WO2001049737A1 - Nouveau polypeptide, latexine proteine humaine 46, et polynucleotide codant pour ce polypeptide - Google Patents

Nouveau polypeptide, latexine proteine humaine 46, et polynucleotide codant pour ce polypeptide Download PDF

Info

Publication number
WO2001049737A1
WO2001049737A1 PCT/CN2000/000664 CN0000664W WO0149737A1 WO 2001049737 A1 WO2001049737 A1 WO 2001049737A1 CN 0000664 W CN0000664 W CN 0000664W WO 0149737 A1 WO0149737 A1 WO 0149737A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
polynucleotide
protein
sequence
human
Prior art date
Application number
PCT/CN2000/000664
Other languages
English (en)
Chinese (zh)
Inventor
Yumin Mao
Yi Xie
Original Assignee
Fudan University
Shanghai Bio Door Gene Technology Ltd.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Fudan University, Shanghai Bio Door Gene Technology Ltd. filed Critical Fudan University
Priority to AU21433/01A priority Critical patent/AU2143301A/en
Publication of WO2001049737A1 publication Critical patent/WO2001049737A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • the present invention belongs to the field of biotechnology. Specifically, the present invention describes a novel polypeptide, human latexin protein 46, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and the polypeptide.
  • the TF3A N-terminal DNA-binding domain consists of 9 regular repeating units, each unit has 30 amino acid residues, of which a pair of cysteine and a pair of histidine and zinc Ions form coordination bonds, and 9 repeat units form 9 finger-like structures, forming a family with common ancestors, responsible for binding to the major grooves of DNA, and the position of cysteine in it is CX (2) -CX ( 9to39) -CX (1 to3) -HX (2to3) -CX (2) -CX (4to48) -CX (2)-C—Sequence: CXHX- (LIVMFY) -CX (2)-C- (LIVMYA)
  • the ZNF127 gene encodes a protein with a zinc finger circular (C3HC4) structure, and has multiple C3HC4
  • C3HC4 zinc finger circular
  • researchers have gradually noticed a certain protein of the smallpox virus, the smallpox pathogen. These motifs may function as an RNP (ribonucleoprotein) in the functioning of ZNF127.
  • ZNF127 gene The exon of ZNF127 gene is universally expressed, but all the encoded sequences and 5, CpG islands (CpG-rich single copy unmethylated locus in the genome) are transferred to the second gene, ZNF127AS is Transcripts and antisense strands of expression are transcribed. Specific allele analysis showed that ZNF127 was only expressed from the paternal allele. For this expression, it can be imagined that ZNF1275 and CpG are all unmethylated loci in the paternal gene, but in the maternal allele Gene is methylated.
  • ZNF127 is part of the same regulatory region Domains are affected by mutations in patients with Prader-Willis syndrome. Therefore, ZNF127 and ZNF127AS are novel genes that may be related to the clinical characteristics of certain polygenic Prader-Willis syndromes.
  • RING-containing protein specifically binds to DNA to form a RING finger, which is a bold guess at best.
  • Many early studies were based on the ability of these RING-containing proteins to bind to cellular DM (22, 26).
  • the location of the RING-finger protein structure is only an artificial hypothetical structure.
  • RING finger members are in the cytoplasm, and many have assembly functions for peroxisomes, which indicates that there is no relationship with DNA binding.
  • proteins with RING finger especially triplets, were found in the macromolecular polyproteins aggregated in the cells.
  • PM1 is a large nucleosome that contains at least 5 different proteins (9-11). Mutations in the RING or B-box domain cause disruption of these multiprotein complexes (25 ..., 28). Further research is needed to determine the natural structure of these multiprotein complexes and the central structure of the RING finger.
  • the RING finger may serve as a central key that can unravel the structure and function of unknown proteins.
  • the polypeptide of the present invention was inferred and identified as a human latexin homologous protein, which has a similar structure and function of the RING-finger protein family, and was named human latexin protein 46.
  • human latexin protein 46 protein plays an important role in important functions of the body as described above, and it is believed that a large number of proteins are involved in these regulatory processes, there has been a need in the art to identify more human latexin protein 46 proteins involved in these processes. In particular, the amino acid sequence of this protein is identified.
  • the isolation of the newcomer's latexin protein 46 protein gene also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for developing diagnostic and / or therapeutic drugs, so isolating its coding DNA is important.
  • Another object of the invention is to provide a polynucleotide encoding the polypeptide.
  • Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding human latexin protein 46.
  • Another object of the present invention is to provide an antibody against the polypeptide of the present invention, human latexin protein 46.
  • Another object of the present invention is to provide mimic compounds, antagonists, agonists, and inhibitors directed to the polypeptide of the present invention, human latexin protein 46.
  • Another object of the present invention is to provide a method for diagnosing and treating diseases related to abnormalities of latex in protein 46 in humans. Summary of invention
  • the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
  • the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
  • sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 60-1310 in SEQ ID NO: 1; and (b) a sequence having 1-2760 in SEQ ID NO: 1 Sequence of bits.
  • the invention further relates to a vector, in particular an expression vector, containing the polynucleotide of the invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; and a method comprising culturing said Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
  • a vector in particular an expression vector, containing the polynucleotide of the invention
  • a host cell genetically engineered with the vector including a transformed, transduced or transfected host cell
  • a method comprising culturing said Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
  • the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
  • the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of human latex in protein 46 protein, which comprises utilizing the polypeptide of the invention.
  • the invention also relates to compounds obtained by this method.
  • the present invention also relates to a method for in vitro detection of a disease or susceptibility to disease associated with abnormal expression of human latex in protein.
  • 46 protein comprising detecting mutations in the polypeptide or a sequence encoding a polynucleotide thereof in a biological sample, or Detection of the amount or biological activity of a polypeptide of the invention in a biological sample.
  • the invention also relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
  • the invention also relates to the polypeptides and / or polynucleotides of the invention in the preparation for the treatment of cancer, developmental diseases Or immunological diseases or other drugs caused by abnormal expression of human latexin protein 46.
  • Fig. 1 is a comparison diagram of amino acid sequence homology of 61 zinc amino acids and domain zinc finger protein C3HC4 of the inventor's latexin protein 46 at 232-293.
  • the upper sequence is human latexin protein 46, and the lower sequence is the zinc finger protein C3HC4 domain.
  • " And ":” and ".” Indicate that the probability that the same amino acid appears between the two sequences decreases in order.
  • Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of the isolated human latexin protein 46.
  • 46kDa is the molecular weight of the protein.
  • the arrow indicates the isolated protein band.
  • Nucleic acid sequence refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
  • amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
  • amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
  • a protein or polynucleotide “variant” refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it. The changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence. Variants can have "conservative" changes in which the substituted amino acid has a structural or chemical property similar to the original amino acid, such as the replacement of isoleucine with leucine. Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
  • “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
  • Insertion refers to an alteration in the amino acid sequence or nucleotide sequence that results in an increase in one or more amino acids or nucleotides compared to a naturally occurring molecule.
  • Replacement refers to a different amino acid Or nucleotides replace one or more amino acids or nucleotides.
  • Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
  • immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response and to bind specific antibodies in a suitable animal or cell.
  • An "agonist” refers to a molecule that, when combined with human latexin protein 46, causes the protein to change, thereby regulating the activity of the protein.
  • An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that can bind to human latexin protein 46.
  • Antagonist refers to a molecule that, when combined with human latexin protein 46, can block or regulate the biological or immunological activity of human latexin protein 46.
  • Antagonists and inhibitors can include proteins, nucleic acids, carbohydrates or any other molecule that can bind to human latexin protein 46.
  • Regular refers to a change in the function of human latexin protein 46, including an increase or decrease in protein activity, a change in binding properties, and any other biological, functional, or immune properties of human latexin protein 46.
  • substantially pure means substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated.
  • Those skilled in the art can purify human latexin protein 46 using standard protein purification techniques.
  • Substantially pure human latexin protein 46 produces a single main band on a non-reducing polyacrylamide gel.
  • the purity of human latexin protein 46 polypeptide can be analyzed by amino acid sequence.
  • Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
  • sequence C-T-G-A
  • complementary sequence G-A-C-T
  • the complementarity between two single-stranded molecules can be partial or complete.
  • the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
  • “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
  • Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Sou t hern blotting or Nor t hern blotting, etc.) under conditions of reduced stringency.
  • Substantially homologous sequences or hybridization probes can compete and inhibit the binding of completely homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.
  • Percent identity refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALIGN program (Lasergene software package, DNASTAR, Inc., Madison Wis.). The MEGALIGN program can compare two or more sequences according to different methods, such as the Cluster method (Higgins, DG and PM Sharp (1988) Gene 73: 237-244). The Cluster method arranges groups of sequences into clusters by checking the distance between all pairs. The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences, such as sequence A and sequence B, is calculated by the following formula: The number of matching residues between the sequence and the sequence S
  • Residues sequences - sequences spacer residues - the sequence interval ⁇ ⁇ residues may be measured as Jo tun He in the percentage of identity between nucleic acid sequences (He Clus ter method or by a method known in the art in J., (1990) Methods in enzyrao logy 183: 625-645).
  • Similarity refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
  • Amino acids used for conservative substitution such as negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having uncharged head groups are Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
  • Antisense refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence.
  • the "antisense strand” refers to a nucleic acid strand that is complementary to the “sense strand”.
  • Derivative refers to HFP or a chemical modification of its nucleic acid. Such a chemical modification may be a substitution of a hydrogen atom with a fluorenyl group, an acyl group or an amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
  • Antibody refers to a complete antibody molecule and its fragments, such as Fa,? (& 1) ') 2 and? It can specifically bind to the epitope of human latex in protein 46.
  • a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
  • isolated refers to the removal of a substance from its original environment (for example, its natural environment if it occurs naturally).
  • a naturally occurring polynucleotide or polypeptide is not isolated when it is present in a living animal, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
  • Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not a component of its natural environment, they are still isolated.
  • isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
  • polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are the same as other substances existing in the natural state. Quality, it is separated and purified,
  • isolated human latexin protein 46 refers to human texin protein 46 that is essentially free of other proteins, lipids, sugars, or other substances that are naturally associated with it. Those skilled in the art can purify human latexin protein 46 using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of human latexin protein 46 peptide can be analyzed by amino acid sequence.
  • the present invention provides a new polypeptide, human latexin protein 46, which basically consists of the amino acid sequence shown in SEQ ID NO: 2.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
  • the polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques. Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
  • the invention also includes fragments, derivatives and analogs of human latexin protein 46.
  • fragment refers to a polypeptide that substantially retains the same biological function or activity of the human latexin protein 46 of the present invention.
  • a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a type in which one or more amino acid residues are replaced with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution The amino acid may or may not be encoded by the genetic codon; or (II) such a type in which a group on one or more amino acid residues is substituted by another group to include a substituent; or (III) such One, in which the mature polypeptide is fused to another compound (such as a compound that extends the half-life of the polypeptide, such as polyethylene glycol); or (IV) such a polypeptide sequence in which the additional amino acid sequence is fused to the mature polypeptide ( Such as a leader sequence or a secreted sequence or a sequence used to purify this polypeptide or a protein sequence).
  • such fragments, derivatives and analogs are considered to be within the knowledge of those skilled in the art.
  • the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the polynucleotide sequence of the present invention includes a nucleotide sequence of SEQ ID NO: 1.
  • the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a polynucleotide sequence of 2760 bases in length and its open reading frame (60-1310) encodes 42 amino acids.
  • This peptide has the characteristic sequence of the zinc finger protein C3HC4, and it can be deduced that the human latexin protein 46 has the structure and function represented by the zinc finger protein C3HC4.
  • the polynucleotide of the present invention may be in the form of DM or RNA.
  • DNA forms include cDNA, genomic DNA, or synthetic DNA.
  • DNA can be single-stranded or double-stranded.
  • DNA can be coding or non-coding.
  • the coding region sequence encoding the mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 Or a degenerate variant.
  • a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
  • the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
  • polynucleotide encoding a polypeptide refers to a polynucleotide that includes the polypeptide and a polynucleotide that includes additional coding and / or non-coding sequences.
  • the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
  • This polynucleotide variant can be a naturally occurring allelic variant or a non-naturally occurring variant.
  • These nucleotide variants include substitution variants, deletion variants, and insertion variants.
  • an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
  • the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity between the two sequences).
  • the present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions.
  • “strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60 ° C; or (2) Add denaturing agents during hybridization, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% F i col l, 42 ° C, etc .; or (3) only between the two sequences Crosses occur at least 95% or more, and more preferably 973 ⁇ 4 or more.
  • the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
  • nucleic acid fragments that hybridize to the sequences described above.
  • a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, most preferably at least 100 nucleotides. Nucleotides or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques (such as PCR) to identify and / or isolate polynucleotides encoding human latexin 46 protein.
  • polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
  • the specific polynucleotide sequence of the present invention encoding human lat ex in protein 46 can be obtained by various methods.
  • polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
  • the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.
  • genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences.
  • the standard method for isolating the cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library. There are many mature techniques for extracting mRNA, and kits are also commercially available (Qiagene).
  • cDNA libraries are also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989).
  • Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
  • genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DM or DNA-RNA hybridization; (2) the presence or absence of marker gene functions; (3) measuring the level of human latexin protein 46 transcripts; (4) Detection of gene-expressed protein products by immunological techniques or determination of biological activity. The above methods can be used singly or in combination.
  • the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
  • the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
  • the probe used here is usually a DNA sequence chemically synthesized based on the gene sequence information of the present invention.
  • the genes or fragments of the present invention can of course be used as probes.
  • DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
  • immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) can be used to detect the protein product expressed by the human latexin protein 46 gene.
  • ELISA enzyme-linked immunosorbent assay
  • a method of applying a PCR technique to amplify DNA / RNA is preferably used to obtain the gene of the present invention.
  • the RACE method RACE-Rapid Amplification of cDNA Ends
  • the primers for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein Select and synthesize using conventional methods.
  • the amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
  • polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be measured by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, sequencing needs to be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
  • the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using human latexin protein 46 coding sequence, and recombinant technology Method for producing the polypeptide of the present invention by surgery. .
  • a polynucleotide sequence encoding human latexin protein 46 can be inserted into a vector to form a recombinant vector containing the polynucleotide of the present invention.
  • vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses or other vectors well known in the art.
  • Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al.
  • any plasmid and vector can be used to construct a recombinant expression vector.
  • An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
  • the expression vector also includes a ribosome binding site for translation initiation, a transcription terminator, and the like. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Examples include 100 to 270 base pair SV40 enhancers at the late side of the replication initiation point, polyoma enhancers and adenovirus enhancers at the late stage of the replication initiation point.
  • the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • GFP fluorescent protein
  • tetracycline or ampicillin resistance for E. coli.
  • a polynucleotide encoding human latexin protein 46 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a genetic engineered gene containing the polynucleotide or the recombinant vector.
  • Programmed host cells refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E.
  • coli Streptomyces
  • bacterial cells such as Salmonella typhimurium
  • fungal cells such as yeast
  • plant cells such as fly S2 or Sf9
  • animal cells such as CH0, COS or Bowes melanoma cells.
  • Transformation of a host cell with a DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art.
  • the host is a prokaryote such as E. coli
  • competent cells capable of absorbing DM can be harvested after the exponential growth phase and treated with the CaCl 2 method. The steps used are well known in the art. Alternatively, MgCl 2 is used. If necessary, transformation can also be performed by electroporation.
  • the host is a eukaryotic organism, the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
  • polynucleotide sequence of the present invention can be used to express or produce recombinant human latexin protein 46 (Science, 1984; 224: 1431). Generally, the following steps are taken:
  • the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
  • a suitable method such as temperature conversion or chemical induction
  • the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If necessary, the recombinant protein can be isolated and purified by various separation methods using its physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
  • conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid
  • polypeptides of the present invention can be directly used in the treatment of diseases, for example, they can be used to treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection, and immunological diseases.
  • Latexin protein has a RING-finger structure, which may have the function of RNA polymerase 3 transcription factor. It is very important for the correct translation of cytogenetic information. Studies have found that it Information transmission in germ cells, such as paternal genetic information, plays an important role. The specific conserved sequences of the iatexin protein are necessary to form its active motif.
  • the abnormal expression of the specific latexin protein motif will cause the function of the polypeptide containing the motif of the present invention to be abnormal, resulting in abnormal DNA translation function, causing errors in genetic information transmission, and may cause abnormalities in the reproductive system. And produce related diseases such as reproductive system diseases, tumors, embryonic development disorders, growth and development disorders and so on.
  • the abnormal expression of the human latexin protein 46 of the present invention will produce various diseases, especially reproductive system diseases, various tumors, embryonic development disorders, and growth disorders. These diseases include, but are not limited to:
  • Testicular tumors such as seminoma, embryonic cancer, teratoma, chorionic carcinoma, yolk sac tumor, testicular stromal cell tumor, epididymal tumors such as adenoma-like tumors, papillary cystadenoma, epididymal tumors Prostate cancer
  • Embryonic disorders congenital abortion, cleft palate, limb loss, limb differentiation disorder, hyaline membrane disease, atelectasis, polycystic kidney, double ureter, cryptorchidism, congenital inguinal hernia, double uterus, vaginal atresia, suburethral Fissure, hermaphroditism, atrial septal defect, ventricular septal defect, pulmonary stenosis, arterial duct occlusion, neural tube defect, congenital hydrocephalus, iris defect, congenital cataract, congenital glaucoma or cataract, congenital deafness
  • Growth and development disorders mental retardation, cerebral palsy, brain development disorders, mental retardation, familial cerebral nucleus dysplasia syndrome, strabismus, skin, fat and muscular dysplasia such as congenital skin laxity, premature aging Disease, congenital keratosis, various metabolic defects such as various amino acid metabolic defects, stunting, dwarfism, sexual retardation
  • Tumors of various tissues gastric cancer, liver cancer, lung cancer, esophageal cancer, breast cancer, leukemia, lymphoma, thyroid tumor, uterine fibroids, neuroblastoma, astrocytoma, ependymoma, glioblastoma, Colon cancer, melanoma, adrenal cancer, bladder cancer, bone cancer, osteosarcoma, myeloma, bone marrow cancer, brain cancer, uterine cancer, endometrial cancer, gallbladder cancer, colon cancer, thymic tumor, nasal cavity and sinus tumor, nose Pharyngeal cancer, Laryngeal cancer, Tracheal tumor, Fibroma, Fibrosarcoma, Lipoma, Liposarcoma, Leiomyoma
  • Abnormal expression of the human latexin protein 46 of the present invention will also cause certain hereditary, hematological and immune system diseases.
  • the polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat various diseases, especially reproductive system diseases, various tumors, embryonic development disorders, and growth disorders. Certain genetic, hematological and immune system diseases.
  • the invention also provides methods of screening compounds to identify agents that increase (agonist) or suppress (antagonist) human latexin protein 46. Agonists enhance human latexin protein 46 to stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
  • mammalian cells or membrane preparations expressing human latexin protein 46 can be cultured with labeled human latexin protein 46 in the presence of drugs. The ability of the drug to increase or block this interaction is then determined.
  • Antagonists of human latexin protein 46 include screened antibodies, compounds, receptor deletions, and the like.
  • the antagonist of human latexin protein 46 can bind to human latexin protein 46 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot perform biological functions.
  • human latexin protein 46 can be added to bioanalytical assays to determine whether a compound is an antagonist by measuring the effect of the compound on the interaction between human latexin protein 46 and its receptor. Receptor deletions and analogs that act as antagonists can be screened in the same way as for screening compounds described above.
  • Peptide molecules capable of binding to human latexin protein 46 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. When screening, human latexin protein 46 molecules should generally be labeled.
  • the present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies.
  • the invention also provides antibodies directed against a human latexin protein 46 epitope. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments generated from Fab expression libraries.
  • Polyclonal antibodies can be produced by injecting human latexin protein 46 directly into immunized animals (such as rabbits, mice, rats, etc.).
  • immunized animals such as rabbits, mice, rats, etc.
  • a variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's adjuvant.
  • Techniques for preparing monoclonal antibodies to human latexin protein 46 include, but are not limited to, hybridoma technology (Kohler and Milstein. Nature, 1975, 256: 495-497), triple tumor technology, human beta-cell hybridoma technology, and EBV-hybridization. Tumor technology, etc.
  • Chimeric antibodies combining human constant regions and non-human variable regions can be produced using existing techniques (Morrison et al, PNAS, 1985, 81: 6851). 0
  • Existing techniques for producing single-chain antibodies can also be used to produce single chain antibodies against human latexin protein 46.
  • Anti-human latexin protein 46 antibodies can be used in immunohistochemical techniques to detect human latexin protein 46 in biopsy specimens.
  • Monoclonal antibodies that bind to human latexin protein 46 can also be labeled with radioisotopes. Its location and distribution can be tracked into the body. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
  • Antibodies can also be used to design immunotoxins that target a particular part of the body.
  • human latexin protein 46 high affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
  • a common method is to attack the amino group of the antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
  • This hybrid antibody can be used to kill human latexin 46 positive cells.
  • the antibodies of the present invention can be used to treat or prevent diseases related to human latexin protein 46.
  • Administration of appropriate doses of antibodies can stimulate or block the production or activity of human latexin protein 46.
  • the invention also relates to a diagnostic test method for quantitative and localized detection of human latexin protein 46 levels. These tests are well known in the art and include FISH assays and radioimmunoassays.
  • the human latexin protein 46 level detected in the test can be used to explain the importance of human latexin protein 46 in various diseases and to diagnose diseases in which human latexin protein 46 plays a role.
  • polypeptide of the present invention can also be used for peptide mapping analysis.
  • the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
  • human latexin protein 46 can also be used for a variety of therapeutic purposes.
  • Gene therapy technology can be used to treat abnormal cell proliferation, development or metabolism caused by the non-expression or abnormal / inactive expression of human latexin protein 46.
  • Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutant human latexin protein 46 to inhibit endogenous human latexin protein 46 activity.
  • a mutant human latexin protein 46 may be a shortened human latexin protein 46 lacking a signaling domain, although it can bind to downstream substrates, but lacks signaling activity. Therefore, the recombinant gene therapy vector can be used to treat diseases caused by abnormal expression or activity of latexin protein 46 in humans.
  • Virus-derived expression vectors such as retroviruses, adenoviruses, adenovirus-associated viruses, herpes simplex virus, and parvoviruses can be used to transfer a polynucleotide encoding human latexin protein 46 into cells.
  • Methods for constructing recombinant viral vectors carrying a polynucleotide encoding human latexin protein 46 can be found in the existing literature (Sambrook, et al.).
  • a recombinant polynucleotide encoding human latexin protein 46 can be packaged into liposomes and transferred into cells.
  • Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
  • a vector such as a virus, phage, or plasmid
  • Oligonucleotides including antisense RNA and DNA
  • nuclear that inhibit human latexin protein 46 mRNA Enzymes are also within the scope of the invention.
  • a ribozyme is an enzyme-like RNA molecule that can specifically decompose specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with the target RNA of the porphyrin to perform endonucleation.
  • Antisense RNA, DNA, and ribozymes can be obtained by any existing RNA or DNA synthesis technology, such as the technology for the synthesis of oligonucleotides by solid-phase phosphoramidite chemical synthesis has been widely used.
  • Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA. This DNA sequence has been integrated downstream of the RNA polymerase promoter of the vector. In order to increase the stability of a nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the ribonucleoside linkages should use phosphate thioester or peptide bonds instead of phosphodiester bonds.
  • a polynucleotide encoding human latexin protein 46 can be used for the diagnosis of diseases related to human latexin protein 46.
  • a polynucleotide encoding human latexin protein 46 can be used to detect the expression of human latexin protein 46 or the abnormal expression of human latexin protein 46 in a disease state.
  • the DNA sequence "" encoding human latexin protein 46 can be used to hybridize biopsy specimens to determine the expression of human latexin protein 46.
  • Hybridization techniques include Southern blotting, Northern blotting, in situ hybridization, and so on. These techniques and methods are all mature and open technologies, and related kits are commercially available.
  • a part or all of the polynucleotides of the present invention can be used as probes to be fixed on a microarray or a DNA chip (also referred to as a "gene chip") for analyzing differential expression analysis of genes and genetic diagnosis in tissues.
  • Human latexin protein 46 specific primers can be used to perform RNA-polymerase chain reaction (RT-PCR) in vitro amplification to detect human latexin protein 46 transcripts.
  • Human latexin 46 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to normal wild-type human latexin 46 DNA sequences. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression, so Northern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
  • sequences of the invention are also valuable for chromosome identification. This sequence will specifically target a specific position on a human chromosome and can hybridize to it. Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for marking chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DNA sequences on a chromosome.
  • the PCR primers (preferably 15-35bp) are prepared based on cDNA, and the sequence can be located on the chromosome. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those hybrid cells that contain the human gene corresponding to the primer will produce amplified fragments. PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes. Using the oligonucleotide primers of the present invention, by a similar method, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization. Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and hybrid pre-selection to construct chromosome-specific cDNA libraries.
  • Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step.
  • FISH Fluorescent in situ hybridization
  • the difference in cDNA or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).
  • the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
  • suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
  • the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
  • the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell.
  • the polypeptides of the invention can be used in combination with other therapeutic compounds.
  • the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
  • Human latexin protein 46 is administered in an amount effective to treat and / or prevent a specific indication. Amount and dosage range of human latexin protein 46 administered to a patient Will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnosing doctor, examples
  • Total human fetal brain RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform.
  • Poly (A) mRNA was isolated from total RNA using Quik mRNA Isolation Kit (Qiegene). 2ug poly (A) mRNA is reverse transcribed to form cDNA. Smart cDNA cloning kit (purchased from C Ion tech 1 cDM fragment was inserted into the multiple cloning site of pBSK (+) vector (Clontech)) to transform DH5a to form a cDNA library.
  • Dye terminate cycle react ion sequencing Kit Perkin-Elmer
  • ABI 377 automatic sequencer Perkin-Elmer
  • the determined cDNA sequences were compared with the existing public DM sequence database (Genebank). The comparison revealed that the cDNA sequence of one of the clones 0311D09 was new DNA.
  • a series of primers were synthesized to determine the inserted cDNA fragment of the clone in both directions.
  • the 0311D09 clone contained a full-length cDNA of 2760bp (such as Seq IDN0: 1), there is a 1250bp open reading frame (0RF) from 60bp to 1310bp, encoding a new protein (as shown in Seq ID NO: 2).
  • This clone P BS-0311D09 The encoded protein is named human latexin protein 46.
  • the sequence of the human latexin protein 46 and its encoded protein sequence of the present invention were profiled using the GCG profile scan program (Basic local alignment search tool) [Al tschul, SF et al. J. Mol. Biol. 1990; 215: 403-10], performing domain analysis in a database such as prote.
  • the human latexin protein 46 of the present invention is homologous with the domain zinc finger protein C3HC4 at 232-293, and the homology result is shown in FIG. 1 with a homology rate of 0.22 and a score of 12.37; the threshold value is 11.70.
  • Example 3 Cloning of a gene encoding human latexin protein 46 by RT-PCR
  • CDNA was synthesized using fetal brain total RNA as a template and oligo-dT as a primer for reverse transcription reaction. After purification using Qiagene's kit, PCR was performed using the following primers: Primerl: 5'- GGAGGCGGCAGCGGCTGCGAGAGGC -3 '(SEQ ID NO: 3)
  • Primer2 5'- TGATTTGGGTTTTAATTTTGTTTTTTT -3 '(SEQ ID NO: 4)
  • Primerl is a forward sequence located at the 5th end of SEQ ID NO: 1, starting at lbp;
  • Primer2 is the 3 'end reverse sequence in SEQ ID NO: 1.
  • a reaction volume of 50 ⁇ 1 contains 50 mmol / L C1, 10 mmol / L Tris-HC1, pH 8.5, 1.5 mmol / L MgCl 2 , 20 ( ⁇ mol / L dNTP, lOpmol primer, 1U Taq DM polymerase (C 1 on tech).
  • the reaction was performed on a PE9600 DNA thermal cycler (Pe rki nE 1 me r) for 25 cycles under the following conditions: 94. C 30sec; 55 ° C 30sec; 72 ° C 2min. Set ⁇ -act in as a positive control and template blank as a negative control at the same time during RT-PCR.
  • amplification products were purified using a QIAGEN kit and linked to a pCR vector using a TA cloning kit (Invitrogen product).
  • DM sequence analysis results show that the DNA sequence of the PCR product is exactly the same as the 1- 2760bp shown in SEQ ID NO: 1.
  • Example 4 Northern blot analysis of human latexin protein 46 gene expression
  • RNA extraction in one step [Anal. Biochem 1987, 162, 156-159] 0
  • This method involves acid guanidinium thiocyanate-chloroform extraction. That is, the tissue is homogenized with 4M guanidine isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 time volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1 ) And centrifuge after mixing. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water.
  • a 32P-labeled probe (about 2 x 10 6 cpm / ml) was hybridized with a nitrocellulose membrane to which RNA was transferred at 42 ° C overnight in a solution containing 50% formamide-25mM KH 2 P0 4 (pH7.4)-5 x SSC-5 x Denhardt's solution and 20 g / ml salmon sperm DNA. After hybridization, the filter was washed in lx SSC-0.1% SDS at 55 ° C for 30 minutes. Then, Phosphor Imager analysis and quantification.
  • Example 5 In vitro expression, isolation and purification of recombinant human latexin protein 46
  • Primer3 5'- CCCGCTAGCATGAGCACCAAGCAGATCACTTGCA -3 '(Seq ID No: 5)
  • Primer4 5'- CCCGGATCCTGATGATTCCACTCCAGAAAGGTGC -3' (Seq ID No: 6)
  • These two primers contain Ndel and BamHI restriction sites, respectively. 5 'end of target gene And the 3 'end coding sequence, the Nde [and BamHI restriction sites correspond to selective endonuclease sites on the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865.3).
  • the PCR reaction was performed using the PBS-0311D09 plasmid containing the full-length target gene as a template.
  • the PCR reaction conditions were as follows: a total volume of 50 ⁇ 1 containing 10 pg of pBS-0311D09 plasmid, primers Primer-3 and Primer-4 were lOpmol, Advantage polymerase Mix (Clontech) 1 ⁇ 1, respectively. Cycle parameters: 94 ° C 20s, 60 ° C 30s, 68 ° C 2 min, a total of 25 cycles. Ndel and BamHI were used to double-digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase. The ligation product was transformed into E. coli DH5c by the calcium chloride method.
  • a peptide synthesizer specific to human latexin protein 46 was synthesized using a peptide synthesizer (product of PE): NH2-Met-Ser-Thr-Lys-Gln-Ile-Thr-Cys-Arg-Tyr-Phe-Met-His- Gly-Val-COOH (SEQ ID NO: 7).
  • the polypeptide is coupled with hemocyanin and bovine serum albumin to form a complex, respectively.
  • oligonucleotide fragments from the polynucleotides of the present invention for use as hybridization probes. Uses: if the probe can be used to hybridize to the genomic or cDNA library of normal tissue or pathological tissue from different sources to identify whether it contains the polynucleotide sequence of the present invention and detect a homologous polynucleotide sequence, it can further be used The probe detects whether the polynucleotide sequence of the present invention or a homologous polynucleotide sequence thereof is abnormally expressed in cells of normal tissue or pathological tissue.
  • the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method.
  • Filter hybridization methods include dot blotting, Sou thern imprinting, Nor thern blotting, and copying methods. They are all used to fix the polynucleotide sample to be tested on the filter and then hybridize using basically the same steps.
  • the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer to saturate the non-specific binding site of the sample on the filter with the carrier and the synthesized polymer.
  • the pre-hybridization solution is then replaced with a hybridization buffer containing labeled probes and incubated to hybridize the probes to the target nucleic acid.
  • the unhybridized probes are removed by a series of membrane washing steps.
  • This embodiment uses higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals.
  • the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
  • the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
  • the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
  • oligonucleotide fragments from the polynucleotide SEQ ID D NO: 1 of the present invention for use as hybridization probes should follow the following principles and several aspects to be considered:
  • the preferred size of the probe ranges from 18 to 50 nucleotides
  • the GC content is 30% -70%, and the non-specific hybridization increases when it exceeds;
  • Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements The regions are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, then the primary probe should not be used;
  • Probe 1 (probel), which belongs to the first type of probe, is completely homologous to the gene fragment of SEQ ID NO: 1 Or complementary (41Nt)
  • Probe 2 which belongs to the second type of probe, is equivalent to the replacement mutant sequence of the gene fragment of SEQ ID NO: 1 or its complementary fragment (41Nt):
  • PBS phosphate buffered saline
  • step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
  • NC membranes nitrocellulose membranes
  • the 32 P-Probe (the second peak is free ⁇ - 32 P-dATP) is prepared after the collection solutions of the first peak are combined.
  • the sample membrane was placed in a plastic bag, and 3-10 mg of prehybridization solution (10xDenhardt-s; 6xSSC, 0.1 mg / nil CT DNA (calf thymus DM)) was added. After sealing the mouth of the bag, shake at 68 ° C for 2 hours.
  • prehybridization solution 10xDenhardt-s; 6xSSC, 0.1 mg / nil CT DNA (calf thymus DM)
  • Gene microarrays or DNA microarrays are new technologies currently being developed by many national laboratories and large pharmaceutical companies. It refers to the orderly and high-density arrangement of a large number of target gene fragments on glass, Silicon and other carriers, and then use fluorescence detection and computer software to compare and analyze the data Analysis in order to achieve the purpose of fast, efficient and high-throughput analysis of biological information.
  • the polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research of new gene functions; search for and screen new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases .
  • the specific method steps have been reported in the literature, for example, see the literature DeRisi, JL, Lyer, V. & Brown, P.0.
  • a total of 4,000 polynucleotide sequences of various full-length cDNAs are used as target DNA, including the polynucleotide of the present invention. They were respectively amplified by PCR. After purification, the concentration of the amplified product was adjusted to about 500 ng / ul, and spotted on a glass medium with a Cartesian 7500 spotter (purchased from Cartesian Company, USA), between the points. The distance is 280 ⁇ ⁇ . The spotted slides were hydrated and dried, cross-linked in a UV cross-linker, and dried after elution to fix the DNA on the glass slide to prepare a chip. The specific method steps have been reported in the literature. The sample post-processing steps in this embodiment are:
  • Total mRNA was extracted from normal liver and liver cancer in one step, and mRNA was purified with 01 igotex mRNA Midi Kit (purchased from QiaGen).
  • the fluorescent reagent Cy3dUTP (5-Amino-propargy 1-2 ⁇ -deoxyur i dine 5'-tr iphate coupled to Cy3 fluorescent dye (purchased from Amersham Phamacia Biotech) was used to label mRNA of normal liver tissue
  • the fluorescent reagent Cy5dUTP (5-Amino-propargy 1-2 ⁇ -deoxyur i dine 5'- tr iphate coupled to Cy5 fluorescent dye (purchased from Amersham Phamacia Biotech) was used to label the liver cancer tissue mRNA, and the probe was prepared after purification.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Toxicology (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

L'invention concerne un nouveau polypeptide, une latexine protéine humaine 46, et un polynucléotide codant pour ce polypeptide ainsi qu'un procédé d'obtention de ce polypeptide par des techniques recombinantes d'ADN. L'invention concerne en outre les applications de ce polypeptide dans le traitement de maladies, notamment des tumeurs malignes, de l'hémopathie, de l'infection par VIH, de maladies immunitaires et de diverses inflammations. L'invention concerne aussi l'antagoniste agissant contre le polypeptide et son action thérapeutique ainsi que les applications de ce polynucléotide codant pour la latexine protéine humaine 46.
PCT/CN2000/000664 1999-12-29 2000-12-25 Nouveau polypeptide, latexine proteine humaine 46, et polynucleotide codant pour ce polypeptide WO2001049737A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU21433/01A AU2143301A (en) 1999-12-29 2000-12-25 A novel polypeptide - human latexin protein 46 and a polynucleotide encoding thesame

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN99127234.X 1999-12-29
CN 99127234 CN1301769A (zh) 1999-12-29 1999-12-29 一种新的多肽——人的1atexin蛋白46和编码这种多肽的多核苷酸

Publications (1)

Publication Number Publication Date
WO2001049737A1 true WO2001049737A1 (fr) 2001-07-12

Family

ID=5284822

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2000/000664 WO2001049737A1 (fr) 1999-12-29 2000-12-25 Nouveau polypeptide, latexine proteine humaine 46, et polynucleotide codant pour ce polypeptide

Country Status (3)

Country Link
CN (1) CN1301769A (fr)
AU (1) AU2143301A (fr)
WO (1) WO2001049737A1 (fr)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101497664B (zh) * 2008-01-29 2012-02-15 北京市肿瘤防治研究所 人羧肽酶A抑制因子Latexin的单克隆抗体及其应用

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1997006255A2 (fr) * 1995-08-04 1997-02-20 University Of Ottawa Famille de genes mammaliens de proteines inhibant l'apoptose (iap), amorces, sondes et procedes de detection
WO1997012971A1 (fr) * 1995-09-29 1997-04-10 Novartis Ag Proteine annulaire a doigt
JPH09221499A (ja) * 1995-10-24 1997-08-26 Shionogi & Co Ltd 神経細胞で発現する新規タンパク質

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1997006255A2 (fr) * 1995-08-04 1997-02-20 University Of Ottawa Famille de genes mammaliens de proteines inhibant l'apoptose (iap), amorces, sondes et procedes de detection
WO1997012971A1 (fr) * 1995-09-29 1997-04-10 Novartis Ag Proteine annulaire a doigt
JPH09221499A (ja) * 1995-10-24 1997-08-26 Shionogi & Co Ltd 神経細胞で発現する新規タンパク質

Also Published As

Publication number Publication date
AU2143301A (en) 2001-07-16
CN1301769A (zh) 2001-07-04

Similar Documents

Publication Publication Date Title
WO2001055189A1 (fr) NOUVEAU POLYPEPTIDE, SECp43, 32 S'ASSOCIANT AVEC L'ARNt DE LA SELENOCYSTEINE HUMAINE, ET POLYNUCLEOTIDE CODANT POUR CE POLYPEPTIDE
WO2001049737A1 (fr) Nouveau polypeptide, latexine proteine humaine 46, et polynucleotide codant pour ce polypeptide
WO2002026810A1 (fr) Nouveau polypeptide, substance proteique p125-77.22, et polynucleotide codant ce polypeptide
WO2001070800A1 (fr) Nouveau polypeptide, proteine humaine 11 helicase atp-dependante, et polynucleotide codant pour ce polypeptide
WO2001048006A1 (fr) Nouveau polypeptide, proteine de liaison de la cobalamine 10, et polynucleotide codant pour ce polypeptide
WO2001049724A1 (fr) Nouveau polypeptide, proteine lissencephale humaine 43, et polynucleotide codant pour ce polypeptide
WO2001046409A1 (fr) Nouveau polypeptide, proteine ribosomale s7 9, et polynucleotide codant pour ce polypeptide
WO2001062782A1 (fr) Nouveau polypeptide, famille proteique 11 de la rhodopsine, et polynucleotide codant pour ce polypeptide
WO2001094530A2 (fr) Nouveau polypeptide, proteine 57 de la sous-famille des proteines a doigt de zinc scan, et polynucleotide codant ce polypeptide
WO2001055195A1 (fr) Nouveau polypeptide, proteine de type an1 humaine, et polynucleotide codant pour ce polypeptide
WO2001072796A1 (fr) Nouveau polypeptide, facteur humain de transcription de la differentiation cellulaire 11, et polynucleotide codant pour ce polypeptide
WO2001081594A1 (fr) Nouveau polypeptide, proteine pax humaine 17, et polynucleotide codant pour ce polypeptide
WO2001079432A2 (fr) Nouveau polypeptide, facteur humain de transcription de la differentiation cellulaire 58, et polynucleotide codant pour ce polypeptide
WO2001072793A1 (fr) Nouveau polypeptide, proteine humaine de regulation 12 de la proteine hydrolase, et polynucleotide codant pour ce polypeptide
WO2001094593A1 (fr) Nouveau polypeptide, glycero-3-phosphate deshydrogenase humaine 11, et polynucleotide codant ce polypeptide
WO2001055423A1 (fr) Nouveau polypeptide, proteine pwwp humaine 58, et polynucleotide codant pour ce polypeptide
WO2001046242A1 (fr) NOUVEAU POLYPEPTIDE, GENE σ-54 9, ET POLYNUCLEOTIDE CODANT POUR CE POLYPEPTIDE
WO2001047973A1 (fr) Nouveau polypeptide, proteine 14 associee a la vesicule a gaz, et polynucleotide codant pour ce polypeptide
WO2001090171A1 (fr) Nouveau polypeptide, proteine humaine ribosomale sii 12, et polynucleotide codant ce polypeptide
WO2001074867A1 (fr) Nouveau polypeptide, proteine humaine 11 regulant la protease, et polynucleotide codant pour ce polypeptide
WO2001066728A1 (fr) Nouveau polypeptide, proteine humaine 11 du gene de reparation de mesappariement de l'adn, et polynucleotide codant pour ce polypeptide
WO2001079437A2 (fr) Nouveau polypeptide, facteur humain de transcription de la differentiation cellulaire 14, et polynucleotide codant pour ce polypeptide
WO2001087962A1 (fr) Nouveau polypeptide, proteine pax humaine 11, et polynucleotide codant ce polypeptide
WO2001087951A1 (fr) Nouveau polypeptide, helicase humaine 11, et polynucleotide codant pour ce polypeptide
WO2002004632A1 (fr) Nouveau polypeptide, latexine humaine 53, et polynucleotide codant ce polypeptide

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP