WO2002026809A1 - Nouveau polypeptide, proteine transmembranaire 35.31 possedant un domaine permettant la duplication de facteurs de croissance epidermique, et polynucleotide codant ce polypeptide - Google Patents

Nouveau polypeptide, proteine transmembranaire 35.31 possedant un domaine permettant la duplication de facteurs de croissance epidermique, et polynucleotide codant ce polypeptide Download PDF

Info

Publication number
WO2002026809A1
WO2002026809A1 PCT/CN2001/001255 CN0101255W WO0226809A1 WO 2002026809 A1 WO2002026809 A1 WO 2002026809A1 CN 0101255 W CN0101255 W CN 0101255W WO 0226809 A1 WO0226809 A1 WO 0226809A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
polynucleotide
growth factor
epidermal growth
transmembrane protein
Prior art date
Application number
PCT/CN2001/001255
Other languages
English (en)
Chinese (zh)
Inventor
Yumin Mao
Yi Xie
Original Assignee
Shanghai Biowindow Gene Development Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shanghai Biowindow Gene Development Inc. filed Critical Shanghai Biowindow Gene Development Inc.
Priority to AU2002220451A priority Critical patent/AU2002220451A1/en
Publication of WO2002026809A1 publication Critical patent/WO2002026809A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy

Definitions

  • the present invention belongs to the field of biotechnology. Specifically, the present invention describes a novel polypeptide, a transmembrane protein 35. 31 having an epidermal growth factor-like repeating functional domain, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and polypeptide.
  • the adrenal cortex is composed of three ring bands ZG, ZF, and ZR.
  • ZG band cells secrete aldosterone.
  • Mammalian ZR band cells secrete glucocorticoids and androgens.
  • Aldosterone is catalyzed by P450 (a ldo), which is aldosterone synthetase.
  • P450 (a ldo) is aldosterone synthetase.
  • the last step of hormone and mineralocorticoid synthesis requires cytochrome P450 (11 ⁇ ), which is catalyzed by the steroid 11 ⁇ -hydroxylase family.
  • the P450 (a ldo) I P450 (11 ⁇ ) gene is controlled by different signal paths in different bands. These three bands are differentiated from a single stem cell.
  • the ZG band is divided into two layers.
  • the first layer is a cell-less layer, which is located under the capsule and expresses Pref-1 protein and cytochrome P450 aldosterone synthase, which has long mitochondria.
  • the second layer is located below the first layer and expresses only the Pref-1 protein. Its mitochondria are small and polymorphic.
  • the envelope is above the tufted zone, and there is a layer of cells below the second cell layer.
  • Pref-1 protein-positive cells and Pref-1 protein-negative cells Pref-1 protein-positive cells and Pref-1 protein-negative cells.
  • Pref-1 information in the ZG band is quite stable under the influence of pituitary hormones. Information has various pituitary-adrenal axis activities in the adrenal glands, but is relatively stable in a single cell. When the adrenal glands are excised and subsequently regenerated, the Pref-1 transcript is severely suppressed at an early stage. At this time, only a small number of cortical cells express the Pref-1 protein, and most cells express cluster / reticulate-specific markers.
  • Pref-1 may play an important role in the cellular determination of the adrenal and / or adrenocortical hormone bands [Endocrinology, 1998, 139 (7): 3316-3328].
  • the novel polypeptide of the present invention has 39% homology and 53% similarity with known transmembrane protein constituents at the protein level, and has similar structural characteristics with it, so it is considered to be a new Human transmembrane protein component, named transmembrane protein 35. 31 with epidermal growth factor-like repeating functional domains, and has similar biological functions to known proteins, and may be in cells of the adrenal and / or adrenal cortex hormone bands Play an important role in the decision. If it is overexpressed, it will inhibit muscle cell differentiation and affect mammalian nervous system development. If its EFG-like repeat domain is mutated, it will lead to disease symptoms such as dementia. In addition, it also plays a role in the diagnosis and treatment of related diseases.
  • the transmembrane protein 35.31 with epidermal growth factor-like repeating domains plays an important role in regulating important functions of the body such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes. There has been a need to identify more of the epidermal growth factor-like repeating domain transmembrane protein 35.31 proteins involved in these processes, and in particular the amino acid sequence of this protein.
  • New transmembrane protein with epidermal growth factor-like repetitive domains 35. The isolation of the 31-coding protein gene also provides the basis for research to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so it is important to isolate its coding DNA.
  • Another object of the invention is to provide a polynucleotide encoding the polypeptide.
  • Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding a transmembrane protein 35. 31 having an epidermal growth factor-like repeat domain.
  • Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding a transmembrane protein 35. 31 with an epidermal growth factor-like repeat domain.
  • Another object of the present invention is to provide a method for producing a transmembrane protein 35. 31 having an epidermal growth factor-like repeating domain.
  • Another object of the present invention is to provide an antibody against the polypeptide of the present invention, a transmembrane protein 35. 31 having an epidermal growth factor-like repeating domain.
  • Another object of the present invention is to provide mimetic compounds, antagonists, agonists, and inhibitors of the polypeptide of the present invention, a transmembrane protein 35. 31 with an epidermal growth factor-like repeating domain.
  • Another object of the present invention is to provide a method for diagnosing and treating diseases related to the abnormality of the transmembrane protein 35.31 having an epidermal growth factor-like repeat domain. Summary of invention
  • the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
  • the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
  • sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 384-1349 in SEQ ID NO: 1; and (b) a sequence having 1-1571 in SEQ ID NO: 1 Sequence of bits.
  • the present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
  • the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
  • the present invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of a transmembrane protein 35.31 protein with an epidermal growth factor-like repeating functional domain, which comprises using a polypeptide of the present invention.
  • the invention also relates to compounds obtained by this method.
  • the present invention also relates to a method for in vitro detection of a disease or disease susceptibility related to abnormal expression of a transmembrane protein 35.31 protein with a repeating domain similar to epidermal growth factor, which comprises detecting the polypeptide or a polynucleoside encoded therein in a biological sample. Mutations in the acid sequence, or the amount or biological activity of a polypeptide of the invention in a biological sample.
  • the invention also relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
  • the present invention also relates to the polypeptides and / or polynucleotides of the present invention in the preparation for the treatment of cancer, developmental disease or immune disease or other transmembrane protein 35. 31 caused by abnormal expression of epidermal growth factor-like repeating domains. Use of medicine for disease.
  • FIG. 1 is a comparison diagram of amino acid sequence homology of a transmembrane protein 35. 31 with an epidermal growth factor-like repeating domain of the present invention and a transmembrane protein with an epidermal growth factor-like repeating domain.
  • the upper sequence is a transmembrane protein with an epidermal growth factor-like repeat domain 35.
  • 31, and the lower sequence is a transmembrane protein with an epidermal growth factor-like repeat domain.
  • Identical amino acids are represented by single-character amino acids between the two sequences, and similar amino acids are represented by.
  • Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of an isolated transmembrane protein 35. 31 with an epidermal growth factor-like repeat domain. 35. 31kDa is the molecular weight of the protein. The arrows indicate the separated protein bands.
  • Nucleic acid sequence refers to oligonucleotides, nucleotides or polynucleotides and fragments or parts thereof, and may also refer to the genome or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
  • amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
  • amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
  • a “variant" of a protein or polynucleotide refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it.
  • the changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence.
  • Variants can have "conservative" changes, in which the amino acid substituted has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine.
  • Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
  • “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
  • Insertion means that a change in the amino acid sequence or nucleotide sequence results in an increase in one or more amino acids or nucleotides compared to a molecule that exists in nature.
  • Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
  • Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
  • immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response and to bind specific antibodies in a suitable animal or cell.
  • Antagonist refers to transmembrane protein 35.31 when repetitive domains similar to epidermal growth factor At the same time, a molecule that can cause the protein to change, thereby regulating the activity of the protein.
  • An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that can bind to a transmembrane protein 35.31 with an epidermal growth factor-like repeating domain.
  • Antagonist refers to a transmembrane protein 35 that blocks or regulates epidermal growth factor-like repeating domains when combined with 35.31. 31 Biologically or immunologically active molecules. Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates, or any other molecule that can bind to a transmembrane protein 35. 31 with an epidermal growth factor-like repeating domain.
  • Regular refers to a change in the function of a transmembrane protein 35.31 with an epidermal growth factor-like repeating functional domain, including an increase or decrease in protein activity, a change in binding properties, and a transmembrane with an epidermal growth factor-like repeating functional domain Alteration of any other biological, functional or immune properties of protein 35.31.
  • Substantially pure ' means substantially free of other proteins, lipids, carbohydrates or other substances with which it is naturally associated.
  • Those skilled in the art can use standard protein purification techniques to purify epidermal growth factor-like repeating functional domains.
  • Transmembrane protein 35. 31. Essentially pure transmembrane protein 35. 31 with epidermal growth factor-like repeating functional domains can produce a single main band on non-reducing polyacrylamide gels.
  • Epidermal growth factor-like repeating functions The purity of the transmembrane protein 35. 31 of the domain can be analyzed by amino acid sequence.
  • Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
  • sequence C-T-G-A
  • complementary sequence G-A-C-T.
  • the complementarity between two single-stranded molecules may be partial or complete.
  • the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
  • “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
  • Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Southern imprinting or Northern blotting, etc.) under conditions of reduced stringency. Substantially homologous sequences or hybridization probes can compete and inhibit the binding of fully homologous sequences to target sequences under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.
  • Percent identity refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALIGN program (Lasergene sof tware package, DNASTAR, Inc., Madi son Wis.). The MEGALIGN program can compare two or more sequences (Higgins, DG and PM Sharp (1988) Gene 73: 237-244). The Clus ter method arranges groups of sequences into clusters by checking the distance between all pairs. The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula:
  • Similarity refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
  • Amino acids used for conservative substitution for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
  • Antisense refers to a nucleotide sequence that is complementary to a particular DM or RNA sequence.
  • Antisense strand refers to a nucleic acid strand that is complementary to a “sense strand.”
  • Derivative refers to HFP or a chemical modification of its nucleic acid. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
  • Antibody refers to a complete antibody molecule and its fragments, such as Fa,? ( ⁇ ) 2 and? It can specifically bind to the epitope of epidermal growth factor-like repeating domain transmembrane protein 35.31.
  • a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
  • isolated refers to the removal of a substance from its original environment (for example, its natural environment if it is naturally occurring).
  • a naturally-occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
  • Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not part of its natural environment, they are still isolated.
  • isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
  • polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances in the natural state .
  • isolated epidermal growth factor-like repeat domain transmembrane protein 35. 31 It refers to a transmembrane protein with epidermal growth factor-like repetitive domains. 35. 31 is essentially free of other proteins, lipids, sugars, or other substances that are naturally associated with it. Those skilled in the art can use standard protein purification techniques to purify transmembrane protein 35. 31 with epidermal growth factor-like repeat domains. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of the transmembrane protein 35. 31 polypeptide having an epidermal growth factor-like repeat domain can be analyzed by amino acid sequence.
  • the present invention provides a novel polypeptide, a transmembrane protein 35. 31 with an epidermal growth factor-like repeating functional domain, which basically consists of the amino acid sequence shown in SEQ ID NO: 2.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
  • the polypeptides of the present invention may be naturally purified products or chemically synthesized products, or produced using recombinant techniques from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants: insects and mammalian cells).
  • polypeptide of the invention may be glycosylated, or it may be non-glycosylated.
  • the polypeptides of the invention may also include or exclude the initial methionine residue.
  • the invention also includes fragments, derivatives and analogs of transmembrane protein 35.31 with epidermal growth factor-like repeat domains.
  • fragment refers to a transmembrane protein 35.31 having the same biological function or activity as the epidermal growth factor-like repeating functional domain of the present invention. Peptide.
  • a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a type in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution
  • the amino acid may or may not be encoded by a genetic codon; or ( ⁇ ) a type in which a group on one or more amino acid residues is replaced by another group to include a substituent; or ( ⁇ ⁇ )
  • Such a polypeptide sequence in which the mature polypeptide is fused with another compound such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol
  • a polypeptide sequence in which an additional amino acid sequence is fused into the mature polypeptide (Such as the leader or secretory sequence or the sequence used to purify the polypeptide or protease sequence).
  • such fragments, derivatives and analogs are considered to be within the knowledge of those skilled in the art.
  • the invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
  • the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a polynucleotide sequence with a total length of 1571 bases, and its open reading frame 384-1349 encodes 321 amino acids.
  • the polynucleotide of the present invention may be in the form of DM or RNA.
  • DNA forms include cDNA, genomic DNA, or synthetic DM.
  • DNA can be single-stranded or double-stranded.
  • DNA can be coding or non-coding.
  • the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
  • a "degenerate variant” refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
  • the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
  • polynucleotide encoding a polypeptide refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.
  • the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
  • Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
  • an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
  • the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity, between the two sequences).
  • the present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions.
  • "strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1 DS, 6 (TC; or (2) hybridization Add denaturing agents, such as 50 ° / ((v / v) formamide, 0.1% calf serum / 0.1.
  • hybridization occurs when the identity between at least 95% and more preferably 97%.
  • polypeptide encoded by the hybridizable polynucleotide has the same biological function as the mature polypeptide shown in SEQ ID NO: 2 And active.
  • nucleic acid fragments that hybridize to the sequences described above.
  • a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 nuclei. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques (such as PCR) to identify and / or isolate polynucleotides encoding transmembrane protein 35. 31 with epidermal growth factor-like repeat domains.
  • polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
  • the specific encoding of the transmembrane protein 35. 31 with epidermal growth factor-like repeat domains of the present invention Polynucleotide sequences can be obtained in a variety of ways. For example, polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or CDM libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
  • the DM fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the DM of the genome; 2) chemically synthesizing the DM sequence to obtain the double-stranded DNA of the polypeptide.
  • genomic DM is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences.
  • the standard method for isolating the cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDM library.
  • Various methods have been used to extract mRNA, and kits are also commercially available (Qiagene).
  • the construction of cDNA libraries is also a common method (Sarabrook, et al., Molecular Cloning, A Laboratory Manua, Cold Spruing Harbor Laboratory. New York, 1989).
  • Commercially available cDNA libraries are also available, such as different cDM libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
  • genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DM-DNA or DM-RNA hybridization; (2) the appearance or loss of marker gene function; (3) determination of transmembrane proteins with epidermal growth factor-like repeating domains 35. 31 transcript levels; (4) detection of gene expressed protein products by immunological techniques or determination of biological activity. The above methods can be used singly or in combination.
  • the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
  • the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
  • the probe used here is generally a DNA sequence chemically synthesized based on the gene sequence information of the present invention.
  • the genes or fragments of the present invention can of course be used as probes.
  • DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
  • transmembrane protein 35 31 genes with epidermal growth factor-like repetitive domains can be performed using immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) and so on.
  • immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) and so on.
  • a method (Sa iki, et al. Science 1985; 230: 1350-1354) using PCR technology to amplify DNA / RNA is preferably used to obtain the gene of the present invention.
  • the RACE method RACE-Rapid Amplification of cDNA Ends
  • the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein.
  • the amplified DNA / RM fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
  • polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. To obtain the full-length CDM sequence, sequencing needs to be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length CDM sequence.
  • the present invention also relates to a vector comprising the polynucleotide of the present invention, and a transmembrane protein of 35.31 coding sequence using the vector of the present invention or directly using epidermal growth factor-like repeating functional domains, and recombinant cells Technology A method of producing a polypeptide of the invention.
  • a polynucleotide sequence encoding a transmembrane protein 35. 31 with an epidermal growth factor-like repeat domain can be inserted into a vector to form a recombinant vector containing the polynucleotide of the present invention.
  • vector refers to bacterial plasmids, bacteriophages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
  • Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al.
  • any plasmid and vector can be used to construct a recombinant expression vector.
  • An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
  • Methods known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding transmembrane protein 35.31 with epidermal growth factor-like repeat domains and appropriate transcription / translation regulatory elements. These methods include in vitro recombinant DNA technology, DNA synthesis technology, in vivo recombination technology, etc. (Sambroook, et al. Molecular Cloning, a Laboratory Manua, Cold Sprue Harbor Laboratory. New York, 1989).
  • the DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis. Representative examples of these promoters are: the lac or trp promoter of E.
  • the expression vector also includes a ribosome binding site and a transcription terminator for translation initiation. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Examples include 100 to 270 base pair SV40 enhancers on the late side of the origin of replication, The polyoma enhancer and adenovirus enhancer on the late side of the starting point.
  • the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • GFP fluorescent protein
  • tetracycline or ampicillin resistance for E. coli.
  • a polynucleotide encoding a transmembrane protein 35. 31 with an epidermal growth factor-like repeating functional domain or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute the polynucleotide or the recombinant.
  • the term "host cell” refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E.
  • coli Streptomyces
  • bacterial cells such as Salmonella typhimurium
  • fungal cells such as yeast
  • plant cells insect cells
  • fly S2 or Sf 9 animal cells
  • animal cells such as CH0, COS or Bowes melanoma cells.
  • Transformation of a host cell with a DM sequence according to the present invention or a recombinant vector containing the DNA sequence can be performed by conventional techniques well known to those skilled in the art.
  • the host is a prokaryote such as E. coli
  • competent cells capable of DNA uptake can be in the exponential growth phase were harvested, treated with CaC l 2 method used in steps well known in the art. Alternatively, MgCl 2 is used.
  • transformation can also be performed by electroporation.
  • the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
  • the polynucleotide sequence of the present invention can be used to express or produce recombinant transmembrane protein with epidermal growth factor-like repeating domain 35. 31 (Sc ience, 1984; 224: 1431). Generally there are the following steps:
  • polynucleotide or variant encoding the transmembrane protein 35. 31 with a human epidermal growth factor-like repeat domain of the present invention, or a recombinant expression vector containing the polynucleotide for transformation or transduction is appropriate Host cell
  • the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
  • a suitable method such as temperature conversion or chemical induction
  • the recombinant polypeptide may be coated in a cell, or expressed on a cell membrane, or secreted Out of the cell.
  • recombinant proteins can be isolated and purified by various separation methods using their physical, chemical, and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
  • polypeptides of the present invention as well as antagonists, agonists and inhibitors of the polypeptides, can be directly used in the treatment of diseases, for example, they can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection, and immune diseases.
  • the adrenal cortex is composed of three ring bands ZG, ZF, and ZR.
  • ZG band cells secrete aldosterone.
  • Mammalian ZR band cells secrete glucocorticoids and androgens.
  • Aldosterone is catalyzed by P450 (aldo), which is aldosterone synthetase.
  • P450 (aldo) is aldosterone synthetase.
  • the last step of hormone and mineralocorticoid synthesis requires cytochrome P450 (11 ⁇ ), which is catalyzed by the steroid 11 ⁇ -hydroxylase family.
  • the P450 (a ldo) / P450 (11 ⁇ ) genes are controlled by different signal paths in different bands. These three bands are differentiated from a single stem cell.
  • Z0G mouse ZG-specific clone
  • the protein encoded by Z0G consists of a C-terminal transmembrane domain, an N-terminal signal peptide, and 6 epidermal growth factor (EGF) -like repeats. Functional domains are composed of transmembrane proteins that can participate in the construction of the cytoplasmic backbone. It is homologous to mouse preadipocyte cytokine-1 (Pref-1).
  • the ZG band is divided into two layers. The first layer is a oligocellular layer, which is located under the envelope and expresses Pref-1 protein and cytochrome P450 aldosterone synthesis. An enzyme that has long mitochondria.
  • the second layer is located below the first layer and expresses only the Pref-1 protein. Its mitochondria are small and polymorphic.
  • the envelope is above the clump zone and there is a layer of cells below the second cell layer. It does not contain Pref-1, cytochrome P450 aldosterone synthase, and cytochrome P45011 ⁇ -hydroxylase. : Pref-1 protein-positive cells and Pref-1 protein-negative cells.
  • the Pref-1 information in the ZG band is quite stable under the influence of pituitary hormones. Information has various pituitary-adrenal axis activities in the adrenal glands, but is relatively stable in a single cell.
  • Pref-1 transcript When the adrenal glands are excised and subsequently regenerated, the Pref-1 transcript is severely suppressed at an early stage. At this time, only a small number of cortical cells express the Pref-1 protein, and most cells express cluster / reticulate-specific markers. Pref-1 may play an important role in the cellular decisions of the adrenal and / or adrenocortical hormone bands.
  • Transmembrane protein with epidermal growth factor-like repeat domain When the adrenal glands are excised and subsequently regenerated, the Pref-1 transcript is severely suppressed at an early stage. At this time, only a small number of cortical cells express the Pref-1 protein, and most cells express cluster / reticulate-specific markers. Pref-1 may play an important role in the cellular decisions of the adrenal and / or adrenocortical hormone bands.
  • the novel polypeptide of the present invention has 39% homology and 53% similarity, and has similar structural characteristics, so it is considered to be a new component of human transmembrane protein, and it is named as a peptide name It has similar biological functions with known proteins and may play an important role in the cellular decision of the adrenal gland and / or adrenocortical hormone bands. Overexpression can inhibit muscle cell differentiation and affect mammals Nervous system development, if its EFG-like repeat domain is mutated, it will lead to disease symptoms such as dementia. In addition, it also plays a role in the diagnosis and treatment of related diseases.
  • the adrenal cortex is composed of three ring bands ZG, ZF, ZR. ZG band cells secrete aldosterone.
  • Mammalian ZR band cells secrete glucocorticoids and androgens. Aldosterone is catalyzed by P450 (a ldo), which is aldosterone synthetase. The final step of hormone and mineralocorticoid synthesis requires cytochrome P450 (11 ⁇ ), which is catalyzed by the steroid 11 ⁇ -hydroxylase family. The P450 (a ldo) I P450 (11 ⁇ ) gene is controlled by different signal pathways in different bands. These three bands are differentiated from a single stem cell. Mammalian ZR zone cells are secreted.
  • the polypeptide of the present invention and a known ZG specific clone with an epidermal growth factor-like repeating functional domain are transmembrane proteins with an epidermal growth factor-like repeating functional domain and contain characteristic sequences of the epidermal growth factor family. Both have similar biological characteristics. Learn function. It is involved in the cell-determining role of the adrenal and / or adrenal corticosteroid bands in the body.
  • Adrenal cortex hormone-producing cells have different pituitary-adrenal axis activities and are of great significance for the secretion regulation of aldosterone, glucocorticoids, and androgens.
  • Glucocorticoids and androgens have effects on water and electrolyte metabolism, protein metabolism, lipid metabolism, and development. Its abnormal expression is usually closely related to disorders of mineralocorticoid metabolism, disorders of glucocorticoid metabolism, and disorders of androgen metabolism, and causes related diseases.
  • the abnormal expression of the transmembrane protein 35. 31 with epidermal growth factor-like repetitive domains of the present invention will produce various diseases, especially mineralocorticoid metabolism disorder, glucocorticoid metabolism disorder, androgen metabolism disorder. And developmental disorders, these diseases include but are not limited to:
  • Mineralocorticoid disorders Edema, hypertension, high / low blood sodium (headache, convulsions, coma), high / low blood potassium (muscle paralysis, arrhythmia, renal failure, paralytic intestinal obstruction, drowsiness, coma) Wait;
  • Glucocorticoid disorders high / low blood sugar, peptic ulcers, muscle wasting, osteoporosis, delayed wound healing, infections, centripetal obesity, water poisoning (headaches, convulsions, coma), mental disorders, etc .; Androgens: sexual dysplasia, virilization of women, anemia (stimulation of bone marrow hematopoiesis), tumor (prostate cancer, breast cancer), edema, hypertension, etc.
  • polypeptides of the present invention and antagonists, agonists and inhibitors of the polypeptides can be directly used in the treatment of diseases, for example, can treat various diseases, especially Mineralocorticoid metabolism disorder, glucocorticoid metabolism disorder, androgen metabolism disorder, development disorder, certain inflammations, immune diseases, etc.
  • the invention also provides screening compounds to identify epidermal growth-enhancing (agonist) or repressor (antagonist)
  • the long factor resembles the method of the repetitive domain of the transmembrane protein 35.
  • 31. Agonists enhance transmembrane proteins with epidermal growth factor-like repetitive domains 35. 31 Stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to cell proliferation, such as various cancers.
  • a mammalian cell or a membrane preparation expressing a transmembrane protein with an epidermal growth factor-like repeating domain 35.
  • 31 can be labeled with a transmembrane protein 35 with an epidermal growth factor-like repeating domain.
  • 31 — Start training. The ability of the drug to increase or block this interaction is then determined.
  • Antagonists of transmembrane protein 35. 31 with epidermal growth factor-like repeating domains include antibodies, compounds, receptor deletions, and the like that have been screened.
  • An antagonist of a transmembrane protein 35. 31 with an epidermal growth factor-like repeat domain can bind to and eliminate the function of a transmembrane protein 35. 31 with an epidermal growth factor-like repeat domain, or inhibit the production of the polypeptide, or It is the binding to the active site of the polypeptide that makes the polypeptide unable to perform biological functions.
  • transmembrane proteins with epidermal growth factor-like repeating functional domains 35. 31 can be added to bioanalytical assays by measuring compounds against transmembrane proteins with epidermal growth factor-like repeating domains 35. 31 and its receptors to determine if a compound is an antagonist. In the same manner as described above for screening compounds, receptor deletions and analogs that act as antagonists can be screened.
  • Polypeptide molecules capable of binding to transmembrane protein 35. 31 with repetitive domains similar to epidermal growth factor can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. When screening, the transmembrane protein 35. 31 molecules with epidermal growth factor-like repeat domains should generally be labeled.
  • the present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies.
  • the invention also provides antibodies directed against transmembrane protein 35.31 epitopes with epidermal growth factor-like repeat domains. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by Fab expression libraries.
  • Polyclonal antibodies can be produced using epidermal growth factor-like transmembrane proteins of repetitive domains 35. 31. They can be obtained by direct injection into animals (such as rabbits, mice, rats, etc.). A variety of adjuvants can be used to enhance the immune response. , Including but not limited to Freund's adjuvant. Techniques for preparing monoclonal antibodies with epidermal growth factor-like repeating domain transmembrane protein 35.31 include, but are not limited to, hybridoma technology (Kohler and Miste in. Nature, 1975, 256: 495-497), three tumors Technology, human B-cell hybridoma technology, EBV-hybridoma technology, etc.
  • Chimeric antibodies that bind human constant regions to non-human-derived variable regions can be produced using existing techniques (Morrison et al, PNAS, 1985, 81: 6851).
  • the existing technology for producing single chain antibodies ⁇ . S. Pat No. 4 6778
  • Antibodies against epidermal growth factor-like repetitive domain transmembrane proteins 35. 31 can be used in immunohistochemical techniques to detect transmembrane proteins with epidermal growth factor-like repetitive domains 35. 31 in biopsy specimens.
  • Monoclonal antibodies that bind to transmembrane protein 35. 31 with repetitive domains similar to epidermal growth factor can also be labeled with radioisotopes and injected into the body to track their location and distribution.
  • This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
  • Antibodies can also be used to design immunotoxins that target a particular part of the body. For example, transmembrane proteins with epidermal growth factor-like repeating domains. 35. 31 High-affinity monoclonal antibodies can covalently bind to bacterial or phytotoxins (such as diphtheria toxin, ricin, ormosine, etc.). A common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds. This hybrid antibody can be used to kill epidermal growth factor-like repeating functional domains. Transmembrane protein 35. 31 positive cells. .
  • the antibodies of the present invention can be used to treat or prevent diseases related to transmembrane protein 35. 31 with epidermal growth factor-like repeating domains. Administration of appropriate doses of antibodies can stimulate or block the production or activity of transmembrane protein 35.31 with epidermal growth factor-like repetitive domains.
  • the invention also relates to a diagnostic test method for quantitatively and locally detecting the level of transmembrane protein 35. 31 with epidermal growth factor-like repeating functional domains.
  • These tests are well known in the art and include FISH assays and radioimmunoassays.
  • the level of transmembrane protein 35. 31 with epidermal growth factor-like repeat domains detected in the test can be used to explain the importance of transmembrane protein 35. 31 with epidermal growth factor-like repeat domains in various diseases and It is used to diagnose diseases with epidermal growth factor-like repeating domain transmembrane protein 35.31.
  • polypeptide of the present invention can also be used for peptide mapping analysis.
  • the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
  • Polynucleotides encoding the transmembrane protein 35. 31 with epidermal growth factor-like repeat domains can also be used for a variety of therapeutic purposes.
  • Gene therapy technology can be used to treat abnormal cell proliferation, development, or metabolism caused by the non-expression or abnormal / inactive expression of transmembrane protein 35.31 with epidermal growth factor-like repetitive domains.
  • Recombinant gene therapy vectors (such as viral vectors) can be designed to express variant transmembrane proteins with epidermal growth factor-like repeat domains 35. 31 to inhibit endogenous transepidermal growth factor-like repeat domains Protein 35. 31 activity.
  • the recombinant gene therapy vector can be used to treat diseases caused by abnormal expression or activity of transmembrane protein 35.31 with epidermal growth factor-like repetitive domains.
  • Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to transfer polynucleotides encoding transmembrane protein 35.31 with epidermal growth factor-like repeat domains Into the cell.
  • a method for constructing a recombinant viral vector carrying a polynucleotide encoding a transmembrane protein 35. 31 with an epidermal growth factor-like repeat domain can be found in the existing literature (Sambrook, et al.).
  • a recombinant polynucleotide encoding a transmembrane protein 35. 31 with an epidermal growth factor-like repeat domain can be packaged into liposomes and transferred into cells.
  • Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
  • a vector such as a virus, phage, or plasmid
  • Oligonucleotides including antisense MA and DM
  • ribozymes that inhibit transmembrane protein 35. 31 mRNA with epidermal growth factor-like repetitive domains are also within the scope of the present invention.
  • a ribozyme is an enzyme-like RNA molecule that specifically decomposes specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes to a complementary target MA for endonucleation.
  • Antisense MA, DNA, and ribozymes can be obtained by any existing RNA or DNA synthesis technology, such as the technique of solid-phase phosphate amide synthesis of oligonucleotides, which is widely used.
  • Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA. This DNA sequence has been integrated downstream of the vector's RNA polymerase promoter. In order to increase the stability of the nucleic acid molecule, it can be modified in various ways, such as increasing the sequence length on both sides, and the linkage between ribonucleosides should use phosphorothioate or peptide bonds instead of phosphodiester bonds.
  • a polynucleotide encoding a transmembrane protein 35. 31 with an epidermal growth factor-like repeat domain can be used to diagnose a disease related to a transmembrane protein 35. 31 with an epidermal growth factor-like repeat domain.
  • a polynucleotide encoding a transmembrane protein 35. 31 with an epidermal growth factor-like repeat domain can be used to detect the expression of transmembrane protein 35. 31 with an epidermal growth factor-like repeat domain or epidermal growth in a disease state Aberrant expression of a transmembrane protein 35. 31 that resembles a factor. For example, a DNA sequence encoding a transmembrane protein 35.
  • 31 with an epidermal growth factor-like repeat domain can be used to hybridize biopsy specimens to determine the expression of a transmembrane protein 35. 31 with an epidermal growth factor-like repeat domain.
  • Hybridization techniques include Southern blotting, Nor thern blotting, and in situ hybridization. These techniques and methods are publicly available and mature, and related kits are commercially available.
  • a part or all of the polynucleotides of the present invention can be used as probes to be fixed on a micro array or a DNA chip (also called a "gene chip") for analyzing differential expression analysis and gene diagnosis of genes in tissues.
  • the transmembrane protein 35. 31 with specific repeat-like domains can be transcribed by RNA-polymerase chain reaction (RT-PCR) in vitro using primers specific to the epidermal growth factor 35. 31. product.
  • RT-PCR RNA-polymerase chain reaction
  • Detection of epidermal growth factor-like repetitive domain transmembrane protein 35 31 gene mutations can also be used to diagnose epidermal growth factor-like repetitive membrane domain transmembrane protein 35. 31-related diseases. Epidermal growth factor-like transmembrane protein 35. 31 mutant forms include point mutations, translocations, and deletions compared to the normal wild-type epidermal growth factor-like repetitive domain 35. 31 DM sequence , Reorganization, and any other abnormalities. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR, and in situ hybridization. In addition, mutations may affect protein expression, so Northern blotting and Western blotting can be used to indirectly determine the presence or absence of mutations in a gene.
  • sequences of the invention are also valuable for chromosome identification. This sequence will specifically target a specific position on a human chromosome and can hybridize to it. Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for marking chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DM sequences on a chromosome.
  • PCR primers (preferably 15-35bp) are prepared based on cDNA, and the sequences can be located on chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
  • PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
  • oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
  • Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.
  • Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step.
  • FISH Fluorescent in situ hybridization
  • the differences in cDNA or genomic sequences between the affected and unaffected individuals need to be determined. If at A mutation is observed in some or all of the affected individuals, and the mutation is not observed in any normal individuals, then the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in the chromosome, such as deletions or translocations that are visible at the chromosomal level or detectable using cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).
  • the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
  • suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
  • the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
  • the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell.
  • the polypeptides of the invention can be used in combination with other therapeutic compounds.
  • the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
  • Transmembrane proteins with epidermal growth factor-like repeating domains 35. 31 are administered in amounts effective to treat and / or prevent specific indications.
  • the amount and dose range of epidermal growth factor-like repetitive domain transmembrane protein 35.31 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician. Examples
  • Example 1 Cloning of transmembrane protein 35. 31 with epidermal growth factor-like repeating functional domains
  • Total human fetal brain RNA was extracted by a one-step method with guanidine isothiocyanate / phenol / chloroform.
  • Separation Quik raRNA Isolat ion Ki t (Qiegene Co.) total RNA from poly (A) mRNA 0 2ug poly (A) mRNA is formed by reverse transcription cDNA.
  • the Smart cDNA cloning kit purchased from Clontech
  • the bacteria formed a cDNA library.
  • the terminate cycle react ion sequencing kit (Perkin_Elmer) and ABI 377 automatic sequencer (Perkin-Elmer) determined the sequences at the 5 'and 3' ends of all clones.
  • the determined cDNA sequence was compared with the existing public DM sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 2411f05 was new DNA.
  • a series of primers were synthesized to determine the inserted cDNA fragments of the clone in both directions.
  • the 2411f05 clone contains a full-length cDNA of 1571bp (as shown in Seq ID NO: 1), and has a 966bp open reading frame (0RF) from 384b P to 1349bp, which encodes a new protein (such as Seq ID NO: 2).
  • This clone pBS-2411f 05 and the encoded protein was named transmembrane protein 35. 31 with an epidermal growth factor-like repeat domain.
  • Example 2 Homologous search of cDNA clones
  • transmembrane protein 35. 31 with an epidermal growth factor-like repeating domain of the present invention was performed using the Blast program (Basic local al ignment search tool) [Al tschul, SF et al. J. Mol. Biol. 1990; 215: 403 10], homologous searches were performed in databases such as Genbank, Switzerland, and so on.
  • Transmembrane protein with epidermal growth factor-like repeating functional domain 35. 31 The gene with the highest homology is a known transmembrane protein with epidermal growth factor-like repeating functional domain, and its encoded protein is in Genbank The access number is 1) 84336. The protein homology results are shown in Figure 1. The two are highly homologous, with 39% identity; 53% similarity.
  • Example 3 Cloning of a gene encoding a transmembrane protein 35. 31 with epidermal growth factor-like repetitive domains by RT-PCR
  • CDNA was synthesized using fetal brain total RNA as a template and ol igo-dT as a primer for reverse transcription reaction. After purification with Qiagene's kit, the following primers were used for PCR amplification:
  • Pr imerl 5'- GATATGAGAAGCGTGATGAGCGGC -3 '(SEQ ID NO: 3)
  • Primer2 5'- CATAGGCCGAGGCGGCCGACATGT -3 '(SEQ ID NO: 4)
  • Primerl is a forward sequence located at the 5th end of SEQ ID NO: 1, starting at lbp;
  • Primer 2 is the 3 'terminal reverse sequence of SEQ ID NO: 1.
  • Amplification reaction conditions 50 mmol / L KCl, 10 mmol / L Tri s-HCl pH 8.5, 1.5 mmol / L MgCl 2 , 200 ⁇ 1/1 dNTP, lOpmol primer, 1U Taq DM polymerization in 50 ⁇ 1 reaction volume Enzyme (Clontech).
  • the reaction was performed on a PE9600 DM thermal cycler (Perkin-Elmer) for 25 cycles under the following conditions: 94. C 30sec; 55. C 30sec; 72 ° C 2min.
  • ⁇ -act in was set as a positive control and template blank was set as a negative control.
  • the amplified product was purified using a QIAGEN kit and ligated to a pCR vector (Invitrogen) using a TA cloning kit. DNA sequence analysis results indicate PCR The DM sequence of the product is exactly the same as that of 1-1571bp shown in SEQ ID NO: 1.
  • Example 4 Analysis of the expression of transmembrane protein 35.31 gene with epidermal growth factor-like repeat domain by Nor thern blot
  • RNA extraction in one step involves acid guanidinium thiocyanate phenol-chloroform extraction. 4M guanidinium isothiocyanate-25 mM sodium citrate, 0. 2M sodium acetate (pH 4.0), homogenize the tissue, add 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1), mix and centrifuge. Aspirate the aqueous layer and add isopropanol (0.8 volume) and centrifuge the mixture to obtain an RNA pellet. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water.
  • the 3-labeled probe (about 2 x 10 6 cpra / ml) was hybridized with a nitrocellulose membrane to which RNA was transferred at 42 ° C overnight in a solution containing 50% formyl Amine-25mM KH 2 P0 4 (pH7. 4)-5 x SSC-5 x Denhardt's solution and 20 g / ml salmon sperm DNA. After hybridization, filter membrane in 1 x SSC- 0.1% SDS in 55 ° C was washed for 30min. Then, analysis and quantification were performed using Phosphor Imager.
  • Example 5 Recombinant transmembrane protein 35.31 with epidermal growth factor-like repetitive domain in vitro expression, isolation and purification
  • Pr imer3 5'-CCCCATATGATGCCTGGCTGCCAGCACGGTACC-3 '(Seq ID No: 5)
  • Pr imer 4 5'-CATGGATCCTCACAGTGCTGTGGTCTTTCCAGG-3' (Seq ID No: 6)
  • the 5 'ends of these two primers contain Ndel and BamHI digestion respectively Site, followed by the coding sequences of the 5 'and 3' ends of the gene of interest, respectively, and the Ndel and BamHI digestion sites correspond to the expression vector plasmid pET-28b (+) (Novagen product, Ca. No. 69865. 3 Selective endonuclease sites on).
  • PCR was performed using pBS-2411f 05 plasmid containing the full-length target gene as a template.
  • the PCR reaction conditions were as follows: a total volume of 50 ⁇ 1 containing 10 pg of pBS-2411f 05 plasmid, primers Primer-3 and Primer-4 were 1 Opraol, Advantage polymerase Mix (Clontech) 1 ⁇ 1, respectively.
  • Cycle parameters 94 ° C 20s, 60 ° C 30s, 68 ° C 2 min, a total of 25 cycles.
  • Ndel and BamHI were used to double digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase.
  • the ligated product was transformed into the colibacillus DH5 cx by the calcium chloride method. After the LB plates containing kanamycin (final concentration 30 ⁇ ⁇ / ⁇ 1) were cultured overnight, positive clones were selected by colony PCR method and sequenced. A positive clone (pET-2411f05) with the correct sequence was selected, and the recombinant plasmid was transformed into E. coli BL21 (DE3) plySs (product of Novagen) using the calcium chloride method.
  • the host bacteria BL21 (pET-2411f 05) was cultured at 37 ° C to the logarithmic growth phase, and IPTG was added to a final concentration of lrmnol / L, Continue incubation for 5 hours. The bacteria were collected by centrifugation, and the supernatant was collected by centrifugation. The supernatant was collected by centrifugation, and chromatography was performed using an His. Bind Quick Cartridge (product of Novagen) with an affinity chromatography column capable of binding 6 histidines (6His-Tag). 31. Purified protein of transmembrane protein with epidermal growth factor-like repeat domain 35.
  • NH2-Met-Pro-Gly-Cys-Gln-Hi s-Gly-Thr-Cys-His-Gln-Pro-Trp-Gln-Cys-C00H (SEQ ID NO: 7).
  • the peptide is coupled to hemocyanin and bovine serum albumin to form a complex.
  • Rabbits were immunized with 4 mg of the hemocyanin-polypeptide complex plus complete Freund's adjuvant, and 15 days later, the hemocyanin-polypeptide complex plus incomplete Freund's adjuvant was used to boost immunity once.
  • a titer plate coated with a 15 g / ml bovine serum albumin peptide complex was used as an ELISA to determine antibody titers in rabbit serum.
  • Total IgG was isolated from antibody-positive rabbit sera using protein A-Sepharose.
  • the peptide was bound to a cyanogen bromide-activated Sepharose4B column, and anti-peptide antibodies were separated from the total IgG by affinity chromatography.
  • Immunoprecipitation demonstrated that the purified antibody specifically binds to a transmembrane protein 35. 31 with an epidermal growth factor-like repeat domain.
  • Example 7 Application of the polynucleotide fragment of the present invention as a hybridization probe
  • the suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in various aspects.
  • the probes can be used to hybridize to the genome or CDM library of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
  • the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissues or Whether the expression in tissue cells is abnormal.
  • the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the multinucleus of the present invention by a filter hybridization method.
  • Filter hybridization methods include dot blotting, Southern blotting, Northern blotting, and copying methods. They all use the same steps of hybridization after fixing the polynucleotide sample to be tested on the filter.
  • the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer, so that the non-specific binding site of the sample on the filter is saturated with the carrier and the synthetic polymer.
  • the pre-hybridization solution is then replaced with a hybridization buffer containing the labeled probe and incubated to hybridize the probe to the target nucleic acid.
  • the unhybridized probes are removed by a series of membrane washing steps.
  • This embodiment utilizes higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals.
  • the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
  • the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
  • the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
  • oligonucleotide fragments from the polynucleotide SEQ ID NO: 1 of the present invention for use as hybridization probes should follow the following principles and several aspects to be considered:
  • the preferred range of probe size is 18-50 nucleotides
  • the GC content is 30% -70%, and the non-specific hybridization increases when it exceeds;
  • Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements The regions are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, then the primary probe should not be used;
  • Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (fiber):
  • Probe 1 which belongs to the second type of probe, is equivalent to the replacement mutant sequence of the gene fragment or its complementary fragment (41Nt) of SEQ ID NO: 1:
  • PBS phosphate buffered saline
  • Phenol extraction method of DNA-step ⁇ 1) Wash cells with 1-10 ml of cold PBS and centrifuge at 1000g for 10 minutes. 2) Resuspend the pelleted cells with cold cell lysate (1x10 8 cells / ml). Use a minimum of 100ul lysis buffer. 3) Add SDS to a final concentration of 1%. If SDS is added directly to the cell pellet before resuspending the cells, the cells may form large clumps that are difficult to break, and reduce the overall yield. This is particularly serious when extracting> 10 7 cells. 4) Add proteinase K to a final concentration of 200ug / ml. 5) Incubate at 50 U C for 1 hour or at 37 ° C. C gently shake overnight.
  • step 14 can be performed directly.
  • 8) Add RNase A to the DNA solution to a final concentration of 100 ug / ml, 37. C was held for 30 minutes.
  • 9) Add SDS and protease to the final concentration of 0.5% and 100ug / ml. Incubate at 37 ° C for 30 minutes.
  • 10) Extract the reaction solution with an equal volume of phenol: chloroform: isoamyl alcohol (25: 24: 1) and centrifuge for 10 minutes. 11) Carefully remove the aqueous phase and re-extract with an equal volume of chloroform: isoamyl alcohol (24: 1) and centrifuge for 10 minutes.
  • NC membranes nitrocellulose membranes
  • Two NC membranes are required for each probe, so that they can be used in the following experimental steps.
  • the film was washed with high-strength conditions and strength conditions, respectively.
  • the 32 P-Pr 0 be (the second peak is free ⁇ - 32 P- dATP) to be prepared.
  • the sample membrane was placed in a plastic bag and 3-10 mg of prehybridization solution (10xDenhardt's; 6xSSC, 0.1 mg / ral CT DNA (calf thymus DNA)) was added. After closing the bag, 68. C water bath for 2 hours.
  • prehybridization solution 10xDenhardt's; 6xSSC, 0.1 mg / ral CT DNA (calf thymus DNA)

