WO2001094530A2 - Nouveau polypeptide, proteine 57 de la sous-famille des proteines a doigt de zinc scan, et polynucleotide codant ce polypeptide - Google Patents

Nouveau polypeptide, proteine 57 de la sous-famille des proteines a doigt de zinc scan, et polynucleotide codant ce polypeptide Download PDF

Info

Publication number
WO2001094530A2
WO2001094530A2 PCT/CN2001/000774 CN0100774W WO0194530A2 WO 2001094530 A2 WO2001094530 A2 WO 2001094530A2 CN 0100774 W CN0100774 W CN 0100774W WO 0194530 A2 WO0194530 A2 WO 0194530A2
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
protein
zinc finger
polynucleotide
scan
Prior art date
Application number
PCT/CN2001/000774
Other languages
English (en)
Chinese (zh)
Other versions
WO2001094530A3 (fr
Inventor
Yumin Mao
Yi Xie
Original Assignee
Shanghai Biowindow Gene Development Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shanghai Biowindow Gene Development Inc. filed Critical Shanghai Biowindow Gene Development Inc.
Priority to AU87506/01A priority Critical patent/AU8750601A/en
Publication of WO2001094530A2 publication Critical patent/WO2001094530A2/fr
Publication of WO2001094530A3 publication Critical patent/WO2001094530A3/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • the present invention belongs to the field of biotechnology. Specifically, the present invention describes a novel polypeptide, the SCAN subfamily protein 57, and a polynucleotide sequence encoding the polypeptide. The invention also relates to methods and applications for preparing such polynucleotides and polypeptides.
  • Zinc finger protein is a member of the multi-gene family encoding zinc ion-mediated nucleotide binding proteins in the body. It has very important physiological functions in the body and is involved in regulating the transcription and expression of various genes in the body.
  • Zinc finger proteins of various configurations have been isolated from a variety of organisms such as yeast, fruit fly, rat and human. Among them, zinc finger proteins with C2H2 configuration constitute the most widely distributed gene in the human genome.
  • the members of the C2H2 zinc finger protein family can be divided into different protein families according to their protein structures.
  • the C2H2 zinc finger protein ruppe l family is one of them.
  • All members of the zinc finger protein Kruppel family have a conserved finger repeat (F / Y) XCXXCXXXFXXXXXLXXHXXXHTGEKP in the amino acid sequence of 28-30 amino acids, some of which have highly conserved amino acid residues. This sequence contains multiple copies in many different zinc finger proteins, with different copy numbers (different number of zinc fingers) and different functions. Studies have found that the zinc finger domain interlinking region of many zinc finger proteins Kruppel family members is also highly conserved.
  • This region usually contains the following sequences: Hi s- Thr- Gly-Gly- Lys- Pro- (Tyr, Phe)- X-Cys, where histidine and cysteine are metal ion binding sites, and X is a variable amino acid residue.
  • This region is necessary for the formation of zinc finger structures.
  • the number of finger structures will directly affect the binding of zinc finger proteins to DMs of different lengths, and the multi-finger structure is related to the binding stability of the complex [Jeremy M. Berg, Annu. Rev. Biophys. Chem, 1990, 19: 405-421].
  • the human gene of the present invention has 41% identity and 57% similarity with the known human zinc finger protein ZFP192 at the protein level, and is similar to ZFP192.
  • the C-terminus of the protein sequence also contains the zinc finger protein SCAN subfamily. Characteristic domains—SCA domains and C2H2-type zinc finger protein Kruppel family characteristic domains—C2H2-type zinc finger domains.
  • the new gene of the present invention is considered to be a new member of the human zinc finger protein SCAN subfamily and named as the zinc finger protein SCAN subfamily protein 57. And it is inferred that it is similar to ZFP192, is a member of the Kruppel zinc finger protein SCAN subfamily, and has similar biological functions.
  • the protein is expressed in various tissues of the organism, and the expression level is high in cells of the reproductive system. Mutations or abnormal expression of this protein are usually associated with some disorders of the reproductive system and early embryonic development in the organism, and tumors in related tissues. And cancer and other diseases are closely related. It can also be used to diagnose and treat various diseases mentioned above.
  • the zinc finger protein SCAN subfamily protein 57 protein regulates cell division and embryonic development. Play an important role in important functions of the body such as education, and it is believed that a large number of proteins are involved in these regulatory processes, so the art has always needed to identify more zinc finger proteins SCAN subfamily protein 57 proteins involved in these processes, especially to identify this protein Amino acid sequence. Isolation of the new zinc finger protein SCAN subfamily protein 57 protein encoding gene also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so isolating its coding DNA is very important. Object of the invention
  • Another object of the invention is to provide a polynucleotide encoding the polypeptide.
  • Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding a zinc finger protein SCAN subfamily protein 57.
  • Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding a zinc finger protein SCAN subfamily protein 57.
  • Another object of the present invention is to provide mimic compounds, antagonists, agonists, and inhibitors of the polypeptide-zinc finger protein SCAN subfamily protein 57 of the present invention.
  • Another object of the present invention is to provide a method for diagnosing and treating diseases related to abnormalities of zinc finger protein SCAN subfamily protein 57. Summary of invention
  • the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
  • the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
  • polynucleotide sequences of (c) and (a) or (b) have at least 70 »/.
  • the sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 131-1687 in SEQ ID NO: 1; and (b) a sequence having 1-3752 in SEQ ID NO: 1 Sequence of bits.
  • the present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
  • the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
  • the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of the zinc finger protein SCAN subfamily protein 57 protein, which comprises utilizing the polypeptide of the invention.
  • the invention also relates to compounds obtained by this method.
  • the present invention also relates to a method for in vitro detection of a disease or disease susceptibility associated with abnormal expression of the zinc finger protein SCAN subfamily protein 57 protein, which comprises detecting mutations in the polypeptide or a polynucleotide sequence encoding the same in a biological sample, or Detection of the amount or biological activity of a polypeptide of the invention in a biological sample.
  • the invention also relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
  • the present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention for the preparation of a medicament for treating cancer, developmental disease or immune disease or other diseases caused by abnormal expression of zinc finger protein SCAN subfamily protein 57.
  • Fig. 1 is a comparison diagram of amino acid sequence homology of zinc finger protein SCAN subfamily protein 57 and zinc finger protein SCAN subfamily protein of the present invention.
  • the upper sequence is the zinc finger protein SCAN subfamily protein 57 and the lower sequence is the zinc finger protein SCAN subfamily protein.
  • Identical amino acids are represented by single-character amino acids between the two sequences, and similar amino acids are represented by "+”.
  • Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of the isolated zinc finger protein SCAN subfamily protein 57.
