotide codant pour ce polypeptide
WO2001083541A1 (fr) Nouveau polypeptide, proteine humaine 42 de liaison a l'adn associee a kruppel, et polynucleotide codant pour ce polypeptide
WO2001046410A1 (fr) Nouveau polypeptide, proteine 13 du sous-groupe moleculaire cpn60, et polynucleotide codant pour ce polypeptide
WO2002026809A1 (fr) Nouveau polypeptide, proteine transmembranaire 35.31 possedant un domaine permettant la duplication de facteurs de croissance epidermique, et polynucleotide codant ce polypeptide
WO2001046437A1 (fr) Nouveau polypeptide, region de liaison d'arn-eucaryote rnp-1-21, et polynucleotide codant pour ce polypeptide
WO2001094530A2 (fr) Nouveau polypeptide, proteine 57 de la sous-famille des proteines a doigt de zinc scan, et polynucleotide codant ce polypeptide
WO2001046409A1 (fr) Nouveau polypeptide, proteine ribosomale s7 9, et polynucleotide codant pour ce polypeptide
WO2001048004A1 (fr) Nouveau polypeptide, proteine de liaison de l'heparine 10, et polynucleotide codant pour ce polypeptide
WO2001047975A1 (fr) Nouveau polypeptide, proteine 10 contenant un domaine chromo, et polynucleotide codant pour ce polypeptide
WO2001049724A1 (fr) Nouveau polypeptide, proteine lissencephale humaine 43, et polynucleotide codant pour ce polypeptide
WO2001087960A1 (fr) Nouveau polypeptide, proteine humaine 10 de liaison a l'adn associee a kruppel, et polynucleotide codant pour ce polypeptide
WO2001048195A1 (fr) Nouveau polypeptide, proteine rcc1 10, et polynucleotide codant pour ce polypeptide
WO2001072796A1 (fr) Nouveau polypeptide, facteur humain de transcription de la differentiation cellulaire 11, et polynucleotide codant pour ce polypeptide
WO2001081594A1 (fr) Nouveau polypeptide, proteine pax humaine 17, et polynucleotide codant pour ce polypeptide
WO2001055417A1 (fr) Nouveau polypeptide, proteine a f-box 65, et polynucleotide codant pour ce polypeptide
WO2001079429A2 (fr) Nouveau polypeptide, facteur humain d'echange guanine nucleotide 10, et polynucleotide codant pour ce polypeptide
WO2001047985A1 (fr) Nouveau polypeptide, proteine kinase c-13, et polynucleotide codant pour ce polypeptide
WO2002033077A1 (fr) Nouveau polypeptide, une proteine de regulation 10.01 etant associee au developpement humain et polynucleotide la codant
WO2001048000A1 (fr) Nouveau polypeptide, fibronectine 10 de type ii, et polynucleotide codant pour ce polypeptide
WO2001083684A2 (fr) Nouveau polypeptide, proteine humaine krab kraz2-12 a doigt de zinc, et polynucleotide codant pour ce polypeptide
WO2001073011A1 (fr) Nouveau polypeptide, proteine humaine a doigt de zinc 38, et polynucleotide codant pour ce polypeptide
WO2001046242A1 (fr) NOUVEAU POLYPEPTIDE, GENE σ-54 9, ET POLYNUCLEOTIDE CODANT POUR CE POLYPEPTIDE
WO2001074866A1 (fr) Nouveau polypeptide, protéine humaine a doigt de zinc 72, et polynucléotide codant pour ce polypeptide

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP