WO1997012971A1 - Proteine annulaire a doigt - Google Patents

Proteine annulaire a doigt Download PDF

Info

Publication number
WO1997012971A1
WO1997012971A1 PCT/IB1995/001024 IB9501024W WO9712971A1 WO 1997012971 A1 WO1997012971 A1 WO 1997012971A1 IB 9501024 W IB9501024 W IB 9501024W WO 9712971 A1 WO9712971 A1 WO 9712971A1
Authority
WO
WIPO (PCT)
Prior art keywords
mat1
protein
nucleic acid
cyclin
dna
Prior art date
Application number
PCT/IB1995/001024
Other languages
English (en)
Inventor
Erich Alois Nigg
Jean-Pierre Tassan
Original Assignee
Novartis Ag
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Novartis Ag filed Critical Novartis Ag
Priority to AU38139/95A priority Critical patent/AU3813995A/en
Publication of WO1997012971A1 publication Critical patent/WO1997012971A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/4702—Regulators; Modulating activity
    • C07K14/4703—Inhibitors; Suppressors

Definitions

  • This invention relates to a protein which is essential for the formation of an active cyclin-dependent kinase (CDK)/cyclin complex, particularly such complex comprising CDK7 and cyclin H, derivatives of said protein, antibodies specific for said protein, and to means and methods for the production thereof.
  • CDK active cyclin- dependent kinase
  • the invention is also directed to nucleic acids coding for a protein of the invention, to a method of obtaining such nucleic acid molecules, and to the expression thereof. Furthermore, the invention is directed to uses of the proteins and nucleic acids of the invention.
  • CDKs cyclin-dependent kinases
  • Thr161 in human CDC2 also referred to as CDK1
  • CDK1 CDK-activating kinase
  • CDK7/cyclin H may perform additional or alternative functions. Both CDK7 and cyclin H are in fact found to be associated with TFIIH, a multiprotein complex required for transcription by RNA polymerase II and for nucleotide excision repair (Roy.R. et al. (1994) Cell, 79, 1093-1101 ; Shiekhattar.R., et al. (1995) Nature, 374, 283-287; Serizawa.H., et al. (1995) Nature, 374, 280-282.).
  • CDK7/cyclin H has been implicated in the phosphorylation of the C-terminal domain (CTD) of RNA polymerase II (Roy et al., supra; Serizawa et al., supra; Shiekhattar et al., supra; Makela, T.P. et al., (1995) Proc. Natl Acad. Sci. USA, 92, 5174-5178), a step that has long been recognized as being important for the regulation of transcription.
  • CCDK/cyclin complex structurally related to CDK7/cyclin H has been identified in Saccharomyces cerevisiae. This complex, KIN28 CCL1 (Valay.J.G.
  • CDK7/cyclin H the properties reported for CDK7/cyclin H indicate that this complex may contribute to integrate several fundamental cellular processes, notably cell cycle progression, transcription and DNA repair.
  • the clarification of the physiological role of this complex is clearly an important issue, e.g. for the development of proper therapeutic agents, e.g. anti-cancer agents.
  • a CAK-active binary CDK7/cyclin H complex can be formed using subunits expressed from recombinant baculoviruses in insect cells. It has also been reported that highly purified mammalian CDK7/cyclin H complexes display CAK activity in the apparent absence of a further subunit (Fisher and Morgan, supra). The lack of deeper knowledge in this field has significantly hampered, for example, progress towards understanding the function of the CDK7/cyclin H complex, and the search for compounds purposively modulating the activity of said complex.
  • the present invention has achieved identification and isolation of a third CAK subunit, which is designated MAT1 (m ⁇ nage a Peru 1). This component is identified as a novel RING finger protein. It is shown that this third CAK subunit is essential for the in vitro formation of a stable complex between CDK7 and cyclin H, and that the resulting ternary MAT1/CDK7/cyclin H complex, herein also referred to as CAK-complex, is associated in vivo with both CAK and CTD-kinase activities. Hence, the present invention provides an essential CDK/cyclin assembly factor. Moreover, the present invention has achieved isolation and sequencing of DNA encoding MAT1, thus enabling e.g. in vitro synthesis of the MAT1 protein and in vitro reconstitution of an active CDK7/cyclin H/MAT1 complex.
  • the present invention relates to a purified or isolated protein designated MAT1 , or a mutant thereof. It is an additional object of the instant invention to provide immunogens for raising antibodies against MAT1 as well as to obtain antibodies capable of specifically binding to MAT1. Furthermore, the present invention relates to isolated nucleic acids (DNA, RNA) coding for MAT1. As used hereinbefore or hereinafter, the term "isolated” is intended to refer to a molecule of the invention in a substantially pure form obtainable from a natural source, by chemical synthesis or by means of genetic engineering. The isolated proteins, DNAs, RNAs of the invention may be useful in ways that the proteins, DNAs, and RNAs as they naturally occur are not, such as identification of compounds modulating the activity of MAT1.
  • the invention provides an isolated nucleic acid that is complementary to, or hybridizes under stringent conditions to, a nucleic acid encoding MAT1.
  • the invention also provides a method for amplifying a nucleic acid test sample comprising priming a nucleic acid polymerase (chain) reaction with nucleic acid (DNA or RNA) encoding (or complementary to) MAT1.
  • the nucleic acid is DNA and further comprises a replicable vector comprising the nucleic acid encoding MAT1 operably linked to control sequences recognized by a host transformed by the vector.
  • the invention provides host cells transformed with such vector and a method of using a nucleic acid encoding MAT1 to effect the production of MAT1 , comprising expressing MAT1 nucleic acid in a culture of the transformed host cells and, if desired, recovering MAT1 from the host cell culture.
  • the present invention also has diagnostic or therapeutic aspects. For example, it relates to a method in which the presence and/or quantity of MAT1 in a biological sample is determined using a nucleic acid probe based on a nucleic acid sequence described herein, or an anti-MAT1 antibody. Such method may e.g. suitable to predict whether cells are likely to display aberrant proliferation behaviour, impaired DNA repair or changes in transcription levels by determining whether their MAT1 or CAK-complex levels, or biological activities associated with MAT1 or the CAK complex are elevated.
  • the present invention relates to a method for modulating MAT1 activity or function in vitro or in vivo comprising introducing into a cell or organism a MAT1 agonist or antagonist.
  • the invention further provides methods of modulating the activity of the CAK complex in cells, particularly by affecting the role of MAT1 in the formation, stabilization or activity of said complex. Such modulation may influence the cellular proliferation rate, DNA repair or transcription.
  • the present invention particularly relates to a method of inhibiting aberrant cell division by interfering with the function of MAT1.
  • the present invention relates to a method of affecting transcription by interfering with the function of MAT1. Also disclosed is a method of increasing DNA repair or reducing DNA repair defects, e.g.
  • MAT1 repair defects which are associated with high UV sensitivity of an organism, by. interfering with the function of MAT1.
  • function of MAT1 is blocked (either totally or partially) by interfering with its ability to contribute to or participate in the formation of an active CAK complex, by means of agents or signals which interfere with MAT1 activity, either directly or indirectly.
  • agents include e.g. anti-sense sequences or transcriptional modulators which bind MAT1 -encoding DNA or RNA; antibodies or other agents which bind either MAT1 or a molecule with which MAT1 must interact or bind in order to carry out its physiological role , e.g.
  • the invention also relates to signals or agents (oligonucleotides, antibodies, peptides) useful in the isolation, diagnostic or therapeutic methods described herein.
  • the present invention relates to an isolated protein designated MAT1 , which is characterized in that it is an assembly factor which is essential for the formation and stabilization of an active CAK complex and, in its full-length form, comprises a Ring finger in the N-terminus.
  • MAT1 is located predominantly in the nucleus of the cell. The level of MAT1 is virtually constant throughout the cell cycle.
  • the present invention relates to an isolated protein designated MAT1 , which is characterized in that it is an assembly factor which is essential for the formation and stabilization of an active CAK complex and, in its full-length form, comprises a Ring finger in the N-terminus, and is encoded by a nucleic acid which is capable of hybridizing under stringent conditions, preferably at high stringency, to an oligonucleotide with the sequence extending from bp 182 to 452 in SEQ ID NO:1.
  • MAT1 of SEQ ID NO:2 is a 309 amino acid protein with a calculated molecular mass of 36 kD.
  • MAT1 also refers to amino acid mutants or glycosylation variants of the protein of SEQ ID NO:2, and derivatives of the beforementioned proteins.
  • MAT1 , MAT1 of SEQ ID NO:2, an amino acid mutant and glycosylation variant thereof, as well as a derivative of the beforementioned proteins are collectively referred to as a "protein of the invention" or MAT1.
  • CAK7 also referred to as catalytic subunit, cyclin H and MAT1.
  • a protein of the invention may be identified by its role in the formation of such ternary complex, employing conventional methods readily evident to those skilled in the art from the information provided herein. Briefly, CDK7, cyclin H and the protein of the invention are contacted under conditions suitable to allow interaction of the proteins.
  • Conditions generally allowing such interaction occur between about 4°C and about 40°C, preferably between about 4°C and about 37°c, at a pH range of between 5 and 9, preferably between 6.5 and 8, for about 15 minutes to about 24 hours.
  • CDK7 and cyclin H may be endogenous (intrinsic) or exogenous (extrinsic), i.e. these proteins may - 6 -
  • Methods suitable for assessing formation of a ternary protein complex comprising CDK7, cyclin H and the protein of the invention include, for example, immunoanalytical techniques, such as immunoprecipitation and immunoblotting using antibodies capable of co-immunoprecipitating the components of the complex, or other methods conventionally employed in protein analysis, such as methods suitable for determining protein (complex) size or molecular mass, e.g. as gelfiltration, gradient centrifugation, e.g.
  • sucrose or glycerol gradient centrifugation, or electrophoresis optionally after immunoprecipitation of the complex with suitable antibodies, e.g. anti-CDK7 antibodies, anti-cyclin H antibodies or anti-MAT1 antibodies.
  • suitable antibodies e.g. anti-CDK7 antibodies, anti-cyclin H antibodies or anti-MAT1 antibodies.
  • the ternary complex has a molecular mass of about 100 to about 200 kD, as determined by gelfiltration. SDS-PAGE of the ternary complex yields bands at about 40 kD to about 42 kD, about 34 kD to about 37 kD, and about 32 kD to about 34 kD, representing CDK7, cyclin H and MAT1 , respectively. Particularly suitable are the respective methods described in more detail in the Examples.
  • cell lysates or incubation mixtures comprising all three CAK subunits may be analyzed for the presence of the ternary complex by SDS-PAGE and a suitable protein detection method, such as fluorography, autoradiography and/or immunoprecipitation with anti-MAT1 or anti-CDK7 antibodies. Analysis may involve separate or collective expression in vitro transcription-translation of these proteins, e.g. using a reticulocyte transcription- translation system.
  • MAT1 acts as a dose-dependent assembly-factor, meaning that increasing amounts of MAT1 cause increasing amounts of cyclin H to associate with CDK7.
  • MAT1 appears not to function as a chaperone in a catalytic fashion, but efficient reconstitution of an active CDK7/cyclin H/MAT1 complex requires about association of these three components in about stoichiometric amounts.
  • the active ternary complex comprising MAT1 displays protein kinase activity towards suitable substrates, particularly substrates mimicking the T-loop in CDKs (such kinase activity is referred to as CAK-activity) and substrates mimicking the C-terminal domain of RNA polymerase II (such kinase activity is referred to as CTD activity).
  • Nuclear CDK7/cyclin H is associated with MAT1 at all stages of the cell cycle in vivo to form a stable ternary complex.
  • the CAK complex is said to be stable e.g. if it forms in reticulocyte lysates primed with RNAs coding for CDK7, cyclin H and MAT1.
  • CAK-activity of an active ternary complex is analyzed according to methods well-known in the art, i.e. using conventional assays for protein kinase activity. Su ⁇ risingly in view of earlier results by Fisher and Morgan (supra), high levels of CAK activity are observed only for the ternary, but not for a binary complex lacking either cyclin H or MAT1.
  • the ternary complex may be used as a immunoprecipitate or be reconstituted from the individual subunits, using protein mixtures, such as cell extracts or lysates, e.g. reticulocyte lysates, or isolated CAK subunits.
  • CAK activity presumes presence of catalytically active CDK7 which may also be present as a fusion protein.
  • the ternary complex is incubated with a suitable proteinaceous kinase substrate in the presence of a phosphate donor, such as ATP or GTP, which is detectably labeled, e.g. [ ⁇ PJATP.
  • Suitable kinase substrates are CDK cyclin complexes with CDKs having a critical, phophorylatable threonine residue located in the T-loop region, e.g. CDK2, which is phophorylated on threonine at position 160, and CDK1 , which is phosphorylated on threonine at position 161 , and fusion proteins comprising such CDKs, wherein the accessibility of critical amino acid is not affected, e.g. the GST-CDK2 fusion protein, as employed in the Examples.
  • An exemplary CAK assay protocol is given in the Examples.
  • the CDK7/cyclin H/MAT1 complex is also associated with kinase activity towards the CTD of RNA polymerase II (CTD activity).
  • CTD activity is assayed under conditions well known in the art, e.g. under essentially the same conditions used in a CAK assay, particularly an assay described herein.
  • a suitable proteinaceous substrate is a protein having repeated TyrSerProTyrSerProSer motifs, such as CTD of RNA Polymerase II or GST-CTD, as employed in the Examples, or peptides comprising several repeats of the said heptamer motif.
  • MAT1 comprises at its N-terminus a RING finger, a specialized form of zinc finger defined by a C3HC4 sequence motif. This domain is not required for ternary complex formation with CDK7/cyclin H, indicating that the RING finger is available for promoting interactions of the ternary complex with other molecules.
  • MAT1 of SEQ ID NO:2 or said MAT1 reconstituted within the ternary CAK complex, no binding of the RING finger protein to either single-stranded or double-stranded DNA is detected.
  • the C3HC4 sequence motif consists of three cysteine residues at aa positions 6, 9 and 26, respectively, the histidine residue at position 28, and four cysteine residues at positions 31 , 34, 46 and 49, respectively.
  • isolated MAT1 means substantially pure MAT1 which has been identified and is essentially free of the components of its natural environment.
  • substantially pure MAT1 is homogenous MAT1 , which is substantially free from other compounds with which it is normally associated in vivo, particularly free from naturally occurring macromolecules, such as cyclin H and CDK7. Homogenicity is determined by reference to purity standards known to those skilled in the art, e.g. purity sufficient to allow determination of the N- terminal amino acid sequence.
  • Isolated MAT1 includes MAT1 in recombinant cell culture.
  • Preferred isolated proteins of the invention are a synthetic and a recombinant protein.
  • a protein of the invention is capable of binding CDK7 and cyclin H in a ternary complex.
  • the invention also relates to a composition of matter comprising a protein of the invention bound in a CAK complex, and optionally further proteins interacting with MAT1 , CDK7 or cyclin H, e.g. components of TFIIH.
  • Substantially pure MAT1 may be obtained from a natural source , e.g. tissue homogenates or cell lysates, through microbial expression, by chemical synthesis. Isolation from a natural source is achieved by protein purification techniques and means commonly known to those skilled in the art, such as techniques employing the affinity between MAT1 and a MAT1 ligand, e.g. immunoprecipitation and affinity chromatography. Such techniques may also be used to obtain biologically active fragments of MAT1 , which contain a binding domain for CDK7, cyclin H, or subunits of the DNA repair and transcription machinery.
  • functional amino acid variants include naturally occurring allelic or interspecies variations of the MAT1 amino acid sequence.
  • Preferred interspecies variants of the protein of SEQ ID NO:2 are mammalian MAT1 proteins.
  • a functional amino acid (sequence) variant of the MAT1 of SEQ ID NO:2 may be substitutional, insertional or deletional. Substitutions, deletions and insertions may be combined to arrive at an amino acid mutant of the invention. Amino acid substitutions are typically of single residues, insertions usually will be on the order of from one to about ten amino acid residues, and deletions will usually range from about one to thirty residues.
  • deletional mutants also refer to MAT1 fragments with an amino acid sequence lacking two or more consecutive amino acids as compared to the sequence of SEQ ID NO:2.
  • a substitutional amino acid mutant is any polypeptide having an amino acid sequence substantially identical to the sequence set forth in SEQ ID NO:2, in which one or more residues have been conservatively substituted with a functionally-similar amino acid residue.
  • Conservative substitutions include e.g. the substitution of one non-polar (hydrophobic) residue, such as methionine, valine, leucine, isoleucine for another, substitution of one polar (hydrophilic) residue for another, such as between glycine and serine, between arginine and lysine, and between glutamine and asparagine.
  • Substitutional or deletional mutagenesis may be employed to eliminate O- or N-linked glycosylation sites. Deletions of cysteine or other labile amino acid residues may also be desirable, for example to increase the oxidative stability of a protein of the invention.
  • Preferred amino acid mutants are fragments of the MAT1 protein of SEQ ID NO:2. Such fragments may be functionally or immunologically equivalent to the full-length protein.
  • An example of a functional equivalent is e.g. a mutant lacking the RING finger domain, e.g. the mutant designated ⁇ and described in the Examples.
  • Immunologically equivalent fragments are fragments comprising at least eight, preferably from about 20 to about 40, contiguous amino acids of the amino acid sequence set forth in SEQ ID NO:2 and mimicking a MAT1 epitope. Such fragments are suitable for the generation of anti-MAT1 antibodies.
  • a derivative of a protein of the invention is a covalent or aggregative conjugate of said protein with another chemical moiety, said derivative displaying essentially the same biological activity as the underivatized protein of the invention.
  • An exemplary covalent conjugate according to the invention is a conjugate of a protein of the invention with another protein or peptide, such as a fusion protein comprising a protein of the invention, e.g. MAT1 of SEQ ID NO:2, or a fragment thereof, and a protein tag, such as GST or polyhistidine, or a carrier protein suitable for enhancing the in vivo antigenicity of MAT1 or said fragment.
  • a covalent conjugate of the invention further includes a protein of the invention labelled with a detectable group, e.g. a protein of the invention which is radiolabelled, covalently bound to a rare earth chelate or conjugated to a fluorescent moiety or biotin.
  • a protein of the invention is obtainable from a natural source, e.g. by isolation from a mammalian, e.g. human organism, particularly human cells including cell Iines, such as HeLa cells or HL60 cells, or human tissue expressing MAT1 , or by chemical synthesis or recombinant DNA techniques.
  • a protein of the invention may be obtainable from a nucleic acid which hybridizes at high stringency to a 271 bp oligonucleotide with the sequence extending from bp 182 to 452 in SEQ ID NO:1.
  • chemical synthesis of a protein of the invention is performed according to conventional methods known in the art. In general, those methods comprise the sequential addition of one or more amino acid residues to a growing (poly)peptide chain. If required, potentially reactive groups, e.g. free amino or carboxy groups, are protected by a suitable, selectively removable protecting group. Chemical synthesis may be particularly advantageous for fragments of MAT1 having no more than about 100 to 150 amino acid residues.
  • the invention also provides a method for preparing a protein of the invention, said method being characterized in that suitable host cells producing the protein of the invention are multiplied in vitro or in vivo.
  • the host cells are transformed or transfected with a hybrid vector comprising an expression cassette comprising a promoter and a DNA sequence coding for a protein of the invention which DNA is controlled by said promoter.
  • the protein of the invention may be recovered. Recovery comprises e.g. isolating the protein of the invention from the host cells or isolating the host cells comprising the protein, e.g. from the culture broth.
  • Suitable host cells include eukaryotic cells, e.g.
  • a protein of the invention can be produced directly in recombinant cell culture or as a fusion with a signal sequence, preferably a host-homologous signal.
  • in vitro means ex vivo.
  • In vivo includes cell culture and tissue culture conditions, as well as living organisms.
  • An amino acid mutant may be produced e.g. from a DNA encoding a protein of SEQ ID NO:2, which DNA has been subjected to site-specific in vitro mutagenesis resulting e.g. in an addition, exchange and/or deletion of one or more amino acids. While the site for introducing an amino acid variation is predetermined, the mutation per se need not be predetermined, but random mutagenesis may be performed at the target codon or region.
  • substitutional, deletional and insertional variants are prepared by recombinant methods and screened for CDK7/cyclin H- or TFIIH subunit- binding affinity, activity in CAK or CTD kinase assays, functionality in promoting cell proliferation, DNA repair or transcription, and/or immuno-crossreactivity with the native forms of the protein of the invention, particularly the protein of SEQ ID NO:2.
  • mutants of the invention may be prepared by chemical synthesis using methods routinely employed in the art.
  • a protein of the invention may be derivatized in vitro or in vivo according to conventional methods known in the art.
  • a protein of the invention may be used, for example, as immunogen, e.g. to raise MAT1 specific immunoreagents, in a drug or ligand screening assay, or in a purification method, such as affinity purification of a binding ligand, such as CDK7/cyclin H, components of the DNA and transcription machinery, or an anti-MAT1 antibody.
  • a protein of the invention, or a fragment thereof, suitable for in vivo administration and capable of competing with endogenous MAT1 for an endogenous ligand is envisaged as therapeutic agent.
  • the invention also relates to the use of a protein of the invention, or a fragment thereof, for the generation of a monoclonal or polyclonal antibody, which specifically binds to MAT1.
  • a protein of the invention or a fragment thereof, for the generation of a monoclonal or polyclonal antibody, which specifically binds to MAT1.
  • Such anti-MAT1 antibody is intended to include immune sera.
  • Particularly useful for this purpose is a protein fragment consisting of at least eight or more, preferably eight to about fourty, consecutive amino acids of MAT1 of SEQ ID NO:2.
  • the invention provides polyclonal and monoclonal antibodies generated against MAT1.
  • Such antibodies may be useful e.g. for immunoassays including immunohistochemistry, as well as diagnostic and therapeutic applications.
  • antibodies specific for the CDK7/cyclin H binding site or the RING finger domain of MAT1 are suitable for blocking or interfering with the function of the endogenous MAT1.
  • Particularly useful are antibodies selectively recognizing and binding to MAT1.
  • the antibodies of the invention can be administered to a subject in need thereof, particulariy a human, employing standard methods.
  • Immunogenic MAT1 includes e.g. a tagged MAT1 fusion protein comprising e.g. a polyamino acid tag, or a myc epitope tag, and MAT1 , or a fragment thereof.
  • a suitable polyamino acid tag is e.g. polyhistidine.
  • Factors to consider in selecting MAT1 fragments as antigens include antigenicity and uniqueness to the protein.
  • the fragment may be a carboxy-terminal fragment of MAT1 comprising e.g. up to about three hundred consecutive C-terminal amino acids of the amino acid sequence set forth in SEQ ID NO:2.
  • Antigenic MAT1 fragments will usually comprise stretches of hydrophilic amino acid residues.
  • the antibodies as provided by the present invention may be capable of distinguishing between free MAT1 and MAT1 comprised in the CAK complex.
  • a multiple injection immunization protocol is used for immunizing animals with immunogenic MAT1.
  • a good antibody response can be obtained in rabbits by intramuscular injection of about 300 ⁇ g immunogenic MAT1 emulsified in complete Freud's adjuvant followed several weeks later by one or more boosts of the same antigen in incomplete Freud's adjuvant.
  • immunogenic MAT1 molecules used to immunize the animal may be fused or coupled to a carrier protein by conjugation using techniques which are well-known in the art.
  • Commmonly used carrier proteins which may be chemically coupled to the molecules include key hole limpet hemocyanin (KLH), thyroglobulin, bovine serum albumin (BSA), and a bacterial toxoid, e.g. tetanus or diphteria toxoid.
  • KLH key hole limpet hemocyanin
  • BSA bovine serum albumin
  • bacterial toxoid e.g. tetanus or diphteria toxoid.
  • Polyclonal antibodies produced by the immunized animals can be further purified by techniques conventionally used in immunology arts for the purification and/or concentration of polyclonal, or monoclonal antibodies, such as affinity chromatography.
  • antibodies of the invention may be purified by binding to and elution from a matrix to which the peptide against which the antibodies are raised to is bound.
  • monoclonal antibodies specific for MAT1 are preferred, e.g. for use in detecting MAT1 in analyte samples (e.g. tissue samples and cell Iines).
  • analyte samples e.g. tissue samples and cell Iines.
  • immunization of mouse, rat or goat is preferred.
  • the general method used for the production of hybridomas is well known (K ⁇ hler and Milstein (1975), Nature 256, 495).
  • the term antibody as used herein is intended to include intact molecules as well as fragments thereof, such as Fab or F(ab') 2 fragments, which are capable of binding the epitopic determinant.
  • Confirmation of MAT1 specificity among antibodies of the invention can be accomplished using routine screening techniques known to be suitable for the determination for the elementary reaction pattern of the antibody of interest, such as the enzyme-linked immunosorbent assay (ELISA). For example, it is possible to evaluate the specificity of an antibody of interest without undue experimentation in a competitive binding assay. Such an assay is useful for determining whether the antibody being tested prevents an anti-MAT1 antibody of the invention from binding to MAT1. If the antibody being tested competes with the antibody of the invention, as shown by a decrease in MAT1 binding by the antibody of the invention, then it is likely that the (monoclonal) antibodies bind to the same or a closely related epitope.
  • ELISA enzyme-linked immunosorbent assay
  • the invention is further intended to include chimeric antibodies of the MAT1 -specific antibodies described above, or biologically active fragments thereof.
  • chimeric antibody refers to an antibody in which the variable regions of the antibodies derived from one species are combined with the constant regions of antibodies derived from a different species, or alternatively refers to CDR grafted antibodies.
  • Chimeric antibodies are constructed by recombinant DNA technology.
  • methods of producing chimeric humanized antibody molecules are known in the art and include combining murine variable regions with human constant regions, or by grafting the murine antibody complementary regions (CDRs) onto the human framework.
  • CDRs are defined as the amino acid sequences on the light and heavy chains of an antibody which form the three- dimensional loop structure that contributes to the formation of the antigen binding site. Any of the above described antibodies or biologically active fragments can be used to generated chimeric and CDR grafted antibodies.
  • the invention also encompasses cell Iines (including hybridomas and transfectomas) which produce monoclonal antibodies of the invention.
  • the isolation of cell Iines producing monoclonal antibodies of the invention can be accomplished using routine screening techniques which permit determination of the elelmentary reaction pattern of the monoclonal antibody of interest.
  • Using the monoclonal antibodies of the invention it is possible to produce anti-idiotypic antibodies which can be used e.g. to screen monoclonal antibodies to identify whether the antibody has the same binding specificity as a monoclonal antibody of the invention. These antibodies can also be used for immunization purposes.
  • anti-MAT1 antibodies may be used diagnostically, e.g. to detect MAT1 expression in a biological cell or tissue sample or to monitor the level of its expression.
  • a suitable cell sample is derived from skin biopsies, sputum specimens, or urinary specimens. Cells may be obtained from any convenient source, such as skin, blood or hair follicles.
  • anti-MAT1 antibodies are useful for detection of the CAK complex, e.g. by co-immunoprecipitation. MAT1 may be detected and/or bound using anti-MAT1 antibodies in either liquid or solid phase immunoassay formats (i.e.
  • immunoassays when bound to a carrier).
  • carriers for use in solid-phase assay formats include glass, polystyrene, polypropylene, polyethylene, dextran, nylon, celluloses, poly ⁇ acrylamides, agaroses and magnetite.
  • Examplary types of immunoassays which can utilized monoclonal antibodies of the invention are competitive and non-competitive immunoassays in either a direct or indirect format. Specific examples of such immunoassays include the radioimmunoassay (RIA) and the sandwich (immunometric) assay.
  • the anti-MAT1 antibodies of the invention may be unlabeled or detectably labelled. There are many different lables and methods of labeling known to those of skill in the art.
  • Examples of the types of labels which can be used in the present invention include enzymes, radioisotopes, fluorescent compounds, colloidal metals, chemiluminescent compounds, and bioluminescent compounds.
  • Another labeling technique which may result in greater sensitivity consists of coupling the antibodies of the invention to low molecular weight haptens, such as biotin. These haptens can then be specifically labeled by means of a second reaction.
  • the anti-MAT1 antibodies of the invention may also be useful for in vivo diagnosis, such as to identify a site of aberrant cell proliferation, altered transcription or impaired (reduced) DNA repair, or to monitor a particular therapy.
  • the detectably labeled monoclonal antibody is given in a dose which is diagnostically effective, meaning that the amount of detectably labelled anti-MAT1 antibody is administered in sufficient quantity to enable detection of the site having cells which (over)express MAT1.
  • This invention further covers a nucleic acid (DNA, RNA) comprising an isolated, preferably recombinant, nucleic acid (DNA, RNA) coding for a protein of the invention, or a fragment of such a nucleic acid.
  • these nucleic acids are useful as probes, thus e.g. readily enabling those skilled in the art to identify and/or isolate nucleic acid encoding MAT1.
  • the nucleic acid may be unlabeled or labeled with a detectable moiety.
  • nucleic acid according to the invention is useful e.g. in a method for determining the presence of MAT1 , said method comprising hybridizing the DNA (or RNA) encoding (or complementary to) MAT1 to test sample nucleic acid and to determine the presence of MAT1.
  • Isolated MAT1 nucleic acid embraces such nucleic acid in ordinarily MAT1 expressing cells where the nucleic acid is in a chromosomal location different from that of natural cells or is otherwise flanked by a different DNA sequence than that found in nature.
  • the invention provides an isolated DNA molecule encoding a MAT1 protein of the invention, or a fragment of such DNA.
  • a DNA comprises a coding single-stranded DNA, a double-stranded DNA consisting of said coding DNA and complementary DNA thereto, or this complementary (single stranded) DNA itself.
  • Preferred is a DNA coding for the above captioned preferred MAT1 , e.g.
  • the invention relates to a DNA comprising a DNA coding for the above captioned preferred MAT1 , or a fragment thereof, e.g. the DNA with the nucleotide sequence set forth in SEQ ID NO:1 , or a fragment thereof.
  • nucleic acid sequences provided herein may be employed to identify DNAs encoding MAT1 amino acid variants, particulariy allelic or interspecies variants.
  • a method for identifying such DNA comprises contacting metazoan, particularly mammalian DNA with a nucleic acid probe described above and identifying DNA(s) which hybridize to said probe.
  • Exemplary nucleic acids of the invention can altematively be characterized as those nucleic acids which encode a protein of the invention and hybridize to the DNA having the sequence set forth in SEQ ID NO: 1 , or a selected portion (fragment) of said DNA.
  • Preferred are such DNA molecules encoding a protein of the invention which hybridize under stringent conditions to the above-mentioned DNAs.
  • Stringency of hybridization refers to conditions under which polynucleic acids hybrids are stable. Such conditions are evident to those of ordinary skill in the field. As known to those of skill in the art, the stability of hybrids is reflected in the melting temperature (T m ) of the hybrid which decreases approximately 1 to 1.5°C with every 1 % decrease in sequence homology. In general, the stability of a hybrid is a function of sodium ion concentration and temperature. Typically, the hybridization reaction is performed under conditions of higher stringency, followed by washes of varying stringency.
  • nucleic acids of the invention are obtainable according to methods well known in the art.
  • the present invention further relates to a process for the preparation of such nucleic acids.
  • a DNA of the invention is obtainable by chemical synthesis, by recombinant DNA technology or by polymerase chain reaction (PCR). Preparation by recombinant DNA technology may involve screening a suitable cDNA or genomic library.
  • a suitable method for preparing a DNA or of the invention may e.g. comprise the synthesis of a number of oligonucleotides, their use for amplification of DNA by PCR methods, and their splicing to give the desired DNA sequence.
  • Suitable libraries are commercially available, e.g. the libraries employed in the Examples, or can be prepared from tissue samples.
  • a DNA or RNA comprising substantially the entire coding region of MAT1 , or a suitable oligonucleotide probe based on said DNA.
  • a suitable oligonucleotide probe (for screening involving hybridization) is a single stranded DNA or RNA that has a sequence of nucleotides that includes at least about 20 to about 30 contiguous bases that are the same as (or complementary to) any about 20 or more contiguous bases of the nucleic acid sequence set forth in SEQ ID NO:1.
  • the nucleic acid sequences selected as probes should be of sufficient length and sufficiently unambiguous so that false positive results are minimized.
  • nucleic acid probes of the invention are labeled with suitable label means, e.g. a chemical moiety, for ready detection upon hybridization.
  • suitable label means is a radiolabel.
  • the preferred method of labelling a DNA fragment is by inco ⁇ orating ⁇ P-labeled ⁇ -dATP with the Klenow fragment of DNA polymerase in a random priming reaction, as is well known in the art.
  • Oligonucleotides are usually end-labeled with ⁇ P-labeled ⁇ -ATP and polynucleotide kinase.
  • other methods e.g. non-radioactive
  • a suitable library e.g. with a portion of DNA including substantially the entire MAT1 -encoding sequence or a suitable oligonucleotide based on a portion of said DNA
  • positive clones are identified by detecting a hybridization signal; the identified clones are characterized by restriction enzyme mapping and/or DNA sequence analysis, and then examined, e.g. by comparison with the sequences set forth herein, to ascertain whether they include DNA encoding a complete MAT1 (i.e., if they include translation initiation and termination codons). If the selected clones are incomplete, they may be used to rescreen the same or a different library to obtain overlapping clones.
  • the overlapping clones may include exons and introns. If the library is a cDNA library, then the overlapping clones will include an open reading frame. In both instances, complete clones may be identified by comparison with the DNAs and deduced amino acid sequences provided herein.
  • nucleotide sequences of the invention may be earned out using nucleotide sequences of the invention as hybridization probes. Also, based on the nucleic acid sequences provided herein antisense-type therapeutic agents may be designed.
  • nucleic acid of the invention can be readily modified by nucleotide substitution, nucleotide deletion, nucleotide insertion or inversion of a nucleotide stretch, and any combination thereof.
  • modified sequences can be used to produce mutant MAT1s which differ from the proteins found in nature. Mutagenesis may be predetermined (site-specific) or random. A mutation which is not a silent mutation must not place sequences out of reading frames and preferably will not create complementary regions that could hybridize to produce secondary mRNA structures such as loops or hai ⁇ ins.
  • the cDNA or genomic DNA encoding native or mutant MAT1 of the invention can be inco ⁇ orated into vectors for further manipulation.
  • the invention concerns a recombinant DNA which is a hybrid vector comprising at least one of the above mentioned DNAs.
  • the hybrid vectors of the invention comprise an origin of replication or an autonomously replicating sequence, one or more dominant marker sequences and, optionally, expression control sequences, signal sequences and additional restriction sites.
  • the hybrid vector of the invention comprises an above described nucleic acid insert operably linked to an expression control sequence, in particular those described hereinafter.
  • Vectors typically perform two functions in collaboration with compatible host cells. One function is to facilitate the cloning of the nucleic acid that encodes a MAT1 protein of the invention, i.e. to produce usable quantities of the nucleic acid (cloning vectors). The other function is to provide for replication and expression of the gene constructs in a suitable host, either by maintenance as an extrachromosomal element or by integration into the host chromosome (expression vectors).
  • a cloning vector comprises the DNAs as described above, an origin of replication or an autonomously replicating sequence, selectable marker sequences, and optionally, signal sequences and additional restriction sites.
  • An expression vector additionally comprises expression control sequences essential for the transcription and translation of the DNA of the invention.
  • an expression vector refers to a recombinant DNA construct, such as a plasmid, a phage, recombinant virus or other vector that, upon introduction into a suitable host cell, results in expression of the cloned DNA.
  • a recombinant DNA construct such as a plasmid, a phage, recombinant virus or other vector that, upon introduction into a suitable host cell, results in expression of the cloned DNA.
  • Suitable expression vectors are well known in the art and include those that are replicable in eukaryotic and/or prokaryotic cells.
  • Most expression vectors are capable of replication in at least one class of organisms but can be transfected into another organism for expression.
  • a vector is cloned in E. coli and then the same vector is transfected into yeast or mammalian cells even though it is not capable of replicating independently of the host cell chromosome.
  • DNA may also be amplified by insertion into the host genome.
  • the recovery of genomic DNA encoding MAT1 is more complex than that of exogenousiy replicated vector because restriction enzyme digestion is required to excise MAT1 DNA.
  • DNA can be amplified by PCR and be directly transfected into the host cells without any replication component.
  • expression and cloning vector contain a selection gene also referred to as selectable marker.
  • This gene encodes a protein necessary for the survival or growth of transformed host cells grown in a selective culture medium. Host cells not transformed with the vector containing the selection gene will not survive in the culture medium.
  • Typical selection genes encode proteins that confer resistance to antibiotics and other toxins, e.g. ampicillin, neomycin, methotrexate or tetracycline, complement auxotrophic deficiencies, or supply critical nutrients not available from complex media.
  • E. coli genetic marker and an E. coli origin of replication are advantageously included. These can be obtained from E. coli plasmids, such as pBR322, Bluescript vector or a pUC plasmid.
  • Suitable selectable markers for mammalian cells are those that enable the identification of cells competent to take up MAT1 nucleic acid, such as dihydrofolate reductase (DHFR, methotrexate resistance), thymidine kinase, or genes confering resistance to G418 or hygromycin.
  • DHFR dihydrofolate reductase
  • thymidine kinase thymidine kinase
  • genes confering resistance to G418 or hygromycin confering resistance to G418 or hygromycin.
  • the mammalian cell transfectants are placed under selection pressure which only those transfectants are uniquely adapted to survive which have taken up and are expressing the marker.
  • Expression and cloning vectors usually contain a promoter that is recognized by the host organism and is operably linked to MAT1 nucleic acid. Such promoter may be inducible or constitutive.
  • the promoters are operably linked to DNA encoding MAT1 by removing the promoter from the source DNA by restriction enzyme digestion and inserting the isolated promoter sequence into the vector.
  • Both the native MAT1 promoter sequence and many heterologous promoters may be used to direct amplification and/or expression of MAT1 DNA. However, heterologous promoters are preferred, because they generally allow for greater transcription and higher yields of expressed MAT1 as compared to native MAT1 promoter.
  • Promoters suitable for use with prokaryotic hosts include, for example, the ⁇ -lactamase and lactose promoter systems, alkaline phosphatase, a tryptophan (t ⁇ ) promoter system and hybrid promoters such as the tac promoter. Their nucleotide sequences have been published, thereby enabling the skilled worker operably to ligate them to DNA encoding MAT1 , using linkers or adaptors to supply any required restriction sites. Promoters for use in bacterial systems will also generally contain a Shine-Delgamo sequence operably linked to the DNA encoding MAT1.
  • MAT1 gene transcription from vectors in mammalian host cells may be controlled by promoters compatible with the host cell systems, e.g. promoters derived from the genomes of viruses.
  • Transcription of a DNA encoding a protein according to the invention by higher eukaryotes may be increased by inserting an enhancer sequence into the vector.
  • the various DNA segments of the vector DNA are operatively linked, i.e. they are contiguous and placed into a functional relationship to each other employing conventional ligation techniques.
  • Isolated plasmids or DNA fragments are cleaved, tailored, and religated in the form desired to generate the plasmids required.
  • analysis to confirm correct sequences in the constructed plasmids is performed in a manner known in the art. Suitable methods for constructing expression vectors, preparing in vitro transcripts, introducing DNA into host cells, and performing analyses for assessing MAT1 expression and function are known to those skilled in the art.
  • Gene presence, amplification and/or expression may be measured in a sample directly, for example, by conventional Southern blotting, northern blotting to quantitate the transcription of mRNA, dot blotting (DNA or RNA analysis), in situ hybridization, using an appropriately labelled probe based on a sequence provided herein, binding assays, immunodetection and functional assays. Those skilled in the art will readily envisage how these methods may be modified, if desired.
  • the invention further provides host cells capable of producing a MAT1 protein of the invention and including heterologous (foreign) DNA encoding said protein.
  • nucleic acids of the invention can be expressed in a wide variety of host cells, e.g. those mentioned above, that are transformed or transfected with an appropriate expression vector.
  • a protein of the invention may also be expressed as a fusion protein. Recombinant cells can then be cultured under conditions whereby the protein (s) encoded by the DNA of the invention is (are) expressed.
  • Suitable prokaryotes include eubacteria, such as Gram-negative or Gram-prositive organisms, such as E. coli, e.g. E. coli K-12 strains, DH5 ⁇ and HB 101, or Bacilli.
  • Further host cells suitable for MAT1 encoding vectors include eukaryotic microbes such as filamentous fungi or yeast, e.g. Saccharomyces cerevisiae. Higher eukaryotic cells include insect, amphebian and vertebrate cells. In recent years propagation of vertebrate cells in culture (tissue culture) has become a routine procedure.
  • the host cells referred to in this application comprise cells in culture as well as cells that are within a host animal. DNA may be stably inco ⁇ orated into the cells or may be transiently expressed according to conventional methods.
  • Stably transfected mammalian cells may be prepared by transfecting cells with an expression vector having a selectable marker gene, and growing the transfected cells under conditions selective for cells expressing the marker gene.
  • mammalian cells are transfected with a reporter gene to monitor transfection efficiency.
  • the cells should be transfected with a sufficient amount of MAT1 -encoding nucleic acid to form MAT1 of the invention.
  • the precise amounts of DNA encoding MAT1 of the invention may be empirically determined and optimized for a particular cell and assay.
  • a DNA of the invention may also be expressed in non-human transgenic animals, particulariy transgenic warm-blooded animals. Methods for producing transgenic animals, including mice, rats, rabbits, sheep and pigs, are known in the art and are disclosed, for example by Hammer et al. ((1985) Nature 315, 680-683).
  • An expression unit including a DNA of the invention coding for a MAT1 together with appropriately positioned expression control sequences, is introduced into pronuciei of fertilized eggs. Introduction may be achieved, e.g. by microinjection. Integration of the injected DNA is detected, e.g. by blot analysis of DNA from suitable tissue samples. It is preferred that the introduced DNA be inco ⁇ orated into the germ line of the animal so that it is passed to the animal's progeny.
  • a knock-out animal may be developed by introducing a mutation in the MAT1 sequence, thereby generating an animal which does not express the functional MAT1 gene anymore.
  • Such knock-out animal is useful e.g. for studying the role of the MAT1 or the MAT1/cyclin H/CDK7 complex in metabolism, but in particular for providing a mammalian animal model with a suitable genetic background for introducing and expressing transgenes encoding the homologous human MAT1.
  • Expression of human counte ⁇ art MAT1 on a homologous gene knock-out background has the unique advantage of excluding differences in efficacies of drugs on a given protein (in this case MAT1) caused by species- specific sequence differences in said protein.
  • Host cells are transfected or transformed with the above-captioned expression or cloning vectors of this invention and cultured in conventional nutrient media modified as appropriate for inducing promoters, selecting transformants, or amplifying the genes encoding the desired sequences.
  • Heterologous DNA may be introduced into host cells by any method known in the art, such as transfection with a vector encoding a heterologous DNA by the calcium phosphate coprecipitation technique, by electroporation or by lipofectin-mediated. Numerous methods of transfection are known to the skilled worker in the field. Successful transfection is generally recognized when any indication of the operation of this vector occurs in the host cell. Transformation is achieved using standard techniques appropriate to the particular host cells used (see, e.g. Sambrook et al. (1989) Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor Laboratory Press).
  • DNA provided herein may be expressed in any suitable host cell, e.g. those referred to above, preferred for expression of DNA encoding functional MAT1 are eukaryotic expression systems, particularly mammalian expression systems, including commercially available systems and other systems known to those of skill in the art.
  • the present invention provides a method for identifying compounds capable of binding to MAT1 , said method comprising employing a protein of the invention in a binding assay.
  • a binding assay may be useful for identification of a MAT1 ligand including a novel endogenous ligand.
  • a binding assay according to the invention involves exposure of a protein of the invention, e.g. the MAT1 of SEQ ID NO:2, to a ligand candidate under conditions and for a time sufficient to allow binding of said potential ligand to said protein of the invention, and determining qualitatively and/or quantitatively, whether binding has occurred, e.g. by detecting the complex formed between the ligand and the protein of the invention.
  • binding assay may further comprise cyclin H and/or CDK7.
  • Binding of a ligand to the protein of the invention may be analyzed according to conventional methods, e.g. methods suitable for detecting the association of proteins, such as electrophoresis or immunoanalytical methods, e.g. immunoprecipitation with an anti-MAT1 antibody.
  • a preferred binding assay is a competitive binding assay.
  • the principle underlying a competitive binding assay is generally known in the art. Briefly, such a binding assay is performed by allowing a compound to be tested for its capability to compete with a known, suitably labeled ligand for the binding site at a target molecule, i.e. a protein of the invention.
  • a suitably labeled ligand is e.g. a radioactively labeled ligand or a ligand which can be detected by its optical properties, such as absorbance or fluorescence. After removing unbound ligand and test compound the amount of labeled ligand bound to the protein of the invention is measured.
  • the amount of bound labeled ligand is reduced in the presence of the test compound, said compound is found to bind to the target molecule, i.e. the protein of the invention.
  • Compounds binding to the target protein of the invention may modulate a functional property of MAT1 and may thereby be identified as an agonist or antagonist in a functional assay.
  • a competitive binding assay may be performed e.g. with transformed or transfected host cells expressing the protein of the invention, or with a soluble or immobilized protein of the invention.Also, such assay may be performed in the presence of CDK7 and cyclin H.
  • the present invention relates to a functional assay, which is suitable for detection of a change of a physical-chemical property of MAT1 , such as conformation, and binding affinity for associatable molecules.
  • a functional response is the result of the interaction of the compound to be tested with MAT1 , and may affect e.g. the phosphory ⁇ lation status or activity of another protein influenced by MAT1 within a cell expressing functional MAT1 (as compared to a negative control).
  • a functional assay which is suitable for detection of a change of a physical-chemical property of MAT1 , such as conformation, and binding affinity for associatable molecules.
  • Such functional response is the result of the interaction of the compound to be tested with MAT1 , and may affect e.g. the phosphory ⁇ lation status or activity of another protein influenced by MAT1 within a cell expressing functional MAT1 (as compared to a negative control).
  • the present invention also provides a method suitable for identifying a component or agent which modulates the biological activity of MAT1 , said method comprising contacting MAT1 of SEQ ID NO:2, or another suitable protein of the invention, with at least one compound or agent, whode ability to modulate the activity of MAT1 is sought to be investigated, and determining the change of MAT1 acitivity of said protein coused by said component or agent.
  • the method enables identification of stimulatory or inhibitory components of MAT1 activity.
  • An assay is then designed to measure a functional property of MAT1.
  • MAT1 is intended to include MAT1 in association with other macromolecules it is naturally associated with, particularly a CAK complex comprising a protein of the invention, CDK7 and cyclin H.
  • a functional assay is a CAK complex comprising the MAT1 of SEQ ID NO:2, cyclin H and CDK7.
  • a component or agent which modulates the activity of MAT1 refers to a compound or signal that is capable of altering the response pathway mediated by functionally active MAT1 within a cell (as compared to the absence of MAT1).
  • a component or agent which modulates the activity of the CAK complex refers to a compound or signal that is capable of altering the response pathway mediated by the functionally active CAK complex within a cell (as compared to the absence of a functionally active complex).
  • Modulation of MAT activity particularly refers to modulation of its ability to act as an assembly factor in the formation of a CAK complex.
  • Modulation of CAK activity particulariy refers to modulation of one or more of the following properties of the CAK complex: ligand (substrate) binding affinity and/or kinetics, catalytic activity (CAK- or CTD-activity), the ability to regulate cell cycle progression, DNA repair and transcription. Methods for determining a change in any of these properties are well-known in the art.
  • a change in the ability of MAT1 to act as assembly factor may be determined using the methods described herein. More specifically, the effect of a particular compound or signal on the interaction of MAT1 with CDK7/cyclin H may be determined in an assay suitable for determining the affinity and or rate of binding of MAT1 to the CDK7/cyclin H complex.
  • MAT1 and cyclin H/CDK7 are (co-) expressed in an appropriate expression system, such as yeast, E. £pJi, insect cells or mammalian cells transformed with suitable expression vectors.
  • the proteins in question may be expressed in baculovirus-infected insect cells, either separately or jointly. The proteins are recovered from the cells, and in enriched or purified form, e.g.
  • the host cells may be metabolically labeled, e.g. [ ⁇ Sj-labeled.
  • the antagonist associates with MAT1 , this inhibition will correlate with the association between the antagonist and MAT1 , as detectable e.g. by immunoprecipitation.
  • Modulation of the CAK complex associated kinase activity may be assessed by analyzing phosphorylation of a suitable substrates, e.g. by employing a protein kinase assay as decribed hereinbefore.
  • cell cycle progression may be analyzed, e.g. in mammalian, particularly human cells, according to methods known in the art, e.g. as described by Tassan, J.P. et al. ((1994), J. Cell Biology 127, 467-478).
  • cells particularly human cells, such asHeLa cells, containing recombinant MAT1 encoding nucleic acid, and, optionally, recombinant cyclin H- and CDK7-encoding nucleic acid are synchronized, e.g. by centifugal elutriation or using drug arrest-release protocols (see e.g. Krek, W. & Nigg, E.A. (1991) EMBO J. 10, 305-31 ; O'Connor, P.M. & Jackman, J. in "Cell Cycle - Material and Methods” (1995), ed. M. Pagano, Springer Verlag, Berlin, Heidelberg, New York).
  • drug arrest-release protocols see e.g. Krek, W. & Nigg, E.A. (1991) EMBO J. 10, 305-31 ; O'Connor, P.M. & Jackman, J. in "Cell Cycle - Material and Methods” (1995), ed. M. Pagano, Spring
  • the interaction with the transcription apparatus or the ability to integrate cellular events with cell cycle progression may be analyzed using in vitro transcription systems or reporter assays involving e.g. chloramphenicol transferase (CAT) or luciferase in vivo.
  • CAT chloramphenicol transferase
  • luciferase in vivo.
  • Assay methods generally require comparison to various controls. A change in MAT1 activity is said to be induced by a test compound if such an effect does not occur in the absence of the test compound.
  • MAT1 of SEQ ID NO:2, or another protein of the invention may be used in a soluble, immobilized or cellular form. If used in an immobilized form, the protein of the invention is attached to a solid support. To obtain a cellular form of the protein of the invention, it is produced by a suitably transformed host cell which is employed in the assay.
  • the protein of the invention is a recombinant protein.
  • cyclin H or CDK7 may be present in a soluble, immobilized or cellular form, with the provision that they are available in a form allowing formation of an active CAK complex. Cellular cyclin H or CDK7 may be homologous or heterologous to the producing cell.
  • heterologous cyclin H or CDK7 cells are transformed with a suitable expression vector.
  • the protein of the invention, cyclin H and CDK7 may be produced by (coupled) jn vitro transcription-translation, e.g. using a system as described in the Examples.
  • the protein of the invention, cyclin H and CDK7 are obtained from the same species, e.g. an assay of the invention employing human MAT1 further comprises human cyclin H and human CDK7.
  • the assays of the invention may be useful to identify compounds or signals which are capable of acting as therapeutic agents in a mammal in need thereof, which are effective against a disease or disorder caused by a decrease or increase of cellular MAT1 activity.
  • the assays described herein render possible e.g. identification of cell growth inhibitors, which may be suitable as therapeutic agents against hype ⁇ roliferative disorders, such as benign and malignant tumors, and psioriasis, e.g. components which are capable of affecting progression of the cell cyclus.
  • compounds identified by a method according to the invention may be therapeutically effective in diseases which are caused by inappropriate transcription or dysfunctional DNA repair.
  • the assays provided herein will enable identification and design of MAT1 -specific compounds, particulariy molecules specifically binding to MAT1 (MAT1 -ligands).
  • Host cells expressing a nucleic acid coding for a protein of the invention are e.g. useful for drug screening, and the present invention encompasses a method for identifying a compound or signal which modulates the biological activity of MAT1 , said method comprising exposing cells containing heterologous DNA encoding a suitable protein of the invention, wherein said cells produce functionally active MAT1 , to at least one compound or signal, whose ability to modulate the activity of said MAT1 is sought to be determined, and thereafter monitoring said cells for changes caused by said modulation.
  • the invention covers an assay for identifying compounds which modulate the activity of MAT1 , said assay comprising:
  • Preferred such cells are suitably manipulated mammalian cells, particularly human cells, such as HeLa cells, which express MAT1, and optionally cyclin H and CDK7.
  • Cells producing functionally active CAK complex may be employed for the identification of compounds, particularly low molecular weight molecules including oligopeptides capable of acting as agonists or antagonists of MAT1 , and which are bioavailable in vitro and in vivo.
  • an agonist is understood to refer to a molecule that is capable of mimicking the action of MAT1, e.g. that is capable of interacting with CDK7/cyclin H.
  • an agonist is capable of increasing or decreasing a measurable parameter within the host cell as does natural MAT1 increase or decrease said parameter.
  • an agonist is e.g. capable of associating with cyclin H/CDK7, resulting in the formation of a ternary complex having CAK- and CTD activity.
  • a preferred method for detecting a MAT1 agonist comprises the steps of (a) exposing a protein of the invention coupled to a CAK response pathway, under conditions and for a time sufficient to allow interaction of the compound with the protein of the invention and an associated response through the pathway, and (b) detecting an increase or decrease in the stimulation of the response pathway resulting from the interaction of the compound with the protein of the invention, relative to the absence of the tested compound and therefrom determining the presence of a MAT1 agonist.
  • MAT1 antagonizing molecules are useful.
  • an antagonist is capable of counteracting or neutralizing the action of MAT1.
  • an antagonist is capable of interacting with CDK7/cyclin H, but does not stimulate a CAK- complex mediated response pathway within the cell.
  • MAT1 antagonists are generally identified by their ability to interact with CDK7/cyclin H by interfering with the binding of MAT1.
  • a preferred method for identifying a MAT1 antagonist comprises the steps of (a) exposing a compound in the presence of a suitable protein of the invention, e.g. MAT1 of SEQ ID NO:2 or the deletional mutant ⁇ , to CDK7/cyclin H coupled to a CAK complex mediated response pathway, under conditions and for a time sufficient to allow interaction of all components and an associated response through the pathway, and (b) detecting an inhibition of the stimulation of the response pathway induced by CAK, said inhibition resulting from the interaction of the compound with the protein of the invention or with CDK7/cyclin H relative to the stimulation of the response pathway by the protein of the invention alone and therefrom determining the presence of a MAT1 antagonist. Inhibition may be detected, e.g. if the test compound competes with the protein of the invention.
  • Compounds which may be screened utilizing such method include blocking antibodies specifically binding to a protein of the invention.
  • conditions and times sufficient for interaction of an agonist or antagonist with MAT1 may vary with the source and purity of MAT1 , however, conditions generally suitable for interaction occur between about 4°C and about 40°C, preferably between about 4°C and about 37°C, in a buffer solution containing between 0 and 2 M NaCl, preferably between 0.1 and 0.9 M NaCl, and within a pH range of between 5 and 9, preferably between 6.5 and 8. Sufficient time for the binding and response will generally be between about 15 min and about 24 h after exposure.
  • the buffer solution comprises magnesium ions (Mg 2+ ), added e.g.
  • a magnesium salt such as magnesium acetate or magnesium nitrate
  • calcium ions Ca 2+
  • Suitable conditions are e.g. those existing in a commercially available reticulocyte lysate, such as the lysates used in the Examples.
  • the present invention also relates to a method of inhibiting CAK complex associated-activity in a cell, comprising introducing into said cell an agent which inhibits the binding of MAT1 to cyclin H/CDK7.
  • agent may e.g. be selected from the group consisting of an oligonucleotide which binds nucleic acid encoding MAT1 , thereby inhibiting e.g. expression of MAT1 ; an antibody which specifically binds MAT1 , and a compound which inactivates MAT1 in such a way that formation of the ternary CAK complex is prevented, e.g. by binding to or degrading MAT1.
  • the invention particularly relates to the specific embodiments (e.g. the proteins, nucleic acids, methods for the preparation, assays and uses thereof) as described in the Examples which serve to illustrate the present invention, but should not be construed as a limitation thereof.
  • lysates are incubated with immunoglobulin-protein A G-Sepharose beads (prepared as described below) for 2h at 4°C on a rotating wheel. Immune complexes are washed four times with RIPA buffer, twice with PBS, and, if suitable, once with kinase assay buffer (50 mM Tris-HCl, pH 7.5, 10 mM MgCI 2 , 1 mM DTT).
  • Western blotting is performed as described previously (Krek.W. and Nigg.E.A. (1991) EMBOJ., 10, 3331-3341 ; Maridor.G. et al., (1993) J. Cell Sci., 106, 535-544), using enhanced chemoluminescence (ECL) (Amersham) for detection of immunoreactive proteins.
  • ECL enhanced chemoluminescence
  • Indirect immunofluorescence microscopy is performed according to Tassan,J.-P., et al. (1994) J. Cell Biol., 127, 467-468.
  • lysine 41 (for CDK7 amino acid sequence and numbering, see Tassan et al., supra, p. 470, Figure 1) is substituted by arginine, using the TransformerTM Site-Directed Mutagenesis Kit (Clontech), as described by the manufacturer.
  • Amino-terminally myc epitope tagged CDK7 is contructed in the eukaryotic expression plasmid pRc/CMV (Invitrogen, San Diego, CA).
  • the protein produced by this plasmid contains the peptide Met Glu Gin Lys He Ser Glu Glu Asp Leu Asn Met Asn Phe fused in frame to the initiator Met of CDK7; thus, the anti-myc epitope mAb 9E10 (Evan.G.I. et al., (1985) Mol. Cell. Biol., 5, 3610-3616) can be used for its detection.
  • Example 1 Purification and Microsequencing of MAT1
  • HeLa cells are grown on 15-cm tissue culture dishes and lysed in RIPA buffer containing both protease and phosphatase inhibitors (supra). Protein complexes containing CDK7 are then immunoprecipitated by incubation of lysates for2h at
  • MO-1.1 immunoglobulin which is a murine monoclonal anti-CDK7 antibody, (T?ssan et al., supra) covalently attached to protein G sepharose beads with dimethyl pir.ielimidate (Harlow.E. and Lane.D. ( 1988).
  • Antibodies a laboratory manual, U.S.A., Cold Spring Ha ⁇ or Laboratory). After washing with RIPA and PBS, immune complexes are released from the beads by boiling in 3 % SDS, 5 % ⁇ -mercaptoethanol, 5 mM Tris-HCl, pH
  • Proteins are concentrated by precipitation for 1 hour at -70°C with 7 volumes of acetone, and pellets are resuspended in 3 x gel sample buffer.
  • 100-200 pMol of the MAT1 polypeptide coprecipitating with CDK7 (referred to as p32 in Tassan et al., supra) are separated on a mini-SDS gel (10 % acrylamide, 1.5 mm thickness) and visualized by negative staining as described by Ortiz, M.L. et al. ((1992) FEBS Lett., 296, 300-304).
  • Example 2 Cloning and sequencing of human MAT1 cDNA.
  • oligonucleotides are designed on the basis of two peptide sequences obtained by microsequence analysis (peptides a and b, infra).
  • a 25mer peptide in the following referred to as peptide b with the amino acid sequence extending from aa 123 to aa 147 in SEQ ID NO:1 is used to design two PCR primers corresponding to its N- and C-terminal sequences (GlulleTyrGlnGluAsn. aa 123 to 129, and ThrArgGluGlnGluGlu, aa 141 to 146, respectively).
  • oligonucleotides for RT-PCR on HeLa polyA + RNA, as described by Schultz.S.J. and Nigg.E.A. ((1993) Cell Growth and Diff. , 4, 821-830), a 72 bp cDNA, having the sequence extending from bp 416 to 487 in SEQ ID NO:1 , encoding peptide b is isolated. Subsequently, a homologous oligonucleotide corresponding to the internal sequence LysAspVallleGlnLys in peptide a (infra) is synthesized.
  • the isolated cDNA codes for a 309 amino acid protein with a calculated molecular weight of 36 kDa.
  • the protein herein termed MAT1
  • MAT1 is somewhat larger than estimated previously (32 kD) on the basis of its gel electrophoretic mobility (Tassan et al., 1994, supra).
  • the nucleotide sequence of the cloned cDNA as well as the deduced amino acid sequence of MAT1 are shown in SEQ ID NOs.1 and 2.
  • the complete sequences are also available from the EMBL database (Accession No. X87843). Independently, two partial sequences derived from genome sequencing projects have been deposited (Accession Nos. T71380 and Z44069).
  • the two peptide sequences a and b (Example 1) determined from the purified protein are encoded by this cDNA, confirming that it codes for the third subunit of CAK.
  • Database searches uncover no extensive similiarities between MAT1 and known proteins, but they reveal the presence of a C3HC4 putative zinc binding domain in the N-terminus (aa 6 to aa 48 in SEQ ID NO:2).
  • This particular zinc finger motif is frequently referred to as a RING finger (from the human ringl gene; Freemont, P.S. et al., (1991) Cell, 64, 483-484).
  • the nucleotide sequence shown in SEQ ID NO:1 does not predict an in-frame stop codon upstream of the putative translation initiator AUG.
  • the cDNA of SEQ ID NO:1 comprises cDNA coding for the entire 36 kD CAK subunit.
  • sequence context surrounding the proposed initiator AUG matches perfectly the consensus determined for efficient translational initiation (Kozak,M. (1989) J. Cell Biol., 108, 229-241).
  • SDS-PAGE reveals precise comigration between the 36 kD protein synthesized from the cloned cDNA in vitro and the third subunit co-immunoprecipitating with CDK7/cyclin H from HeLa cells.
  • Example 3 Mutant lacking the N-terminal ring domain .MAT1 ⁇ 1
  • the N-terminal RING finger can be deleted by excising an Ncol to Bglll fragment encompassing the RING domain (extending from bp 48 to 664 in SEQ ID NO:1) and be replaced by a PCR fragment extending from glycine in position 50 (Gly50) of SEQ ID NO:1 to the Bglll site of MAT1 (aa 207/208 in SEQ ID NO:1).
  • the latter PCR fragment is amplified using the PCR primer GATGCCATGGGTACTCCACTCAGAA (bp 10 to 25 of said primer correspond to bp 197 to 212 in SEQ ID NO:2) introducing an Ncol site upstream of Gly50.
  • MAT1 ⁇ codes for a polypeptide corresponding to the fusion of the initiator codon with the sequence C terminal to Gly50 starting with threonine at position 51 in SEQ ID NO:1.
  • MAT1 ⁇ lacking the RING domain is used to determine whether the RING finger of MAT1 might be required for the formation of the ternary complex with CDK7 and cyclin H.
  • the mutant is tested for its ability to reconstitute an active CAK complex, following translation of the individual components in a rabbit reticulocyte lysate (cf. Example 6).
  • MAT1 ⁇ is as efficient in forming a ternary complex as is the wild-type MAT1 , indicating that the presence of the RING finger is not required for the association of MAT1 with CDK7 and cyclin H. Also, the RING finger of MAT1 is not necessary for conferring CAK activity to CDK7. These results indicate that the RING finger of MAT1 remains available for promoting interactions of the ternary complex with other molecules.
  • the RING domain may play a role in mediating protein-protein (or protein-lipid) interactions, since no binding of MAT1 to either single-stranded or double-stranded DNA may be detected using MAT1 alone or MAT1 reconstituted within a CAK complex.
  • a cDNA spanning the entire coding sequence of MAT1 is cloned into the plasmid pGEX-KG (Guan.K. and Dixon.J.E. (1991) Anal. Biochem., 192, 262-267), and the GST-MAT1 fusion protein, as obtained using a QIAGEN kit and following the instruction of the manufacturer, is expressed in E.coli strain BL21 (DE3).
  • the expressed protein is highly insoluble and is therefore solubilized under denaturing conditions, before being renatured and subjected to purification (Guan.K. and Dixon.J.E., supra).
  • D-thiogalactopyranoside (0.1 mM). After centrifugation, cells are resuspended and lysed in 15 ml of 50 mM Tris-HCl pH 7.5, 2 mM EDTA, 1 mM DTT, 1 mM PMSF, 10 ⁇ g/ml leupeptin, 10 ⁇ g/ml pepstatin, 10 ⁇ g ml aprotinin and 2 mg/ml lysozyme. The lysate is sonicated and centrifuged at 10,000 g for 15 min.
  • the pellet is resuspended in 2.5 ml of 0.1 M Tris-HCl, pH 8.5, containing 6 M urea, and the sample is centrifuged again for 15 min. Then, the supernatant is diluted 1 :10 with 50 mM KH 2 PO 4 (pH 10.7), 1 mM EDTA (pH 8.0), 50 mM NaCI and incubated at room temperature for 30 min. During this incubation, the pH of the solution is maintained at 10.7. Subsequently, the pH is adjusted to 8.0 and the incubation is continued for 30 min at room temperature. Finally, insoluble material is removed by centrifugation at 10,000 g for 15 min. Renaturated, soluble GST-MAT1 protein is affinity- purified on a glutathione-Sepharose 4B column.
  • Recombinant GST-MAT1 protein purified from bacterial inclusion bodies, is used to raise both polyclonal (rabbit) and monoclonal (mouse) antibodies.
  • rabbits are immunized with the bacterially expressed GST-MAT1 fusion protein obtained according to Example 4 and anti-MAT1 immunoglobulins are affinity-purified according to standard methods (Tassan et al., supra; Hariow and Lane, supra).
  • Intramuscular injections are carried out every four weeks with 280 ⁇ g of recombinant MAT1 in 8 M urea, 0.1 M NaH 2 PO 4 , 10 mM Tris-HCl, pH 4.5 emulsified in Freud's adjuvant.
  • Anti-MAT1 antibodies are capable of immunoprecipitating the ternary CAK complex comprising CDK7, MAT1 and cyclin H from reticulocyte lysates programmed with mRNAs encoding the three subunits or HeLa cells (see Example 6).
  • Anti-MAT1 antibodies are affinity purified as follows: purified recombinant MAT1 is subjected to SDS-PAGE, blotted on a nitrocellulose membrane, and a nitrocellulose strip containing the MAT1 protein is excised. After incubation with anti-MAT1 serum, this strip is extensively washed with 0.1 M glycine, pH 2.5, neutralized with an equal volume of 1 M tris- HCl, pH 8.0, and stored at 4°C.
  • affinity-purified rabbit immunoglobulins or hybridoma supernatants are incubated for 2h at 4°C with protein A or protein G-Sepharose, repsectively, equilibrated in 0.5 M Tris-HCl, pH 7.5.
  • Immunoglobulin-protein A/G-sepharose beads are washed with phosphate buffered saline (PBS: 137mM NaCl, 2.7 mM KCl, 8.1 mM Na 2 HPO , 1.5 mM KH 2 HPO 4 ; pH 7.2) and stored at 4°C.
  • PBS phosphate buffered saline
  • Example 7 In vitro association experiments.
  • reticulocyte lysates containing the desired proteins (MAT1 ,
  • CDK7 or cyclin H are mixed, incubated for 1 hour at 30°C and an aliquot of each sample is analyzed directly by SDS-PAGE and fluorography.
  • samples are diluted 1:10 in NP40 buffer (50 mM Tris, pH 8.0, 150 mM NaCl, 1 % NP40, 0.1 % deoxycholate, 0.01 % SDS, 1 mM PMSF, and 10 ⁇ g/ml each of leupeptin, aprotinin, and pepstatin) and incubated for 2 hours at 4°C with anti-CDK7 or anti-myc antibodies.
  • NP40 buffer 50 mM Tris, pH 8.0, 150 mM NaCl, 1 % NP40, 0.1 % deoxycholate, 0.01 % SDS, 1 mM PMSF, and 10 ⁇ g/ml each of leupeptin, aprotinin, and pepstatin
  • Immune complexes are isolated and then subjected to SDS-PAGE and fluorography, as described previously (Krek,W. and Nigg.E.A. (1991) EMBOJ., 10, 3331-3341, Tassan et al., 1994, supra).
  • the three proteins are produced separately by coupled transcription-translation in a rabbit reticulocyte lysate ( Figure 1A, wherein MAT1 is referred to as p36). Equal amounts of protein are mixed as indicated and incubated long enough to allow protein-protein interactions to occur. One aliquot of each sample is then subjected to an SDS-PAGE and autoradiography ( Figure 1 A, upper panel), whereas the remainder of the sample is subjected to immunoprecipitation with anti-CDK7 antibodies.
  • FIG. 1B A GST-MAT1 fusion protein (referred to as GST-p36 in Figure 1B) is expressed in E.coli (Example 4). and increasing amounts of the purified protein are added to reticulocyte lysates containing equal and constant amounts of [ 35 S]-labeled CDK7 and cyclin H. Samples are then incubated for one hour at 30°C and CDK7 is isolated by immunoprecipitation. As expected, equal amounts of CDK7 are immunoprecipitated from all lysates ( Figure 1B).
  • CAK is reconstituted from purified GST-MAT1 and from in vitro translated CDK7 and cyclin H, as described above. Then, CAK activity is measured as a function of GST- MAT1 levels, using amounts of GST-MAT1 up to 10 fold higher than those required for maximal formation of the ternary complex. No evidence is obtained for inhibition of CAK activity by MAT1 at any concentration tested. Also, addition of large amounts of GST-MAT1 to CDK7 immunoprecipitates prepared from HeLa cells does not affect CAK activity. These results provide no indication that MAT1 can function as an inhibitor of CDK7/cyclin H- associated CAK activity.
  • Example 8 Subcellular Localization and Cell Cycle Expression of MAT1 Subcellular localization: When used for immunoblotting, the antibodies raised against the GST-MAT1 fusion protein (Example 5) recognize endogenous MAT1 in total HeLa cell protein extracts as well as MAT1 proteins translated in a reticulocyte lysate (Example 5). The immunoreactive protein present in HeLa cells comigrates with in vitro translated wild ⁇ type MAT1 , whereas the MAT1 mutant lacking the N-terminal RING domain (MAT1 ⁇ , Example 3) displays the expected enhanced electrophoretic mobility. As determined by indirect immunofluorescence microscopy, MAT1 is predominantly nuclear in all inte ⁇ hase cells, whilst it is diffusely distributed throughout the cell during mitosis, showing no obvious association with condensed chromosomes.
  • Cell cycle expression of MAT1 To determine the expression levels of MAT1 during the cell cycle, HeLa cells are synchronized at various stages of the cell cycle. Cells are either arrested at the G1/S phase boundary using a thymidine/aphidicolin double block or in mitosis (prometaphase) using nocodazole. Then, cells are released from the blocks for various lengths of time (2, 4, 6, 8 and 10 h for the thymidine/aphidicoline block; 3, 9, 18, 21 and 24 h for the nocodozale block). Aliquots of cells are used for FACS* analyses to determine the proportions of cells at different stages in the cell cycle. In parallel, for each sample, the amount of MAT1 recovered is determined by immunoblotting with anti-MAT36 antibodies (Example 5). The results show that the level of MAT1 is virtually constant throughout the cell cycle.
  • CAK The activity of CAK is assayed as described previously (Tassan, J.-P et al., (1994) J. Cell Biol. , 127, 467-468) using immunoprecipitates or reticulocyte lysates comprising the CDK7/cyclin H/MAT1 complex.
  • Kinase assays are carried out in a total volume of 50 ⁇ l of kinase assay buffer (50 mM Tris-HCl, pH 7.5, 10 mM MgCI 2 , 1 mM DTT), supplemented with 4 mM ATP, 10 ⁇ Ci of [ ⁇ -32P]ATP (Amersham) and 400 ⁇ g/ml of purified GST-CDK2 protein (prepared as described by Tassan et al., supra) as a substrate. After 30 min at 32°C, the reaction is stopped with 50 ⁇ l of 3x gel sample buffer (see e.g. Rickwood, D.
  • CDK7 is isolated from HeLa cells, using either anti- MAT1 or anti-CDK7 antibodies for immunoprecipitation.
  • MAT1 and CDK7 immunoprecipitates contain CTD kinase as well as CAK activities. No phosphorylation of GST alone can be detected and no significant kinase activities are seen in control immunoprecipitates prepared with pre-immune sera.
  • CDK7/cyclinH/MAT1 complexes are reconstituted in a reticulocyte lysate, using myc-eptiope tagged versions of either wild ⁇ type CDK7 or the catalytically inactive K41 R mutant.
  • kinase activities are monitored using both GST-CDK2 and GST-CTD as substrates.
  • kinase assays are alos performed using immunoprecipitates prepared from lysates that have not been primed with mRNA.
  • Reconstituted complexes containing wild-type CDK7 readily phosphorylate both GST-CDK2 and GST-CTD, whereas only background activities are associated with complexes containing the K41 R mutant CDK7.
  • Figure 1 p36 is required for CDK7/cyclin H association in a dose-dependent manner.
  • FIG. 1A CDK7 or myc-tagged CDK7, cyclin H and p36 (hereinbefore referred to as
  • MAT1 reticulocyte lysates and mixed as indicated. After incubation at 30°C for one hour to allow protein association, an aliquot is analysed by SDS-PAGE and autoradiography (total IVT). The remaining samples are subjected to immunoprecipitation with either anti-CDK7 (lanes 1-7) or anti-myc tag antibodies (lanes 8 and 9). Immunoprecipitates are divided in two. One half is analysed by electrophoresis in a polyacrylamide gel followed by autoradiography (IP). The second half of the immunoprecipitate is assayed for CAK activity on the GST-CDK2 fusion protein (CAK activity).
  • IP autoradiography
  • Figure 1 B Reticulocyte lysates containing equal and constant amounts of [ 35 S]-labeled CDK7 and cyclin H are mixed with increasing quantities of purified GST-p36 expressed in E.coli. Lysates are then incubated with anti-CDK7 antibodies and immune complexes are analysed by fluorography after separation of the proteins by SDS-PAGE.
  • GTC AGA GCT GCC TCA CCA CAG GAC CTT GCT GGA GGC TAT ACT TCT TCT 919 Val Arg Ala Ala Ser Pro Gin Asp Leu Ala Gly Gly Tyr Thr Ser Ser 275 280 285 290
  • CAG CCC AGT TAACCATTTA TAAGAT TGG ACCTTGGAGC TGAACCAGGG 1016

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Toxicology (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

Cette invention a trait à une protéine essentielle pour la formation d'une kinase cyclino-dépendante (CDK)/complexe à base de cycline, à des dérivés de cette protéine, à des anticorps spécifiques de cette protéine ainsi qu'à des moyens et techniques de sa production. Cette invention, qui porte également sur des acides nucléiques codant la protéine selon l'invention, sur une technique d'obtention de ces molécules d'acide nucléique et sur leur expression, concerne, de surcroît, l'utilisation de ces protéines et acides nucléiques.
PCT/IB1995/001024 1995-09-29 1995-11-20 Proteine annulaire a doigt WO1997012971A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU38139/95A AU3813995A (en) 1995-09-29 1995-11-20 Ring finger protein

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
PCT/IB1995/000810 WO1997012900A2 (fr) 1995-09-29 1995-09-29 Proteine annulaire a doigt
CHPCT/IB95/00810 1995-09-29

Publications (1)

Publication Number Publication Date
WO1997012971A1 true WO1997012971A1 (fr) 1997-04-10

Family

ID=11004372

Family Applications (2)

Application Number Title Priority Date Filing Date
PCT/IB1995/000810 WO1997012900A2 (fr) 1995-09-29 1995-09-29 Proteine annulaire a doigt
PCT/IB1995/001024 WO1997012971A1 (fr) 1995-09-29 1995-11-20 Proteine annulaire a doigt

Family Applications Before (1)

Application Number Title Priority Date Filing Date
PCT/IB1995/000810 WO1997012900A2 (fr) 1995-09-29 1995-09-29 Proteine annulaire a doigt

Country Status (2)

Country Link
AU (2) AU3483795A (fr)
WO (2) WO1997012900A2 (fr)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001049737A1 (fr) * 1999-12-29 2001-07-12 Fudan University Nouveau polypeptide, latexine proteine humaine 46, et polynucleotide codant pour ce polypeptide
WO2006076442A2 (fr) * 2005-01-14 2006-07-20 Janssen Pharmaceutica N.V. Derives de triazolopyrimidine
WO2013059471A1 (fr) * 2011-10-18 2013-04-25 Children's Hospital Los Angeles Compositions et méthodes pour traiter la leucémie

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1995018824A1 (fr) * 1994-01-07 1995-07-13 Sloan-Kettering Institute For Cancer Research PROTEINE p27 ISOLEE ET MOLECULES D'ACIDE NUCLEIQUE CODANT CETTE PROTEINE

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1995018824A1 (fr) * 1994-01-07 1995-07-13 Sloan-Kettering Institute For Cancer Research PROTEINE p27 ISOLEE ET MOLECULES D'ACIDE NUCLEIQUE CODANT CETTE PROTEINE

Non-Patent Citations (8)

* Cited by examiner, † Cited by third party
Title
DEVAULT, ALAIN ET AL: "MAT1 ('menage a trois') a new RING finger protein subunit stabilizing cyclin H - cdk7 complexes in starfish and Xenopus CAK", EMBO J. (1995), 14(20), 5027-36 CODEN: EMJODG;ISSN: 0261-4189, XP002004330 *
FISHER R.P ET AL.: "A novel cyclin associates with MO15/CDK7 to form the CDK-activating kinase", CELL, vol. 78, no. 4, 1994, pages 713 - 724, XP002004328 *
FISHER, ROBERT P. ET AL: "Alternative mechanisms of CAK assembly require an assembly factor or an activating kinase", CELL (CAMBRIDGE, MASS.) (1995), 83(1), 47-57 CODEN: CELLB5;ISSN: 0092-8674, XP002004331 *
MORGAN DO: "Principles of CDK regulation", NATURE, vol. 374, March 1995 (1995-03-01), pages 131 - 134, XP000571581 *
SOLOMON MJ,: "The functions of CAK, the p34 cdc 2 -activating kinase", TRENDS BIOCHEM SCI, vol. 19, 1994, pages 496 - 500, XP000571594 *
TASSAN, JEAN-PIERRE ET AL: "Cell cycle analysis of the activity, subcellular localization, and subunit composition of human CAK (CDK-activating kinase)", J. CELL BIOL. (1994), 127(2), 467-78 CODEN: JCLBA3;ISSN: 0021-9525, XP000571273 *
TASSAN, JEAN-PIERRE ET AL: "In vitro assembly of a functional human CDK7 - cyclin H complex requires MAT1, a novel 36 kDa RING finger protein", EMBO J. (1995), 14(22), 5608-17 CODEN: EMJODG;ISSN: 0261-4189, XP002004329 *
YEE, ANN ET AL: "Molecular cloning of CDK7 -associated human MAT1, a cyclin-dependent kinase-activating kinase (CAK) assembly factor", CANCER RES. (1995), 55(24), 6058-62 CODEN: CNREA8;ISSN: 0008-5472, XP000571289 *

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001049737A1 (fr) * 1999-12-29 2001-07-12 Fudan University Nouveau polypeptide, latexine proteine humaine 46, et polynucleotide codant pour ce polypeptide
WO2006076442A2 (fr) * 2005-01-14 2006-07-20 Janssen Pharmaceutica N.V. Derives de triazolopyrimidine
WO2006076442A3 (fr) * 2005-01-14 2007-08-23 Janssen Pharmaceutica Nv Derives de triazolopyrimidine
US7563781B2 (en) 2005-01-14 2009-07-21 Janssen Pharmaceutica Nv Triazolopyrimidine derivatives
WO2013059471A1 (fr) * 2011-10-18 2013-04-25 Children's Hospital Los Angeles Compositions et méthodes pour traiter la leucémie

Also Published As

Publication number Publication date
AU3813995A (en) 1997-04-28
WO1997012900A3 (fr) 1997-05-15
AU3483795A (en) 1997-04-28
WO1997012900A2 (fr) 1997-04-10

Similar Documents

Publication Publication Date Title
Just et al. Glucosylation of Rho proteins by Clostridium difficile toxin B
JP3561268B2 (ja) レセプターチロシンキナーゼ標的タンパク質のｃＤＮＡクローニング方法及びｈＧＲＢタンパク質
US5767075A (en) Inhibiting protein interactions
US6171781B1 (en) NF-AT polypeptides and polynucleotides
JP3091769B2 (ja) プロテインキナーゼ
US5858679A (en) Method for determining the presence of functional p53 by measuring GADD45 protein expression
US5744313A (en) Assay employing novel protein domain which binds tyrosine phosphorylated proteins
US6586577B2 (en) Telomere repeat binding factors and diagnostic and therapeutic use thereof
US6476193B1 (en) NLK1 protein and NLK1 protein complexes
US6472197B1 (en) GRB2 associating polypeptides and nucleic acids encoding therefor
WO1998037196A1 (fr) Parg, proteine d'activation de gtpase exerçant une interaction avec ptpl1
WO1997019101A9 (fr) Nouveaux polypeptides s'associant a la proteine grb2 et acides nucleiques les codant
US6660837B1 (en) Modified protein derived from protein kinase N
WO1997012971A1 (fr) Proteine annulaire a doigt
CA2236154A1 (fr) Nouvel isoforme creba
US6307035B1 (en) BRCA1 associated polynucleotide (BAP-1) and uses therefor
JP2003523723A (ja) ヘルマンスキー−パドラック症候群タンパク質相互作用タンパク質およびその使用の方法
WO1997009432A1 (fr) Kinase cyclinodependante
JP2002525035A (ja) 新規なリボゾームｓ６プロテインキナーゼの同定および機能的なキャラクタライゼーション
US20050037446A1 (en) Agents that recognize src when phosphorylated at serine 17
US20030087387A1 (en) Human toll homologues
KR100460227B1 (ko) Ｓｒｃ-타입 타이로신 키나제와 결합하는 신규한 어댑터단백질, ＬＡＳＴ 및 그의 유전자
WO2001051509A2 (fr) Proteine 140 associee a shc (sap-140)
WO2002046219A2 (fr) Proteines d'activation de rho-gtpase et procedes correspondants
US20030087386A1 (en) Human toll homologue

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AL AM AU BB BG BR BY CA CN CZ EE FI GE HU IS JP KG KP KR KZ LK LR LT LV MD MG MK MN MX NO NZ PL RO RU SG SI SK TJ TM TT UA US UZ VN

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): KE LS MW SD SZ UG AT BE CH DE DK ES FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN ML MR NE SN TD TG

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
121 Ep: the epo has been informed by wipo that ep was designated in this application
122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: CA