  • 57kDa is the molecular weight of the protein.
  • the arrow indicates the isolated protein band.
  • Nucleic acid sequence refers to oligonucleotides, nucleotides or polynucleotides and fragments or parts thereof, and can also refer to genomic or synthetic DNA or RNA, which can be single-stranded or double-stranded, representing the sense strand or Antisense strand.
  • amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
  • amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
  • a “variant" of a protein or polynucleotide refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it.
  • the changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence.
  • Variants can have "conservative" changes, in which the amino acid substituted has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine.
  • Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
  • “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
  • Insertion means that a change in the amino acid sequence or nucleotide sequence results in an increase in one or more amino acids or nucleotides compared to a molecule that exists in nature.
  • Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
  • Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
  • immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response and to bind specific antibodies in a suitable animal or cell.
  • An "agonist” refers to a molecule that, when combined with the zinc finger protein SCAN subfamily protein 57, can cause changes in the protein and thereby regulate the activity of the protein.
  • An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that binds the zinc finger protein SCAN subfamily protein 57.
  • Antagonist refers to a molecule that can block or regulate the biological or immunological activity of zinc finger protein SCAN subfamily protein 57 when combined with zinc finger protein SCAN subfamily protein 57.
  • Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates, or any other molecule that can bind zinc finger protein SCAN subfamily protein 57.
  • Regular refers to a change in the function of the zinc finger protein SCAN subfamily protein 57, including an increase or decrease in protein activity, a change in binding characteristics, and any other biological properties, functions, or immunity of the zinc finger protein SCAN subfamily protein 57. Change of nature.
  • Substantially pure 1 'means substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated.
  • Those skilled in the art can purify the zinc finger protein SCAN subfamily protein 57 using standard protein purification techniques.
  • Substantially pure zinc finger protein SCAN subfamily protein 57 produces on non-reducing polyacrylamide gels Create a single main band.
  • the purity of the zinc finger protein SCAN subfamily protein 57 polypeptide can be analyzed by amino acid sequence.
  • Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
  • sequence C-T-G-A
  • complementary sequence G-A-C-T.
  • the complementarity between two single-stranded molecules may be partial or complete.
  • the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
  • “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
  • Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Southern imprinting or Northern blotting, etc.) under conditions of reduced stringency. Substantially homologous sequences or hybridization probes can compete and inhibit the binding of fully homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.
  • Percent identity refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALIGN program (Lasergene sof tware package, DNASTAR, Inc., Madi son Wis.). The MEGALIGN program can compare two or more sequences according to different methods, such as the Clus ter method (Higgins, DG and PM Sharp (1988) Gene 73: 237-244). 0 The Clus ter method groups each group by checking the distance between all pairs. The sequences are arranged in clusters. The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula:
  • the assay may be Jotun Hein percent identity between nucleic acid sequences Clus ter or a method well known in the art (Hein J., (1990) Methods in enzymology 183: 625-645) 0
  • Similarity refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
  • Amino acids used for conservative substitution such as ⁇ negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group has Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
  • Antisense refers to a nucleotide sequence that is complementary to a particular DM or MA sequence.
  • Antisense strand refers to a nucleic acid strand that is complementary to a “sense strand.”
  • Derivative refers to HFP or a chemical modification of its nucleic acid. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives encode major organisms that retain natural molecules Peptides with chemical properties.
  • Antibody refers to a complete antibody molecule and its fragments, such as Fa,? ( ⁇ ') 2 and? , It can specifically bind to the epitope of zinc finger protein SCAN subfamily protein 57.
  • a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
  • isolated refers to the removal of a substance from its original environment (for example, its natural environment if it is naturally occurring).
  • a naturally-occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
  • Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not part of its natural environment, they are still isolated.
  • isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
  • polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances in the natural state .
  • isolated zinc finger protein SCAN subfamily protein 57 refers to the zinc finger protein SCAN subfamily protein 57 that is substantially free of other proteins, lipids, carbohydrates, or other substances with which it is naturally associated. Those skilled in the art can purify the zinc finger protein SCAN subfamily protein 57 using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of the zinc finger protein SCAN subfamily protein 57 peptide can be analyzed by amino acid sequence.
  • the present invention provides a new polypeptide ⁇ finger protein SCAN subfamily protein 57 which is basically composed of the amino acid sequence shown in SEQ ID NO: 2.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
  • the polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques. Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude initial methionine residues.
  • the invention also includes fragments, derivatives and analogs of the zinc finger protein SCAN subfamily protein 57.
  • fragment refers to a polypeptide that substantially maintains the same biological function or activity of the zinc finger protein SCAN subfamily protein 57 of the invention.
  • a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution of The amino acid may or may not be encoded by the genetic code; or (II) such a type in which a group on one or more amino acid residues is replaced by another group to include a substituent; or ( ⁇ ⁇ ) such A type in which a mature polypeptide is fused to another compound (such as a compound that extends the half-life of a polypeptide, such as polyethylene glycol); or (IV) a type of polypeptide sequence in which an additional amino acid sequence is fused into a mature polypeptide ( Such as leader sequences or secreted sequences or sequences used to purify this polypeptide or protease sequences).
  • such fragments, derivatives and analogs are considered to be within the knowledge of those skilled in the art.
  • the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
  • the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a polynucleotide sequence of 3752 bases in length and its open reading frame 131-1687 encodes 518 amino acids. Based on the amino acid sequence homology comparison, it was found that this polypeptide has 41% homology with the zinc finger protein SCAN subfamily protein. It can be inferred that the zinc finger protein SCAN subfamily protein 57 has a similar structure and structure as the zinc finger protein SCAN subfamily protein.
  • the polynucleotide of the present invention may be in the form of DNA or RNA.
  • DM forms include cDNA, genomic DNA, or synthetic DNA.
  • DNA can be single-stranded or double-stranded.
  • DNA can be coding or non-coding.
  • the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
  • a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
  • the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
  • polynucleotide encoding a polypeptide refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.
  • the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
  • Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
  • an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
  • the present invention also relates to a polynucleotide that hybridizes to a sequence described above 50% less, preferably 70% identity).
  • the invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the invention under stringent conditions.
  • “strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60 ° C; or (2) Add a denaturant during hybridization, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% Ficol 1, 42 ° C, etc .; or (3) only between the two sequences Hybridization occurs only when the identity is at least 953 ⁇ 4 and more preferably 97%.
  • the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
  • nucleic acid fragments that hybridize to the sequences described above.
  • a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 cores. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques, such as PCR, to identify and / or isolate polynucleotides encoding the zinc finger protein SCAN subfamily protein 57.
  • polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
  • the specific polynucleotide sequence encoding the zinc finger protein SCAN subfamily protein 57 of the present invention can be obtained by various methods.
  • polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
  • the DM fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DM of the polypeptide.
  • genomic DNA isolation is the least commonly used. Direct chemical synthesis of DM sequences is often the method of choice.
  • the more commonly used method is the isolation of cDNA sequences.
  • the standard method for isolating the cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library.
  • mRNA extraction There are many mature techniques for mRNA extraction, and kits are also commercially available (Qiagene;).
  • the construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manua, Cold Spruing Harbor Laboratory. New York, 1989).
  • Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
  • these genes can be screened from these cDNA libraries by conventional methods. These methods include (but are not limited to): (D DNA-DNA or DNA-RNA hybridization; (2) the presence or absence of marker gene functions; (3) determination of the level of the transcript of zinc finger protein SCAN subfamily protein 57; ( 4) Detecting the protein product of gene expression through immunological techniques or measuring biological activity.
  • the above methods can be used alone or in combination.
  • the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
  • the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
  • the probe used here is generally a DM sequence chemically synthesized based on the gene sequence information of the present invention.
  • the genes or fragments of the present invention can of course be used as probes.
  • the D probe can be labeled with a radioisotope, luciferin, or an enzyme (such as alkaline phosphatase).
  • immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) can be used to detect the protein products expressed by the zinc finger protein SCAN subfamily protein 57 gene expression.
  • ELISA enzyme-linked immunosorbent assay
  • a method (Sa iki, et al. Science 1985; 230: 1350-1354) using PCR technology to amplify DNA / RNA is preferably used to obtain the gene of the present invention.
  • the RACE method RACE-rapid amplification of cDNA ends
  • the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Select and synthesize using conventional methods.
  • the amplified DNA / RM fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
  • polynucleotide sequence of the gene of the present invention or various DM fragments and the like obtained as described above can be measured by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, sequencing needs to be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
  • the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using the zinc finger protein SCAN subfamily protein 57 coding sequence, and recombinant technology to produce the present invention. Polypeptide method.
  • a polynucleotide sequence encoding the zinc finger protein SCAN subfamily protein 57 can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
  • vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
  • Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al.
  • any plasmid and vector can be used to construct a recombinant expression vector.
  • An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements. Methods known to those skilled in the art can be used to construct an expression vector containing a DNA sequence encoding the zinc finger protein SCAN subfamily protein 57 and appropriate transcription / translation regulatory elements.
  • the MA sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis.
  • promoters are: the lac or trp promoter of E.
  • the expression vector also includes a ribosome binding site and a transcription terminator for translation initiation. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors expressed by DM, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers on the late side of the origin of replication, and adenoviral enhancers.
  • the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • GFP fluorescent protein
  • tetracycline or ampicillin resistance for E. coli.
  • a polynucleotide encoding a zinc finger protein SCAN subfamily protein 57 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to form a genetically engineered host cell containing the polynucleotide or the recombinant vector.
  • host cell refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E.
  • coli Streptomyces
  • bacterial cells such as Salmonella typhimurium
  • fungal cells such as yeast
  • plant cells such as fly S 2 or Sf9
  • animal cells such as CH0, COS or Bowes melanoma cells.
  • Transformation of a host cell with a DNA sequence according to the present invention or a recombinant vector containing the DM sequence can be performed using conventional techniques well known to those skilled in the art.
  • the host is a prokaryote, such as E. coli
  • competent cells capable of absorbing DNA can be harvested after the exponential growth phase and treated with the CaCl 2 method. The steps used are well known in the art. Alternatively, MgCl 2 is used. If necessary, transformation can also be performed by electroporation.
  • the host is a eukaryotic organism, the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
  • the polynucleotide sequence of the present invention can be used for expression or production Recombinant zinc finger protein SCAN subfamily protein 57 (Science, 1984; 224: 1431). Generally there are the following steps:
  • the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
  • a suitable method such as temperature conversion or chemical induction
  • the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If necessary, the recombinant protein can be isolated and purified by various separation methods using its physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC), and various other liquid chromatography techniques and combinations of these methods.
  • conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid
  • polypeptides of the present invention as well as antagonists, agonists and inhibitors of the polypeptides, can be directly used in the treatment of diseases, for example, they can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection, and immune diseases.
  • Zinc-binding protein is usually used as a transcription factor and signal transduction molecule to participate in gene expression and regulation. It is expressed in various tissues, such as hematopoietic cells, brain, nervous system, various tumor-related tissues, and immortalized cells. Department organization.
  • the C2H2-type zinc finger domain-containing protein not only plays an important role in regulating gene expression in some tissues, but also plays a key role in developmental regulation.
  • the Kruppel-type zinc finger proteins containing the KRAB domain have become a subfamily.
  • the KRAB scab domain is related to the correct localization and function of the protein.
  • C2H2 type zinc finger domains are related to the following diseases: solid tumors such as thyroid adenoma, uterine fibroids, neurological diseases such as extrapyramidal dysfunction, Parkinson's syndrome, ataxia, nerve cells Tumors, glioblastomas, hematological malignancies such as leukemia, non-Hodgkin's lymphoma, developmental disorders such as Williams syndrome, cleft-hand and cleft foot syndrome, Bayer's syndrome, other tumors such as neuroblasts Cell tumor, colon cancer, breast cancer, etc.
  • solid tumors such as thyroid adenoma, uterine fibroids
  • neurological diseases such as extrapyramidal dysfunction, Parkinson's syndrome, ataxia
  • nerve cells Tumors such as leukemia, non-Hodgkin's lymphoma
  • developmental disorders such as Williams syndrome, cleft-hand and cleft foot syndrome, Bayer's syndrome
  • other tumors such as neuroblasts Cell tumor, colon cancer, breast cancer, etc.
  • the polypeptide of the present invention and the known human zinc finger protein ZFP192 are proteins of the zinc finger protein SCAN subfamily, both of which are members of the human Kruppel zinc finger protein SCAN subfamily, and have similar physiological functions. Studies have found that human zinc finger protein ZFP192 is highly expressed in cells of the reproductive system.
  • the new zinc finger protein SCAN subfamily protein 57 of the present invention is similar to it and participates in transcriptional regulation in vivo, which is of great significance for development and growth, cell division and proliferation, and its abnormal expression will cause related diseases.
  • abnormal expression of the zinc finger protein SCAN subfamily protein 57 of the present invention will produce various diseases, especially various tumors, neurological diseases, hematological malignant diseases, and developmental disorders. These diseases include, but are not limited to:
  • Tumors of various tissues thyroid tumors, uterine fibroids, neuroblastomas, ependymomas, colon cancer, breast cancer, leukemia, lymphoma, malignant histiocytosis, melanoma, sarcoma, gastric cancer, liver cancer, lung cancer, Esophageal cancer, myeloma, teratoma, adrenal cancer, bladder cancer, bone cancer, osteosarcoma, brain cancer, uterine cancer, gallbladder cancer, liver cancer, thymic tumor, uterine fibroids, astrocytoma, ependymoma, Glioblastoma, Neurofibromatosis, Myeloma, Myeloma, Endometrial Cancer, Gallbladder Cancer, Nasal and Sinus Tumors, Nasopharyngeal Cancer, Laryngeal Cancer, Tracheal Tumors, Fibroma, Fibrosarcoma, Lipoma, Liposarcoma, Leio
  • Neurological diseases Parkinson's syndrome, ataxia, neurocytoma, glioblastoma, dementia, depression, amnesia, Huntington's disease, epilepsy, migraine, dementia, multiple sclerosis, Myasthenia gravis, muscular hypertrophy, tonic muscular dystrophy, dystonia, schizophrenia, depression, paranoia, anxiety, obsessive-compulsive disorder, phobia, neurasthenia
  • Hematological malignancies Leukemia, non-Hodgkin's lymphoma
  • Abnormal expression of the zinc finger protein SCAN subfamily protein 57 of the present invention will also produce certain genetic diseases, endocrine system diseases such as endocrine adenoma, and immune system diseases.
  • the polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat various diseases, especially various tumors, nervous system diseases, hematological malignant diseases, development disorders, etc. Some genetic diseases, endocrine system diseases such as endocrine adenoma, immune system diseases, etc.
  • the invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) the zinc finger protein SCAN subfamily protein 57.
  • Agonist raises zinc finger protein SCAN subfamily protein 57 Stimulates biological functions such as cell proliferation, and antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
  • a mammalian cell or a membrane preparation expressing the zinc finger protein SCAN subfamily protein 57 can be cultured with the labeled zinc finger protein SCAN subfamily protein 57 in the presence of a drug. The ability of the drug to increase or block this interaction is then determined.
  • Antagonists of zinc finger protein SCAN subfamily protein 57 include antibodies, compounds, receptor deletions, and the like that have been screened. Antagonists of zinc finger protein SCAN subfamily protein 57 can bind to zinc finger protein SCAN subfamily protein 57 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot function biological functions.
  • zinc finger protein SCAN subfamily protein 57 can be added to the bioanalytical assay, and the compound can be determined by measuring the effect of the compound on the interaction between zinc finger protein SCAN subfamily protein 57 and its receptor. Whether it is an antagonist. Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds.
  • Peptide molecules capable of binding to the zinc finger protein SCAN subfamily protein 57 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. When screening, the zinc finger protein SCAN subfamily protein 57 molecule should generally be labeled.
  • the present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies.
  • the invention also provides antibodies against the zinc finger protein SCAN subfamily protein 57 epitope. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by Fab expression libraries.
  • Polyclonal antibodies can be produced by direct injection of zinc finger protein SCAN subfamily protein 57 into immunized animals (such as rabbits, mice, rats, etc.).
  • immunized animals such as rabbits, mice, rats, etc.
  • adjuvants can be used to enhance the immune response, including but not limited to Freund's Adjuvant, etc.
  • Techniques for preparing monoclonal antibodies to zinc finger protein SCAN subfamily protein 57 include, but are not limited to, hybridoma technology (Kohler and Miste in. Nature, 1975, 256: 495-497), triple tumor technology, human beta cells Hybridoma technology, EBV-hybridoma technology, etc.
  • An inlay antibody combining a human constant region and a non-human variable region can be produced using existing technologies (Morrison et al., PNAS, 1985, 81: 6851).
  • the existing technology for producing single-chain antibodies ⁇ S. Pat No. 4946778, can also be used to produce single-chain antibodies against the zinc finger protein SCAN subfamily protein 57.
  • Antibodies against zinc finger protein SCAN subfamily protein 57 can be used in immunohistochemistry to detect zinc finger protein SCAN subfamily protein 57 in biopsy specimens.
  • Monoclonal antibodies that bind to zinc finger protein SCAN subfamily protein 57 can also be labeled with radioisotopes and injected into the body to track their location and distribution.
  • This radiolabeled antibody can be used as a non-traumatic sexual diagnosis is used to locate tumor cells and determine whether there is metastasis.
  • Antibodies can also be used to design immunotoxins that target a particular part of the body.
  • zinc finger protein SCAN subfamily protein 57 High affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
  • a common method is to attack the amino group of the antibody with a thiol crosslinker such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
  • This hybrid antibody can be used to kill the zinc finger protein SCAN subfamily protein 57 positive Cell.
  • the antibodies of the present invention can be used to treat or prevent diseases related to the zinc finger protein SCAN subfamily protein 57.
  • the proper dose of antibody can stimulate or block the production or activity of zinc finger protein SCAN subfamily protein 57.
  • the invention also relates to a diagnostic test method for quantitative and localized detection of zinc finger protein SCAN subfamily protein 57 levels. These tests are well known in the art and include FISH assays and radioimmunoassays. The level of zinc finger protein SCAN subfamily protein 57 detected in the test can be used to explain the importance of zinc finger protein SCAN subfamily protein 57 in various diseases and to diagnose the role of zinc finger protein SCAN subfamily protein 57. disease.
  • polypeptide of the present invention can also be used for peptide mapping analysis.
  • the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
  • the polynucleotide encoding the zinc finger protein SCAN subfamily protein 57 can also be used for a variety of therapeutic purposes.
  • Gene therapy technology can be used to treat abnormal cell proliferation, development or metabolism caused by the non-expression or abnormal / inactive expression of zinc finger protein SCAN subfamily protein 57.
  • Recombinant gene therapy vectors (such as viral vectors) can be designed to express variant zinc finger protein SCAN subfamily protein 57 to inhibit endogenous zinc finger protein SCAN subfamily protein 57 activity.
  • a variant zinc finger protein SCAN subfamily protein 57 may be a shortened zinc finger protein SCAN subfamily protein 57 lacking a signaling domain. Although it can bind to downstream substrates, it lacks signaling activity.
  • recombinant gene therapy vectors can be used to treat diseases caused by abnormal expression or activity of zinc finger protein SCAN subfamily protein 57.
  • Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, and parvovirus can be used to transfer the polynucleotide encoding the zinc finger protein SCAN subfamily protein 57 into cells.
  • a method for constructing a recombinant viral vector carrying a polynucleotide encoding a zinc finger protein SCAN subfamily protein 57 can be found in the existing literature (Sambrook, et al.).
  • a polynucleotide encoding the zinc finger protein SCAN subfamily protein 57 can be packaged into liposomes and transferred into cells.
  • Methods for introducing a polynucleotide into a tissue or cell include: injecting the polynucleotide directly into a tissue in vivo; or introducing the polynucleotide into a cell through a vector (such as a virus, phage, or plasmid) in vitro, The cells are then transplanted into the body and the like.
  • a vector such as a virus, phage, or plasmid
  • Oligonucleotides including antisense RM and DM
  • ribozymes that inhibit the zinc finger protein SCAN subfamily protein 57 are also within the scope of the present invention.
  • a ribozyme is an enzyme-like RNA molecule that specifically decomposes specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RM to perform endonucleation.
  • Antisense RM, DM, and ribozymes can be obtained by any existing RNA or DM synthesis technology, such as solid-phase phosphoramidite synthesis of oligonucleotides.
  • Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RM.
  • This DM sequence has been integrated downstream of the RNA polymerase promoter of the vector.
  • it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the linkage between ribonucleosides using phosphate thioester or peptide bonds instead of phosphodiester bonds.
  • the polynucleotide encoding the zinc finger protein SCAN subfamily protein 57 can be used to diagnose diseases related to the zinc finger protein SCAN subfamily protein 57.
  • Polynucleotides encoding the zinc finger protein SCAN subfamily protein 57 can be used to detect the expression of zinc finger protein SCAN subfamily protein 57 or abnormal expression of zinc finger protein SCAN subfamily protein 57 in disease states.
  • the DNA sequence encoding zinc finger protein SCAN subfamily protein 57 can be used to hybridize biopsy specimens to determine the expression of zinc finger protein SCAN subfamily protein 57.
  • Hybridization techniques include Southern blotting, Nor thern blotting, and in situ hybridization. These technical methods are all mature technologies that are publicly available, and related kits are commercially available.
  • a part or all of the polynucleotides of the present invention can be used as probes to be fixed on a microarray (Microarray) or a DM chip (also referred to as a "gene chip") for analyzing differential expression analysis and gene diagnosis of genes in tissues.
  • Zinc finger protein SCAN subfamily protein 57 specific primers can be used for RNA-polymerase chain reaction (RT-PCR) in vitro amplification to detect the transcription products of zinc finger protein SCAN subfamily protein 57.
  • Detection of mutations in the zinc finger protein SCAN subfamily protein 57 gene can also be used to diagnose zinc finger protein SCAN subfamily protein 57-related diseases.
  • the zinc finger protein SCAN subfamily protein 57 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild type zinc finger protein SCAN subfamily protein 57 DNA sequence. Mutations can be detected using existing techniques such as Southern blotting, DM sequence analysis, PCR and in situ hybridization. In addition, mutations may affect the expression of proteins. Therefore, Nor thern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
  • sequences of the invention are also valuable for chromosome identification. This sequence will specifically target a specific position on a human chromosome and can hybridize to it. Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for labeling chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DNA sequences on a chromosome. In short, PCR primers (preferably 15-35bp) are prepared according to CDM, and the sequences can be mapped on chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those hybrid cells that contain the human gene corresponding to the primer will produce amplified fragments.
  • PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
  • oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
  • Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.
  • Fluorescent in situ hybridization of cDM clones with metaphase chromosomes allows precise chromosomal localization in one step.
  • FISH Fluorescent in situ hybridization
  • the difference in cDM or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the CDM that is accurately mapped to a disease-related chromosomal region can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).
  • the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
  • suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
  • the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
  • the present invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the present invention.
  • these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which reminders authorize them to be administered to humans by government agencies that manufacture, use, or sell them.
  • the polypeptides of the invention can be used in combination with other therapeutic compounds.
  • the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
  • the zinc finger protein SCAN subfamily protein 57 is administered in an amount effective to treat and / or prevent a specific indication. The amount and range of zinc finger protein SCAN subfamily protein 57 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician. Examples
  • Total human fetal brain RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform. Separation Quik mRNA Isolat ion Ki t (Qiegene Co.) total RNA from poly (A) mRNA 0 2ug poly (A) mRNA by reverse transcription formed cDM. Smart cDNA cloning kit (purchased from Clontech) was used to insert the cDNA fragments into the multiple cloning site of pBSK (+) vector (Clontech) to transform DH5a. The bacteria formed a cDNA library.
  • Dye terminate cycle react ion sequencing kit Perkin-Elmer
  • ABI 377 automatic sequencer Perkin-Elmer
  • the determined cDNA sequence was compared with an existing public DM sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 0706al2 was a new DM.
  • a series of primers were synthesized to determine the inserted cDNA fragments of the clone in both directions.
  • the 0706al2 clone contains a full-length cDNA of 3752bp (as shown in Seq ID NO: l), and has an open reading frame (0RF) of 1557b P from 131bp to 1687bp, which encodes a new protein (such as Seq ID NO: 2).
  • This clone pBS-0706al2 was named zinc finger protein SCAN subfamily protein 57.
  • Example 2 Homologous search of cDNA clones
  • the sequence of the zinc finger protein SCAN subfamily protein 57 of the present invention and its encoded protein sequence were analyzed using the Blas t program (Basic local al ignment search tool) [Al tschul, SF et al. J. Mol. Biol. 1990; 215: 403-10], perform homology search in databases such as Genbank, Switzerland, and so on.
  • the gene with the highest homology to the zinc finger protein SCAN subfamily protein 57 of the present invention is a known zinc finger protein SCAN subfamily protein, and its encoded protein has the accession number U57796 in Genbank. Protein homology results In Figure 1, the two are highly homologous, with an identity of 41% and a similarity of 57%.
  • Example 3 The gene encoding zinc finger protein SCAN subfamily protein 57 was cloned by RT-PCR method. Fetal brain cells were used as a template, and ol-igo-dT was used as a primer to perform a reverse transcription reaction to synthesize cDNA. , Using the following primers for PCR amplification:
  • Primer 1 5
  • SEQ ID NO: 3 one TGAGCTTGGGAGAACCGTGGGCGC-3, (SEQ ID NO: 3)
  • Primer 2 5'- ACATACATTTCCGCTTTATTCAAA -3 '(SEQ ID NO: 4)
  • Pr itnerl is a forward sequence located at the 5th end of SEQ ID NO: 1, starting at lbp;
  • Primer 2 is the 3 'terminal reverse sequence of SEQ ID NO: 1.
  • Amplification reaction conditions reaction volume containing 50 ⁇ 1 of 50mmol / L KCl, 10mraol / L Tri s-HCl pH8 5, 1. 5raraol / L MgCl 2, 20 ( ⁇ mol / L dNTP, lOpmol primer. Taq DNA polymerase III (Clontech). The reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) for 25 cycles under the following conditions: 94 ° C 30sec; 55 ° C 30sec; 72 ° C 2min. During RT-PCR, ⁇ -act in was used as a positive control and template blank was used as a negative control.
  • the amplified product was purified using a QIAGEN kit and ligated to a pCR vector (product of Invitrogen) using a TA cloning kit. DNA sequence The analysis results showed that the DNA sequence of the PCR product was exactly the same as l-3752bp shown in SEQ ID NO: 1.
  • Example 4 Northern blot analysis of the expression of the zinc finger protein SCAN subfamily protein 57 gene expression Total RNA was extracted in one step [Anal. Biochem 1987 , 162, 156-159] 0 This method involves acid guanidinium thiocyanate phenol-chloroform extraction.
  • the tissue is homogenized with 4M guanidine isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0).
  • Slurry add 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1), After mixing, centrifuge. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RM precipitate. Wash the resulting RNA precipitate with 70% ethanol, dry and dissolve in water.
  • Use 20 ⁇ RNA Perform electrophoresis on a 1.2% agarose gel containing 20 mM 3- (N-morpholino) propanesulfonic acid (H7.
  • Example 5 In vitro expression, isolation and purification of recombinant zinc finger protein SCAN subfamily protein 57 Based on the sequence of the coding region shown in SEQ ID NO: 1 and FIG. 1, a pair of specific amplification primers were designed. The sequences are as follows:
  • Primer3 5'-CATGCTAGCATGGCTGTGGCCCTGGGTTGTGCA-3 '(Seq ID No: 5)
  • Primer4 5'-CCCGAGCTCTTAAATAAGTCCTCTAAAGTGAGT-3' (Seq ID No: 6)
  • the 5 'ends of these two primers contain Nhel and Sacl restriction sites, respectively.
  • the coding sequences for the 5 ,, and 3 'ends of the gene of interest, respectively, correspond to the Nhel and Sacl restriction sites on the expression vector plasmid P ET-28b (+) (Novagen, Cat. No. 69865. 3). Selective endonuclease site.
  • the pBS-0706al2 plasmid containing the full-length target gene was used as a template for the PCR reaction.
  • the PCR reaction conditions are: ppg_0706al2 plasmid 10pg, primer Primer-3 and Pr imer-4 points in a total volume of 50 ⁇ 1; j is lOpmol, Advantage polymerase Mix
  • Cycle parameters 94. C 20s, 60 ° C 30s, 68. C 2 min, a total of 25 cycles.
  • Nhel and Sacl were used to double-digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase.
  • the ligated product was transformed with colibacillus DH5a by the calcium chloride method.
  • the LB plate with a final concentration of 3 (Vg / ml) was cultured overnight, and the positive clones were screened by colony PCR and sequenced.
  • the positive clones with the correct sequence (pET-0706al2) were selected to transform the recombinant plasmid into E. coli using the calcium chloride method BL 2 l (DE3) plySs (product of Novagen).
  • the host strain BL21 pET-0706al2 was cultured at 37 ° C to In the logarithmic growth phase, add IPTG to a final concentration of 1 mmol / L, and continue the cultivation for 5 hours.
  • a peptide synthesizer (product of PE company) was used to synthesize the following zinc finger protein SCAN subfamily protein 57-specific peptides:
  • Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
  • the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
  • the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
  • the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by using a filter hybridization method.
  • Filter hybridization methods include dot blotting, Southern imprinting, Northern blotting, and copying methods. They all use the same steps to immobilize the polynucleotide sample to be tested on the filter.
  • the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer to saturate the non-specific binding site of the sample on the filter with the carrier and the synthesized polymer.
  • the pre-hybridization solution is then replaced with a hybridization buffer containing labeled probes and incubated to hybridize the probes to the target nucleic acid.
  • the unhybridized probes are removed by a series of membrane washing steps.
  • This embodiment uses higher-intensity washing conditions (such as lower salt concentration and higher temperature), so that the hybridization background is reduced and only strong specific signals are retained.
  • the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
  • the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
  • the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
  • oligonucleotide fragments from the polynucleotide SEQ ID NO: 1 of the present invention for use as hybridization probes should follow the following principles and several aspects to be considered:
  • the preferred range of probe size is 18-50 nucleotides
  • the primary selection probe is compared with its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complementary regions, respectively. If the homology with the non-target molecular region is greater than 85% or there is If more than 15 consecutive bases are identical, the primary probe should generally not be used;
  • Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
  • Probe 2 which belongs to the second type of probe, is equivalent to the replacement mutant sequence (41Nt) of the gene fragment or its complementary fragment of SEQ ID NO: 1:
  • PBS phosphate buffered saline
  • step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
  • NC membranes nitrocellulose membranes
  • Two NC membranes are required for each probe, so that they can be used in the following experimental steps.
  • the film was washed with high-strength conditions and strength conditions, respectively.
  • the 32 P-Probe (the second peak is free ⁇ - 32 P-dATP) is prepared.
  • the sample membrane was placed in a plastic bag, and 3-1 Omg pre-hybridization solution (1 OxDenhardt-s; 6xSSC, 0.1 mg / ml CT DNA (calf thymus DM)) was added. After sealing the mouth of the bag, shake at 68 ° C for 2 hours.
  • 3-1 Omg pre-hybridization solution (1 OxDenhardt-s; 6xSSC, 0.1 mg / ml CT DNA (calf thymus DM)

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Toxicology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

L'invention concerne un nouveau polypeptide, une protéine 57 de la sous-famille des protéines à doigt de zinc SCAN, et un polynucléotide codant ce polypeptide ainsi qu'un procédé d'obtention de ce polypeptide par des techniques recombinantes d'ADN. L'invention concerne en outre les applications de ce polypeptide dans le traitement de maladies, notamment de toutes sortes de tumeurs, de neuropathologies, de maladies graves liées à l'hémopathie, des troubles du développement et de l'infection par VIH. L'invention concerne aussi l'antagoniste agissant contre le polypeptide et son action thérapeutique ainsi que les applications de ce polynucléotide codant la protéine 57 de la sous-famille des protéines à doigt de zinc SCAN.
PCT/CN2001/000774 2000-05-16 2001-05-14 Nouveau polypeptide, proteine 57 de la sous-famille des proteines a doigt de zinc scan, et polynucleotide codant ce polypeptide WO2001094530A2 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU87506/01A AU8750601A (en) 2000-05-16 2001-05-14 A novel polypeptide, a scan zinc-finger protein subfamily protein 57 and the polynucleotide encoding the polypeptide

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN00115706.X 2000-05-16
CN 00115706 CN1323817A (zh) 2000-05-16 2000-05-16 一种新的多肽——锌指蛋白scan亚家族蛋白57和编码这种多肽的多核苷酸

Publications (2)

Publication Number Publication Date
WO2001094530A2 true WO2001094530A2 (fr) 2001-12-13
WO2001094530A3 WO2001094530A3 (fr) 2002-02-21

Family

ID=4585150

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2001/000774 WO2001094530A2 (fr) 2000-05-16 2001-05-14 Nouveau polypeptide, proteine 57 de la sous-famille des proteines a doigt de zinc scan, et polynucleotide codant ce polypeptide

Country Status (3)

Country Link
CN (1) CN1323817A (fr)
AU (1) AU8750601A (fr)
WO (1) WO2001094530A2 (fr)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2003089466A1 (fr) * 2002-04-19 2003-10-30 Riken Nouvelles proteines et adn codant de celles-ci

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5919912A (en) * 1995-08-04 1999-07-06 University Of Ottawa Mammalian IAP antibodies and diagnostic kits

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5919912A (en) * 1995-08-04 1999-07-06 University Of Ottawa Mammalian IAP antibodies and diagnostic kits

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2003089466A1 (fr) * 2002-04-19 2003-10-30 Riken Nouvelles proteines et adn codant de celles-ci

Also Published As

Publication number Publication date
AU8750601A (en) 2001-12-17
WO2001094530A3 (fr) 2002-02-21
CN1323817A (zh) 2001-11-28

Similar Documents

Publication Publication Date Title
WO2002026972A1 (fr) Nouveau polypeptide, proteine humaine 20.13 de liaison de l'acide polyadenylique, et polynucleotide codant ce polypeptide
WO2001094530A2 (fr) Nouveau polypeptide, proteine 57 de la sous-famille des proteines a doigt de zinc scan, et polynucleotide codant ce polypeptide
WO2002026809A1 (fr) Nouveau polypeptide, proteine transmembranaire 35.31 possedant un domaine permettant la duplication de facteurs de croissance epidermique, et polynucleotide codant ce polypeptide
WO2001046437A1 (fr) Nouveau polypeptide, region de liaison d'arn-eucaryote rnp-1-21, et polynucleotide codant pour ce polypeptide
WO2002026810A1 (fr) Nouveau polypeptide, substance proteique p125-77.22, et polynucleotide codant ce polypeptide
WO2002033077A1 (fr) Nouveau polypeptide, une proteine de regulation 10.01 etant associee au developpement humain et polynucleotide la codant
WO2001049724A1 (fr) Nouveau polypeptide, proteine lissencephale humaine 43, et polynucleotide codant pour ce polypeptide
WO2001049737A1 (fr) Nouveau polypeptide, latexine proteine humaine 46, et polynucleotide codant pour ce polypeptide
WO2001072796A1 (fr) Nouveau polypeptide, facteur humain de transcription de la differentiation cellulaire 11, et polynucleotide codant pour ce polypeptide
WO2001046409A1 (fr) Nouveau polypeptide, proteine ribosomale s7 9, et polynucleotide codant pour ce polypeptide
WO2001094395A1 (fr) Nouveau polypeptide, proteine humaine a doigt de zinc 38, et polynucleotide codant ce polypeptide
WO2001083684A2 (fr) Nouveau polypeptide, proteine humaine krab kraz2-12 a doigt de zinc, et polynucleotide codant pour ce polypeptide
WO2001087949A1 (fr) Nouveau polypeptide, proteine pax humaine 9, et polynucleotide codant pour ce polypeptide
WO2001066584A1 (fr) Nouveau polypeptide, proteine humaine pax 9, et polynucleotide codant pour ce polypeptide
WO2001079432A2 (fr) Nouveau polypeptide, facteur humain de transcription de la differentiation cellulaire 58, et polynucleotide codant pour ce polypeptide
WO2001074866A1 (fr) Nouveau polypeptide, protéine humaine a doigt de zinc 72, et polynucléotide codant pour ce polypeptide
WO2001087960A1 (fr) Nouveau polypeptide, proteine humaine 10 de liaison a l'adn associee a kruppel, et polynucleotide codant pour ce polypeptide
WO2001073011A1 (fr) Nouveau polypeptide, proteine humaine a doigt de zinc 38, et polynucleotide codant pour ce polypeptide
WO2001083541A1 (fr) Nouveau polypeptide, proteine humaine 42 de liaison a l'adn associee a kruppel, et polynucleotide codant pour ce polypeptide
WO2001070803A1 (fr) Nouveau polypeptide, proteine humaine de regulation de la transcription 9.7, et polynucleotide codant pour ce polypeptide
WO2001047975A1 (fr) Nouveau polypeptide, proteine 10 contenant un domaine chromo, et polynucleotide codant pour ce polypeptide
WO2001046242A1 (fr) NOUVEAU POLYPEPTIDE, GENE σ-54 9, ET POLYNUCLEOTIDE CODANT POUR CE POLYPEPTIDE
WO2002004500A1 (fr) Nouveau polypeptide, proteine humaine a doigt de zinc fpm315-17, et polynucleotide codant ce polypeptide
WO2001081399A1 (fr) Nouveau polypeptide, proteine pax humaine 14, et polynucleotide codant pour ce polypeptide
WO2001070784A1 (fr) Nouveau polypeptide, proteine humaine 17 contenant un domaine de structure chromo, et polynucleotide codant pour ce polypeptide

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
AK Designated states

Kind code of ref document: A3

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A3

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase in:

Ref country code: JP