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Immunology (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Toxicology (AREA)
  • Cell Biology (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Molecular Biology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Genetics & Genomics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Zoology (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

L'invention concerne un nouveau polypeptide, une protéine transmembranaire 35.31 possédant un domaine permettant la duplication de facteurs de croissance épidermique, et un polynucléotide codant ce polypeptide ainsi qu'un procédé d'obtention de ce polypeptide par des techniques recombinantes d'ADN. L'invention concerne en outre les applications de ce polypeptide dans le traitement de maladies, notamment des troubles du métabolisme provoqués par les minéralocorticoïdes, des troubles du métabolisme provoqués par les glucocorticoïdes, des troubles du métabolisme provoqués par les androgènes et des troubles du développement. L'invention concerne aussi l'antagoniste agissant contre le polypeptide et son action thérapeutique ainsi que les applications de ce polynucléotide codant la protéine transmembranaire 35.31 possédant un domaine permettant la duplication de facteurs de croissance épidermique.
PCT/CN2001/001255 2000-08-23 2001-08-20 Nouveau polypeptide, proteine transmembranaire 35.31 possedant un domaine permettant la duplication de facteurs de croissance epidermique, et polynucleotide codant ce polypeptide WO2002026809A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU2002220451A AU2002220451A1 (en) 2000-08-23 2001-08-20 A new polypeptide- transmembrane 35.31 containing epidermal growth factor-like repeating domain and the polynucleotide encoding it

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN00119730A CN1339456A (zh) 2000-08-23 2000-08-23 一种新的多肽——具表皮生长因子类似重复功能域的跨膜蛋白35.31和编码这种多肽的多核苷酸
CN00119730.4 2000-08-23

Publications (1)

Publication Number Publication Date
WO2002026809A1 true WO2002026809A1 (fr) 2002-04-04

Family

ID=4587967

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2001/001255 WO2002026809A1 (fr) 2000-08-23 2001-08-20 Nouveau polypeptide, proteine transmembranaire 35.31 possedant un domaine permettant la duplication de facteurs de croissance epidermique, et polynucleotide codant ce polypeptide

Country Status (3)

Country Link
CN (1) CN1339456A (fr)
AU (1) AU2002220451A1 (fr)
WO (1) WO2002026809A1 (fr)

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN109868274A (zh) * 2019-02-13 2019-06-11 广州市红十字会医院（暨南大学医学院附属广州红十字会医院） 靶向抑制EGFL9基因表达的siRNA、siRNA质粒、慢病毒及其构建方法和应用
CN111617247B (zh) * 2019-02-28 2023-05-02 中国医学科学院肿瘤医院 表皮生长因子受体激酶底物8类蛋白3在增强多靶点激酶抑制剂疗效中的用途

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
DORNSEIFER P. ET AL.: "Overexpression of a zebrafish homologue of the drosophila neurogenic gene delta perturbs differentiation of primary neurons and somite development", MECH. DEV., vol. 63, no. 2, 1997, pages 159 - 171 *
HOMMEL U. ET AL.: "Human epidermal growth factor. High resolution solution structure and comparison with human transforming growth factor alpha", J. MOL. BIOL., vol. 227, no. 1, 1992, pages 271 - 282 *

Also Published As

Publication number Publication date
CN1339456A (zh) 2002-03-13
AU2002220451A1 (en) 2002-04-08

Similar Documents

Publication Publication Date Title
WO2002051867A1 (fr) Nouveau facteur 8.8 polypeptidique liberant de la corticotrophine et polynucleotide codant ledit polypeptide
WO2002026972A1 (fr) Nouveau polypeptide, proteine humaine 20.13 de liaison de l'acide polyadenylique, et polynucleotide codant ce polypeptide
WO2002026809A1 (fr) Nouveau polypeptide, proteine transmembranaire 35.31 possedant un domaine permettant la duplication de facteurs de croissance epidermique, et polynucleotide codant ce polypeptide
WO2001083780A1 (fr) Nouveau polypeptide, methylthioadenosine phosphorylase humaine 37, et polynucleotide codant pour ce polypeptide
WO2001046240A1 (fr) Nouveau polypeptide, mariner transposase 19 humaine, et polynucleotide codant pour ce polypeptide
WO2001096560A1 (fr) Nouveau polypeptide, proteine humaine stat2, et polynucleotide codant ce polypeptide
WO2001088084A2 (fr) Nouveau polypeptide, superoxyde dismutase 11, et polynucleotide codant pour ce polypeptide
WO2001094401A1 (fr) Nouveau polypeptide, proteine npat humaine 15, et polynucleotide codant pour ce polypeptide
WO2001049724A1 (fr) Nouveau polypeptide, proteine lissencephale humaine 43, et polynucleotide codant pour ce polypeptide
WO2001062783A1 (fr) Nouveau polypeptide, compose de clivage 69, et polynucleotide codant pour ce polypeptide
WO2001074876A1 (fr) Nouveau polypeptide, phosphatidylinositol-3 kinase humaine 14, et polynucleotide codant pour ce polypeptide
WO2001072832A1 (fr) Nouveau polypeptide, famille de proteines 11 a laquelle appartiennent des hormones de croissance, et polynucleotide codant pour ce polypeptide
WO2001072790A1 (fr) Nouveau polypeptide, proteine humaine p40 12 de facteur l1, et polynucleotide codant pour ce polypeptide
WO2001079432A2 (fr) Nouveau polypeptide, facteur humain de transcription de la differentiation cellulaire 58, et polynucleotide codant pour ce polypeptide
WO2001094371A1 (fr) Nouveau polypeptide, proteine ribosomale humaine s4-10, et polynucleotide codant ce polypeptide
WO2002026810A1 (fr) Nouveau polypeptide, substance proteique p125-77.22, et polynucleotide codant ce polypeptide
WO2001094530A2 (fr) Nouveau polypeptide, proteine 57 de la sous-famille des proteines a doigt de zinc scan, et polynucleotide codant ce polypeptide
WO2001079279A1 (fr) Nouveau polypeptide, facteur humain associe au recepteur du facteur de necrose tumorale 16, et polynucleotide codant pour ce polypeptide
WO2001087960A1 (fr) Nouveau polypeptide, proteine humaine 10 de liaison a l'adn associee a kruppel, et polynucleotide codant pour ce polypeptide
WO2001074866A1 (fr) Nouveau polypeptide, protéine humaine a doigt de zinc 72, et polynucléotide codant pour ce polypeptide
WO2002000698A1 (fr) Nouveau polypeptide, proteine humaine 12 de transport de l'acide phosphorique, et polynucleotide codant ce polypeptide
WO2001070784A1 (fr) Nouveau polypeptide, proteine humaine 17 contenant un domaine de structure chromo, et polynucleotide codant pour ce polypeptide
WO2001074996A2 (fr) Nouveau polypeptide, c. elegans 52 humain, et polynucléotide codant pour ce polypeptide
WO2002020585A1 (fr) Nouveau polypeptide, suppresseur de la transmission de signaux par la cytokine socs-5-29, et polynucleotide codant ce polypeptide
WO2001083760A1 (fr) Nouveau polypeptide, sous-unite humaine 9 d'alpha-cetone acidohydrogenase ramifiee e1-beta, et polynucleotide codant pour ce polypeptide

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EC EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP