WO2001073011A1 - Nouveau polypeptide, proteine humaine a doigt de zinc 38, et polynucleotide codant pour ce polypeptide - Google Patents

Nouveau polypeptide, proteine humaine a doigt de zinc 38, et polynucleotide codant pour ce polypeptide Download PDF

Info

Publication number
WO2001073011A1
WO2001073011A1 PCT/CN2001/000431 CN0100431W WO0173011A1 WO 2001073011 A1 WO2001073011 A1 WO 2001073011A1 CN 0100431 W CN0100431 W CN 0100431W WO 0173011 A1 WO0173011 A1 WO 0173011A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
polynucleotide
zinc finger
finger protein
human zinc
Prior art date
Application number
PCT/CN2001/000431
Other languages
English (en)
Chinese (zh)
Inventor
Yumin Mao
Yi Xie
Original Assignee
Shanghai Biowindow Gene Development Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shanghai Biowindow Gene Development Inc. filed Critical Shanghai Biowindow Gene Development Inc.
Priority to AU56071/01A priority Critical patent/AU5607101A/en
Publication of WO2001073011A1 publication Critical patent/WO2001073011A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • the present invention belongs to the field of biotechnology. Specifically, the present invention describes a novel polypeptide, human zinc finger protein 38, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and polypeptide.
  • Transcriptional regulation of eukaryotic genes is very important for the normal expression of genes and exerts biological functions. Usually, transcriptional regulatory factors complete this process. Transcriptional regulatory factors are involved in the body to determine which tissues and developmental stages of genes begin to transcribe. If the genes encoding such proteins are mutated, not only the gene itself cannot be expressed normally, but many genes regulated by it cannot be normal. Perform transcription and expression. The regulation of transcription factors on gene expression is mainly accomplished through the combination of transcription factors with specific DNA sequences, the interaction between transcription factors, and the interaction of transcription factors with conventional transcription mechanisms.
  • DNA-binding proteins can be divided into two main categories: proteins containing helix-turn-helix motifs and zinc finger proteins [Kamal Chowdhury, Heidi Rohdekard et al., Nucleic Acids Research, 1988, 16: 9995-10011].
  • Zinc finger proteins are members of a multi-gene family encoding zinc ion-mediated nucleotide binding proteins.
  • the zinc finger structures of zinc finger proteins mainly include the following: C2H2 configuration, C2C2 configuration, C2HC configuration, CCC configuration , C3H configuration, C3HC4 configuration (Dai KS et al., 1998).
  • Zinc finger proteins of various configurations have been isolated from a variety of organisms such as yeast, fruit fly, rat and human, among which the zinc finger protein genes containing the C2H2 configuration constitute the largest family of genes in the human genome (Berker et al. al., 1995).
  • C2H2 zinc finger proteins are involved in the activation and suppression of gene transcription. Abnormal expression of these proteins will cause various developmental disorders, the development of various tumors, various genetic diseases and immune system diseases [Kamal Chowdhury, Heidi Rohdekard et al., Nucleic Acids Research, 1988, 16: 9995-10011].
  • All C2H2 zinc finger proteins contain a conserved finger repeat sequence (F / Y) XCXXCXXFXXXXXLXXHXXXHTGEKP with a length of 28-30 amino acids, some of which have highly conserved amino acid residues.
  • This sequence contains multiple copies in many different zinc finger proteins, with different copy numbers (different number of zinc fingers) and different functions.
  • the binding of zinc finger protein to DM with different lengths depends on the number of finger structures.
  • the multi-finger structure may be related to the binding stability of the complex, which is the site of RNA polymerase transcription. Studies have found that the zinc finger domain interconnected regions of many zinc finger proteins are also high It is highly conserved.
  • This region usually contains the following sequences: His- Thr-Gly- Gly- Lys- Pro- (Tyr, Phe)-X-Cys, in which histidine and cysteine are metal ion binding sites And X is a variable amino acid residue.
  • This region is necessary for the formation of zinc finger structures.
  • the number of finger structures will directly affect the binding of zinc finger proteins to DNA of different lengths, and the multi-finger structure is related to the binding stability of the transcription regulation complex [Jeremy M. Berg, Annu. Rev. Biophys. Chem, 1990, 19: 405-421].
  • it can also be divided into different zinc finger protein subfamilies, such as the KRAB type zinc finger protein subfamily.
  • the protein is localized on the eighteenth human chromosome, and it is usually closely related to the occurrence of some atypical myeloproliferative syndromes and chronic leukemia in the body [Reiter A., Sohal J. et al., 1998, Blood, 92: 1735— 1742].
  • the human gene of the present invention has 63% identity and 78% similarity with the known human zinc finger protein ZNF198 at the protein level, and has similar structural characteristics, and its amino acid sequence contains not only the C2H2 zinc finger protein The characteristic sequence fragment also contains a conserved MYM structural motif. Based on the above points, the new gene of the present invention is considered to be a new member of the C2H2 zinc finger protein family and named human zinc finger protein 38. It is inferred that it is similar to ZFP198 and has similar biological functions.
  • the protein is expressed in various tissues of the organism, and it is usually closely related to the occurrence of some developmental disorders, atypical myeloproliferative syndrome, and chronic leukemia and the occurrence of tumors and cancers in related tissues. It may play an important regulatory role in spinal cord development.
  • the protein can also be used for diagnosis and treatment of various related diseases mentioned above. '
  • the human zinc finger protein 38 protein plays an important role in regulating important functions of the body such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes, so there has been a need in the art to identify more involved in these processes.
  • Human zinc finger protein 38 protein, especially the amino acid sequence of this protein is identified. Isolation of the new human zinc finger protein 38 protein encoding gene also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so it is important to isolate its coding for DM.
  • Another object of the invention is to provide a polynucleotide encoding the polypeptide.
  • Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding human zinc finger protein 38.
  • Another object of the invention is to provide a genetically engineered host cell containing a polynucleotide encoding human zinc finger protein 38.
  • Another object of the present invention is to provide a method for producing human zinc finger protein 38.
  • Another object of the present invention is to provide antibodies against the polypeptide of the present invention, human zinc finger protein 38.
  • Another object of the present invention is to provide mimic compounds, antagonists, agonists, and inhibitors against the polypeptide of the present invention, human zinc finger protein 38.
  • Another object of the present invention is to provide a method for diagnosing and treating diseases associated with abnormalities in human zinc finger protein 38. Summary of invention
  • the present invention relates to an isolated polypeptide, which is of human origin, and includes: a polypeptide having the amino acid sequence of SEQ ID D. 2, or a conservative variant, biologically active fragment, or derivative thereof.
  • the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
  • sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 623-1648 in SEQ ID NO: 1; and (b) a sequence having 1-2124 in SEQ ID NO: 1 Sequence of bits.
  • the present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
  • the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
  • the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of human zinc finger protein 38 protein, which comprises utilizing the polypeptide of the invention.
  • the invention also relates to ⁇ The compound.
  • the invention also relates to a method for detecting a disease or disease susceptibility related to abnormal expression of human zinc finger protein 38 protein in vitro, which comprises detecting a mutation in the polypeptide or a polynucleotide sequence encoding the same in a biological sample, or detecting a biological sample.
  • the amount or biological activity of a polypeptide of the invention comprises detecting a mutation in the polypeptide or a polynucleotide sequence encoding the same in a biological sample, or detecting a biological sample.
  • the invention also relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
  • the present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention in the preparation of a medicament for treating cancer, developmental disease or immune disease or other diseases caused by abnormal expression of human zinc finger protein 38.
  • FIG. 1 is a comparison diagram of amino acid sequence homology of human zinc finger protein 38 and human zinc finger protein ZNF198 of the present invention.
  • the upper sequence is human zinc finger protein 38, and the lower sequence is human zinc finger protein ZNF198.
  • Identical amino acids are represented by single-character amino acids between the two sequences, and similar amino acids are represented by "+”.
  • FIG. 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of human zinc finger protein 38 isolated.
  • 38KDa is the molecular weight of the protein.
  • the arrow indicates the isolated protein band.
  • Nucleic acid sequence refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
  • amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
  • amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
  • a protein or polynucleotide “variant” refers to an amino acid sequence having one or more amino acids or nucleotide changes, or a polynucleotide sequence encoding it.
  • the changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence.
  • Variants can have "conservative" changes, which The amino acid substituted in the amino acid has a structural or chemical property similar to that of the original amino acid, such as replacing isoleucine with leucine.
  • Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
  • “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
  • Insertion means that a change in the amino acid sequence or nucleotide sequence results in an increase in one or more amino acids or nucleotides compared to a molecule that exists in nature.
  • Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
  • Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
  • immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response and to bind specific antibodies in a suitable animal or cell.
  • An "agonist” refers to a molecule that, when combined with human zinc finger protein 38, causes the protein to change, thereby regulating the activity of the protein.
  • An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that can bind human zinc finger protein 38.
  • Antagonist refers to a molecule that can block or regulate the biological or immunological activity of human zinc finger protein 38 when combined with human zinc finger protein 38.
  • Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates, or any other molecule that can bind human zinc finger protein 38.
  • Regular refers to a change in the function of human zinc finger protein 38, including an increase or decrease in protein activity, a change in binding characteristics, and any other biological, functional, or immune properties of human zinc finger protein 38.
  • substantially pure means substantially free of other proteins, lipids, carbohydrates or other substances with which it is naturally associated.
  • Those skilled in the art can purify human zinc finger protein 38 using standard protein purification techniques.
  • the substantially pure human zinc finger protein 38 produced a single main band on a non-reducing polyacrylamide gel.
  • the purity of the human zinc finger protein 38 polypeptide can be analyzed by amino acid sequence.
  • Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
  • sequence C-T-G-A
  • complementary sequence G-A-C-T.
  • the complementarity between two single-stranded molecules may be partial or complete.
  • the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
  • “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
  • Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. The inhibition of such hybridization can be detected by performing hybridization (Southern blotting or Nor thern blotting, etc.) under conditions of reduced stringency.
  • Substantially homologous sequences or hybridization probes can compete and inhibit the binding of completely homologous sequences to the target sequence under conditions of reduced stringency. This does not mean strictness Reduced conditions allow non-specific binding, because conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.
  • Percent identity refers to the percentage of sequences that are the same or similar in a comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALIGN program (Lasergene software package, DNASTAR, Inc., Madison Wis.). The MEGALIGN program can compare two or more sequences according to different methods such as the Cluster method (Higgins, D. G. and P.M. Sharp (1988) Gene 73: 237-244). The Cluster method arranges groups of sequences into clusters by checking the distance between all pairs. The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula:
  • the percent identity between nucleic acid sequences can also be determined by the Cluster method or by methods known in the art such as Jotun Hein (Hein J., (1990) Methods in enzyraology 183: 625-645).
  • Similarity refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
  • Amino acids used for conservative substitution for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
  • Antisense refers to a nucleotide sequence that is complementary to a particular DM or RNA sequence.
  • Antisense strand refers to a nucleic acid strand that is complementary to a “sense strand.”
  • Derivative refers to HFP or a chemical modification of its nucleic acid. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
  • Antibody refers to a complete antibody molecule and its fragments, such as Fa,? ( ⁇ ') 2 and? ⁇ It can specifically bind to the epitope of human zinc finger protein 38.
  • a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
  • isolated refers to the removal of a substance from its original environment (for example, its natural environment if it occurs naturally).
  • a naturally occurring polynucleotide or polypeptide is not isolated when it is present in a living animal, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
  • Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not Components of its natural environment, they are still isolated.
  • isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
  • polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances in the natural state .
  • isolated human zinc finger protein 38 means that human zinc finger protein 38 is substantially free of other proteins, lipids, carbohydrates, or other substances with which it is naturally associated. Those skilled in the art can purify human zinc finger protein 38 using standard protein purification techniques. Substantially pure polypeptides produce a single main band on non-reducing polyacrylamide gels. The purity of the human zinc finger protein 38 polypeptide can be analyzed by amino acid sequence.
  • the present invention provides a new polypeptide, human zinc finger protein 38, which basically consists of the amino acid sequence shown in SEQ ID NO: 2.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
  • the polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques. Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
  • the invention also includes fragments, derivatives and analogs of human zinc finger protein 38.
  • fragment refers to a polypeptide that substantially retains the same biological function or activity of the human zinc finger protein 38 of the present invention.
  • a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution
  • the amino acid may or may not be encoded by a genetic codon; or ( ⁇ ) a type in which a group on one or more amino acid residues is replaced by another group to include a substituent; or ( ⁇ ⁇ )
  • Such a type, in which the mature polypeptide is fused with another compound such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol
  • such fragments, derivatives and analogs are considered to be within the knowledge of those skilled in the art.
  • the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
  • the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a polynucleotide sequence with a total length of 2124 bases, and its open reading frame 623-1648 encodes 341 amino acids. According to the amino acid sequence homology comparison, it was found that this polypeptide has 63% homology with human zinc finger protein ZNF198.
  • the polynucleotide of the present invention may be in the form of DNA or RNA.
  • DNA forms include cDNA, genomic DM, or synthetic DNA.
  • DNA can be single-stranded or double-stranded.
  • DNA can be coding or non-coding.
  • the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
  • a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
  • the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
  • polynucleotide encoding a polypeptide refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.
  • the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
  • Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
  • an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
  • the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity, between the two sequences).
  • the present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions.
  • "strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60'C; or (2) A denaturant was added during hybridization, such as 50% ( ⁇ / ⁇ ) formamide, 0.1% calf serum / 0.1% Fi co ll, 42.
  • Hybridization occurs only when the identity between two sequences is at least 95%, and more preferably 97%.
  • the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
  • nucleic acid fragments that hybridize to the sequences described above.
  • a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, most preferably at least 100 nucleotides. Nucleotides or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques such as PCR to identify and / or isolate polynucleotides encoding human zinc finger protein 38.
  • polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
  • the specific polynucleotide sequence encoding the human zinc finger protein 38 of the present invention can be obtained by various methods.
  • polynucleotides are isolated using hybridization techniques well known in the art. These technologies include but are not limited to: 1) Probes are used to hybridize to a genomic or cDNA library to detect homologous polynucleotide sequences, and 2) antibody expression libraries are screened to detect cloned polynucleotide fragments with common structural characteristics.
  • the DM fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.
  • genomic DM is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences.
  • the standard method for isolating the cDNA of interest is to isolate mRM from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library.
  • mRM plasmid or phage cDNA library.
  • kits are also commercially available (Qiagene).
  • the construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989).
  • Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
  • genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DM-RNA hybrids; (2) the presence or absence of marker gene functions; (3) measuring the level of human zinc finger protein 38 transcripts; (4) Detection of gene-expressed protein products by immunological techniques or determination of biological activity. The above methods can be used singly or in combination.
  • the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
  • the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
  • the probe used here is usually a DNA sequence chemically synthesized based on the gene sequence information of the present invention.
  • the genes or fragments of the present invention can of course be used as probes.
  • DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
  • immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) can be used to detect the protein product of human zinc finger protein 38 gene expression.
  • ELISA enzyme-linked immunosorbent assay
  • a method using PCR technology to amplify DNA / RNA is preferably used to obtain the gene of the present invention.
  • the RACE method RACE-Rapid Amplification of cDNA Ends
  • the primers for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein Select and synthesize using conventional methods.
  • the amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
  • polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. To obtain full-length cDNA Sequence, sequencing needs to be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
  • the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell genetically engineered using the vector of the present invention or directly using a human zinc finger protein 38 coding sequence, and a method for producing a polypeptide of the present invention by recombinant technology.
  • a polynucleotide sequence encoding human zinc finger protein 38 can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
  • vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
  • Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al.
  • any plasmid and vector can be used to construct a recombinant expression vector.
  • An important feature of expression vectors is that they usually contain origins of replication, promoters, marker genes, and translational regulatory elements.
  • Methods known to those skilled in the art can be used to construct expression vectors containing a DM sequence encoding human zinc finger protein 38 and appropriate transcription / translation regulatory elements. These methods include in vitro recombinant DNA technology, DNA synthesis technology, and in vivo recombination technology (Sambroook, et al. Molecular Cloning, a Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989).
  • the DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis. Representative examples of these promoters are: the lac or trp promoter of E.
  • the expression vector also includes a ribosome binding site for translation initiation, a transcription terminator, and the like. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors expressed by DM, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers and adenovirus enhancers on the late side of the origin of replication.
  • the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • GFP fluorescent protein
  • tetracycline or ampicillin resistance for E. coli.
  • a polynucleotide encoding human zinc finger protein 38 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a genetically engineered host cell containing the polynucleotide or the recombinant vector.
  • the term "host cell” refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E.
  • coli Streptomyces
  • bacterial cells such as Salmonella typhimurium
  • fungal cells such as yeast
  • plant cells such as fly S2 or Sf 9
  • animal cells such as CH0, COS or Bowes melanoma cells.
  • Transformation of a host cell with a DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art.
  • the host is a prokaryote such as E. coli
  • competent cells capable of DNA uptake can be in the exponential growth phase were harvested, treated with CaC l 2 method used in steps well known in the art. The alternative is to use MgC l 2 .
  • transformation can also be performed by electroporation.
  • the host is a eukaryote, the following DM transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
  • the polynucleotide sequence of the present invention can be used to express or produce recombinant human zinc finger protein 38 (Scence, 1984; 224: 14 31). Generally there are the following steps:
  • the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
  • a suitable method such as temperature conversion or chemical induction
  • the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If necessary, the recombinant protein can be isolated and purified by various separation methods using its physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
  • conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid
  • the polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection and immune diseases.
  • Zinc-binding proteins are usually involved in gene expression and regulation as transcription factors and signal transduction molecules.
  • Zinc finger proteins are expressed in various tissues of different organisms, including hematopoietic cells, brain, nervous system, various tumors and tumors.
  • the C2H2-type zinc finger domain-containing protein not only plays an important role in regulating gene expression in some tissues, but also plays a key role in the developmental regulation process.
  • C2H2 type zinc finger domains are related to the following diseases: solid tumors such as thyroid adenoma, uterine fibroids, neurological diseases such as extrapyramidal dysfunction, Parkinson's syndrome, ataxia, nerve cells Tumors, glioblastomas, hematological malignancies such as leukemia, non-Hodgkin's lymphoma, developmental disorders such as Williams syndrome, cleft-hand and cleft foot syndrome, Bayer's syndrome, other tumors such as neuroblasts Cell tumor, colon cancer, breast cancer, etc.
  • solid tumors such as thyroid adenoma, uterine fibroids
  • neurological diseases such as extrapyramidal dysfunction, Parkinson's syndrome, ataxia
  • nerve cells Tumors such as leukemia, non-Hodgkin's lymphoma
  • developmental disorders such as Williams syndrome, cleft-hand and cleft foot syndrome, Bayer's syndrome
  • other tumors such as neuroblasts Cell tumor, colon cancer, breast cancer, etc.
  • the polypeptide of the present invention is homologous to the known human zinc finger protein ZNF198, and also has a MYM domain specifically conserved by the zinc finger protein ZNF198.
  • the MYM structural motif participates in the process of protein binding to protein receptors and exerts biological activities during protein interaction. Its mutation or abnormal expression will directly lead to the protein's functional activity in the body, that is, it will cause various related diseases such as some atypical ones. Myeloproliferative syndrome, chronic leukemia, etc.
  • human zinc finger protein 38 of the present invention will produce various diseases, especially atypical myeloproliferative syndrome, chronic leukemia, other tumors, nervous system diseases, hematological malignant diseases, and developmental disorders. These diseases include but not limited to:
  • Tumors of various tissues atypical myeloproliferative syndrome, chronic leukemia, thyroid tumors, uterine fibroids, colon cancer, breast cancer, leukemia, lymphoma, malignant histiocytosis, melanoma, gastric cancer, liver cancer, lung cancer, esophageal cancer , Myeloma, teratoma, adrenal cancer, bladder cancer, bone cancer, osteosarcoma, brain cancer, thymus tumor, uterine fibroids, ependymal tumor, glioblastoma, myeloma, bone marrow cancer, endometrial cancer Fibrosarcoma
  • Neurological diseases Parkinson's syndrome, ataxia, neurocytoma, glioblastoma, dementia, depression, amnesia, Huntington's disease, epilepsy, migraine, dementia, multiple sclerosis, Myasthenia gravis, muscular hypertrophy, tonic muscular dystrophy, dystonia, schizophrenia, Depression, paranoia, anxiety, obsessive-compulsive disorder, phobia, neurasthenia
  • Hematological malignancies Leukemia, non-Hodgkin's lymphoma
  • Abnormal expression of the human zinc finger protein 38 of the present invention will also produce certain genetic diseases, endocrine system diseases such as endocrine adenoma, and immune system diseases.
  • the polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat various diseases, especially atypical myeloproliferative syndrome, chronic leukemia, other tumors, neurological diseases, and hematological Malignant diseases, developmental disorders, certain genetic diseases, endocrine system diseases, etc.
  • the invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) human zinc finger protein 38.
  • Agonists enhance human zinc finger protein 38 to stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
  • mammalian cells or a membrane preparation expressing human zinc finger protein 38 can be cultured with labeled human zinc finger protein 38 in the presence of a drug. The ability of the drug to increase or block this interaction is then determined.
  • Antagonists of human zinc finger protein 38 include antibodies, compounds, receptor deletions, and the like that have been screened. Antagonists of human zinc finger protein 38 can bind to human zinc finger protein 38 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot perform biological functions.
  • human zinc finger protein 38 can be added to a bioanalytical assay to determine whether a compound is an antagonist by measuring the effect of the compound on the interaction between human zinc finger protein 38 and its receptor. Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds.
  • Polypeptide molecules capable of binding to human zinc finger protein 38 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. When screening, the human zinc finger protein 38 molecule should generally be labeled.
  • the present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies.
  • the invention also provides antibodies against human zinc finger protein 38 epitopes. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments generated from Fab expression libraries.
  • Polyclonal antibodies can be produced by injecting human zinc finger protein 38 directly into immunized animals (such as rabbits, mice, rats, etc.).
  • immunized animals such as rabbits, mice, rats, etc.
  • a variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's adjuvant.
  • Techniques for preparing monoclonal antibodies to human zinc finger protein 38 include, but are not limited to, hybridoma technology (Kohl er and Milstei n. Nature, 1975, 256: 495-497), triple tumor technology, human beta-cell hybridoma technology Surgery, EBV-hybridoma technology, etc.
  • Chimeric antibodies that bind human constant regions and non-human-derived variable regions can be produced using existing techniques (Morrison et al, PNAS, 1985, 81: 6851).
  • the existing technology for producing single chain antibodies (US Pat No. 4946778) can also be used to produce single chain antibodies against human zinc finger protein 38.
  • Anti-human zinc finger protein 38 antibodies can be used in immunohistochemical techniques to detect human zinc finger protein 38 in biopsy specimens.
  • Monoclonal antibodies that bind to human zinc finger protein 38 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
  • Antibodies can also be used to design immunotoxins that target a particular part of the body.
  • human zinc finger protein 38 high affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
  • a common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
  • This hybrid antibody can be used to kill human zinc finger protein 38 positive cells.
  • the antibodies of the present invention can be used to treat or prevent diseases related to human zinc finger protein 38.
  • Administration of an appropriate dose of antibody can stimulate or block the production or activity of human zinc finger protein 38.
  • the invention also relates to a diagnostic test method for quantitative and localized detection of human zinc finger protein 38 levels. These tests are well known in the art and include FISH assays and radioimmunoassays. The level of human zinc finger protein 38 detected in the test can be used to explain the importance of human zinc finger protein 38 in various diseases and to diagnose diseases where human zinc finger protein 38 functions.
  • polypeptide of the present invention can also be used for peptide mapping analysis.
  • the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
  • the polynucleotide encoding human zinc finger protein 38 can also be used for a variety of therapeutic purposes.
  • Gene therapy technology can be used to treat abnormal cell proliferation, development or metabolism caused by the non-expression or abnormal / inactive expression of human zinc finger protein 38.
  • Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated human zinc finger protein 38 to inhibit endogenous human zinc finger protein 38 activity.
  • a variant human zinc finger protein 38 may be a shortened human zinc finger protein 38 that lacks a signaling domain. Although it can bind to downstream substrates, it lacks signaling activity. Therefore, recombinant gene therapy vectors can be used to treat diseases caused by abnormal expression or activity of human zinc finger protein 38.
  • Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to transfer a polynucleotide encoding human zinc finger protein 38 into cells.
  • Methods for constructing recombinant viral vectors carrying a polynucleotide encoding human zinc finger protein 38 can be found in existing literature (Sambrook, eta l.). Human recombinant zinc finger
  • the polynucleotide of protein 38 can be packaged into liposomes and transferred into cells.
  • Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
  • a vector such as a virus, phage, or plasmid
  • Oligonucleotides including antisense RNA and DNA
  • ribozymes that inhibit human zinc finger protein 38 mRNA are also within the scope of the present invention.
  • a ribozyme is an enzyme-like RNA molecule that specifically decomposes specific RNA. Its mechanism is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation.
  • Antisense RNA, DNA, and ribozymes can be obtained using any existing RNA or DNA synthesis techniques, such as solid-phase phosphate amide chemical synthesis to synthesize oligonucleotides.
  • Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA.
  • This DM sequence has been integrated downstream of the RNA polymerase promoter of the vector.
  • it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the phosphorothioate or peptide bond instead of the phosphodiester bond is used for the ribonucleoside linkage.
  • the polynucleotide encoding human zinc finger protein 38 can be used for the diagnosis of diseases related to human zinc finger protein 38.
  • the polynucleotide encoding human zinc finger protein 38 can be used to detect the expression of human zinc finger protein 38 or the abnormal expression of human zinc finger protein 38 in a disease state.
  • the DNA sequence encoding human zinc finger protein 38 can be used to hybridize biopsy specimens to determine the expression of human zinc finger protein 38.
  • Hybridization techniques include Southern blotting, Nor thern blotting, and in situ hybridization. These technical methods are all mature technologies that are publicly available, and related kits are commercially available.
  • polynucleotides of the present invention can be used as probes to be fixed on a micro array or a DNA chip (also known as a "gene chip") for analyzing differential expression analysis and gene diagnosis of genes in tissues.
  • a DNA chip also known as a "gene chip”
  • RM-polymerase chain reaction (RT-PCR) in vitro amplification of human zinc finger protein 38 specific primers can also be used to detect transcripts of human zinc finger protein 38.
  • Detection of mutations in the human zinc finger protein 38 gene can also be used to diagnose human zinc finger protein 38-related diseases.
  • Human zinc finger protein 38 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild type human zinc finger protein 38 DNA sequence. Mutations can be detected using existing techniques such as Sout hern imprinting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression. Therefore, the Nor thern blot and Western blot can be used to indirectly determine whether a gene is mutated.
  • sequences of the invention are also valuable for chromosome identification. This sequence will specifically target a specific position on a human chromosome and can hybridize to it. Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for labeling chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DNA sequences on a chromosome. In short, the PCR primers (preferably 15-35bp) are prepared based on cDNA, and the sequence can be located on the chromosome. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those hybrid cells that contain the human gene corresponding to the primer will produce amplified fragments.
  • PCR localization of somatic hybrid cells is a quick way to localize DM to specific chromosomes.
  • oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
  • Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.
  • Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step.
  • FISH Fluorescent in situ hybridization
  • the difference in cDNA or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).
  • the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
  • suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
  • the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
  • the present invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the present invention.
  • these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which reminders authorize them to be administered to humans by government agencies that manufacture, use, or sell them.
  • the polypeptides of the invention can be used in combination with other therapeutic compounds.
  • the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
  • Human zinc finger protein 38 is administered in an amount effective to treat and / or prevent a specific indication. The amount and dosage range of human zinc finger protein 38 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician. Examples
  • Human fetal brain total MA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform.
  • Poly (A) mRNA was isolated from total RNA using Quik mRNA Isolation Kit (Qiegene). 2ug poly (A) mRNA is reverse transcribed to form cDNA.
  • the Smart cDNA cloning kit purchased from Clontech was used to insert the 00 fragment into the multiple cloning site of the pBSK (+) vector (Clontech) to transform DH5 ⁇ to form a cDNA library.
  • Dye terminate cycle reaction ion sequencing kit Perkin-Elmer
  • ABI 377 automatic sequencer Perkin-Elmer
  • the determined cDNA sequence was compared with the existing public DNA sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 1060g08 was new DNA.
  • a series of primers were synthesized to determine the inserted cDNA fragments of the clone in both directions.
  • the sequence of the human zinc finger protein 38 of the present invention and the protein sequence encoded by the same were subjected to the Blast program (Basic local alignment search tool) [Al tschul, SF et al. J. Mol. Biol. 1990; 215: 403-10] Perform homology search in Genbank, Swissport and other databases.
  • the gene with the highest homology to the human zinc finger protein 38 of the present invention is a known human zinc finger protein ZNF198, whose accession number encoded by Genbank is AF035374.
  • the protein homology results are shown in Figure 1. The two are highly homologous, with an identity of 63%; a similarity of 78%.
  • Example 3 Cloning of a gene encoding human zinc finger protein 38 by RT-PCR
  • CDNA was synthesized using fetal brain total RNA as a template and oligo-dT as a primer for reverse transcription reaction. After purification with Qiagene's kit, the following primers were used for PCR amplification:
  • Primer2 5
  • one CCATTAAAAATAATATTTATTTTA — 3 (SEQ ID NO: 4)
  • Primerl is a forward sequence starting at lbp of the 5th end of SEQ ID NO: 1;
  • Primer2 is the 3 'end reverse sequence in SEQ ID NO: 1.
  • Amplification conditions 50 ⁇ l reaction volume containing 50 ol / L KC1, 10 mmol / L Tris-HCl, pH 8.5, 1.5 mmol / L MgCl 2 , 200 ⁇ 1 / L dNTP, lOptnol primer, 1U Taq DNA polymerase (Clontech).
  • the reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) under the following conditions for 25 cycles: 94 ° C 30sec; 55 ° C 30sec; 72 ° C 2min.
  • ⁇ -actin was set as a positive control and template blank was set as a negative control.
  • the amplified product was purified using a QIAGEN kit, and ligated to a pCR vector (Invitrogen product) using a TA cloning kit.
  • the DNA sequence analysis results showed that the DM sequence of the PCR product was exactly the same as 1-2124bp shown in SEQ ID NO: 1.
  • Example 4 Northern blot analysis of human zinc finger protein 38 gene expression
  • RNA extraction in one step [Anal. Biochem 1987, 162, 156-159] 0
  • This method involves acid guanidinium thiocyanate-chloroform extraction. That is, the tissue is homogenized with 4M guanidinium isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1 ) And centrifuge after mixing. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water.
  • Electrophoresis was performed on a 1.2% agarose gel containing 2 g of RNA on 20 mM 3- (N-morpholino) propanesulfonic acid (PH7.0)-5 mM sodium acetate-1 mM EDTA-2.2M formaldehyde. Then Transfer to a nitrocellulose membrane. A 32 P dATP was used to prepare 32 P-labeled DNA probes by random primers. The DM probe used was the PCR amplified human zinc finger protein 38 coding region shown in Figure 1 sequence (623bp to 1648bp).
  • a pair of specific amplification primers was designed, and the sequences are as follows: Primer3: 5, — CCCCATATGATGTGGCAGGAGACTTATTTCAGA -3, (Seq ID No: 5) Primer4: 5'- CATGGATCCTTACGTGTACAACAACAGCACACC -3, (Seq ID No: 6) The 5 'ends of these two primers contain Ndel and BamHI restriction sites, respectively.
  • the coding sequences for the 5 ,, and 3 'ends of the gene of interest are followed, and the Ndel and BamHI restriction sites correspond to the selectivity within the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865.3). Digestion site.
  • the PCR reaction was performed using pBS-1060g08 plasmid containing the full-length target gene as a template.
  • the PCR reaction conditions were as follows: 10 pg of pBS-1060g08 plasmid, Primer-3, and Primer-4 were included in a total volume of 50 ⁇ 1; j was 1 Opmol, Advantage polymerase Mix (Clontech) 1 ⁇ 1. Cycle parameters: 94. C 20s, 60.
  • Ndel and BamHI were used to double digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase.
  • the ligation product was transformed into E. coli DH5c by the calcium chloride method. After being cultured overnight in LB plates containing kanamycin (final concentration 3 ( ⁇ g / ml)), positive clones were selected by colony PCR method and sequenced. The correct positive clone (PET-1060g08) was used to transform the recombinant plasmid into E.
  • coli BL21 (DE3) plySs (product of Novagen) by calcium chloride method.
  • LB liquid medium containing kanamycin final concentration 30 ⁇ ⁇ / ⁇ 1
  • IPTG was added to a final concentration of 1 ol / L, and the culture was continued for 5 hours.
  • the cells were collected by centrifugation.
  • the supernatant was chromatographed using an affinity chromatography column His. Bind Quick Cartridge (product of Novagen) capable of binding to 6 histidine His-Tag) to obtain a purified human protein zinc finger protein 38.
  • a peptide synthesizer (product of PE company) was used to synthesize the following human zinc finger protein 38-specific peptides:
  • the polypeptide is coupled with hemocyanin and bovine serum albumin to form a complex, respectively.
  • hemocyanin and bovine serum albumin For the method, see: Avraraeas, et al. Immunochemistry, 1969; 6: 43. Rabbits were immunized with 4 mg of the hemocyanin polypeptide complex plus complete Freund's adjuvant, and 15 days later, the hemocyanin polypeptide complex plus incomplete Freund's adjuvant was used to boost immunity once.
  • a titer plate coated with 15 g / ml bovine serum albumin peptide complex was used as an ELISA to determine the antibody titer in rabbit serum.
  • Total IgG was isolated from antibody-positive rabbit sera using protein A-Sepharose.
  • the peptide was bound to a cyanogen bromide-activated Sepharos B column and the anti-peptide antibody was separated from the total IgG by affinity chromatography.
  • the immunoprecipitation method proved that the purified antibody could specifically bind to human zinc finger protein 38.
  • Example 7 Application of the polynucleotide fragment of the present invention as a hybridization probe
  • Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
  • the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
  • the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
  • the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method.
  • Filter hybridization methods include dot blotting, Southern imprinting, Nor thern blotting, and copying methods. They all use the same steps to fix the polynucleotide sample to be tested on the filter and then hybridize.
  • the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer to saturate the non-specific binding site of the sample on the filter with the carrier and the synthesized polymer.
  • the pre-hybridization solution is then replaced with a hybridization buffer containing labeled probes and incubated to hybridize the probes to the target nucleic acid.
  • the unhybridized probes are removed by a series of membrane washing steps.
  • This embodiment uses higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals.
  • the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
  • the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
  • the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
  • oligonucleotide fragments from the polynucleotide SEQ ID NO: 1 of the present invention for use as hybridization probes should follow the following principles and several aspects to be considered:
  • the preferred range of probe size is 18-50 nucleotides
  • Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements For homology comparison of the regions, if the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, the primary probe should not be used generally;
  • Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
  • Probe 2 which belongs to the second type of probe, is equivalent to the replacement mutant sequence of the gene fragment of SEQ ID NO: 1 or its complementary fragment (41Nt):
  • PBS phosphate buffered saline
  • step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
  • NC membrane nitrocellulose membrane
  • the 32 P-Probe (the second peak is free ⁇ - 32 P-dATP) is prepared.
  • the sample membrane was placed in a plastic bag, and 3 to 10 mg of prehybridization solution (10xDenhardfs; 6xSSC, 0.1 mg / ml CT DM (calf thymus DNA)) was added. After sealing the mouth of the bag, shake at 68 ° C for 2 hours.
  • prehybridization solution 10xDenhardfs; 6xSSC, 0.1 mg / ml CT DM (calf thymus DNA)

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Toxicology (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

L'invention concerne un nouveau polypeptide, une protéine humaine à doigt de zinc 38, et un polynucléotide codant pour ce polypeptide ainsi qu'un procédé d'obtention de ce polypeptide par des techniques recombinantes d'ADN. L'invention concerne en outre les applications de ce polypeptide dans le traitement de maladies, notamment du syndrome myéloprolifératif atypique, des leucémies chroniques, d'autres tumeurs, des maladies du système nerveux, des hémopathies malignes, des troubles du développement et de l'infection par VIH. L'invention concerne aussi l'antagoniste agissant contre le polypeptide et son action thérapeutique ainsi que les applications de ce polynucléotide codant pour la protéine humaine à doigt de zinc 38.
PCT/CN2001/000431 2000-03-27 2001-03-26 Nouveau polypeptide, proteine humaine a doigt de zinc 38, et polynucleotide codant pour ce polypeptide WO2001073011A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU56071/01A AU5607101A (en) 2000-03-27 2001-03-26 A novel polypeptide, a human zinc finger protein 38 and the polynucleotide encoding the polypeptide

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN00115171.1 2000-03-27
CN 00115171 CN1315383A (zh) 2000-03-27 2000-03-27 一种新的多肽——人锌指蛋白38和编码这种多肽的多核苷酸

Publications (1)

Publication Number Publication Date
WO2001073011A1 true WO2001073011A1 (fr) 2001-10-04

Family

ID=4584640

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2001/000431 WO2001073011A1 (fr) 2000-03-27 2001-03-26 Nouveau polypeptide, proteine humaine a doigt de zinc 38, et polynucleotide codant pour ce polypeptide

Country Status (3)

Country Link
CN (1) CN1315383A (fr)
AU (1) AU5607101A (fr)
WO (1) WO2001073011A1 (fr)

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
DATABASE GENBANK [online] 1 October 1999 (1999-10-01), accession no. EMBL Database accession no. AJ133352 *
DATABASE GENBANK [online] 1 October 1999 (1999-10-01), accession no. EMBL Database accession no. AJ133353 *
DATABASE GENBANK [online] 1 October 1999 (1999-10-01), accession no. EMBL Database accession no. AJ133354 *
DATABASE GENBANK [online] 1 October 1999 (1999-10-01), accession no. EMBL Database accession no. AJ133355 *
DATABASE GENBANK [online] 22 January 1999 (1999-01-22), accession no. EMBL Database accession no. AJ007676 *

Also Published As

Publication number Publication date
CN1315383A (zh) 2001-10-03
AU5607101A (en) 2001-10-08

Similar Documents

Publication Publication Date Title
WO2001038523A1 (fr) Nouveau polypeptide, gene humain 14 lie a la surdite, et polynucleotide codant pour ce polypeptide
WO2001073011A1 (fr) Nouveau polypeptide, proteine humaine a doigt de zinc 38, et polynucleotide codant pour ce polypeptide
WO2001094530A2 (fr) Nouveau polypeptide, proteine 57 de la sous-famille des proteines a doigt de zinc scan, et polynucleotide codant ce polypeptide
WO2001049724A1 (fr) Nouveau polypeptide, proteine lissencephale humaine 43, et polynucleotide codant pour ce polypeptide
WO2001079432A2 (fr) Nouveau polypeptide, facteur humain de transcription de la differentiation cellulaire 58, et polynucleotide codant pour ce polypeptide
WO2001081594A1 (fr) Nouveau polypeptide, proteine pax humaine 17, et polynucleotide codant pour ce polypeptide
WO2001046409A1 (fr) Nouveau polypeptide, proteine ribosomale s7 9, et polynucleotide codant pour ce polypeptide
WO2001048195A1 (fr) Nouveau polypeptide, proteine rcc1 10, et polynucleotide codant pour ce polypeptide
WO2001055381A1 (fr) Nouveau polypeptide, facteur regulateur 80 de la transcription humaine, et polynucleotide codant pour ce polypeptide
WO2001070965A1 (fr) Nouveau polypeptide, facteur humain de regulation de la transcription 15, et polynucleotide codant pour ce polypeptide
WO2001064733A1 (fr) Nouveau polypeptide, facteur humain 22 lie a la transcription inverse, et polynucleotide codant pour ce polypeptide
WO2001048004A1 (fr) Nouveau polypeptide, proteine de liaison de l'heparine 10, et polynucleotide codant pour ce polypeptide
WO2001079279A1 (fr) Nouveau polypeptide, facteur humain associe au recepteur du facteur de necrose tumorale 16, et polynucleotide codant pour ce polypeptide
WO2001066584A1 (fr) Nouveau polypeptide, proteine humaine pax 9, et polynucleotide codant pour ce polypeptide
WO2001046437A1 (fr) Nouveau polypeptide, region de liaison d'arn-eucaryote rnp-1-21, et polynucleotide codant pour ce polypeptide
WO2001053483A1 (fr) Nouveau polypeptide, proteine humaine 30 a doigt de zinc, et polynucleotide codant pour ce polypeptide
WO2001083684A2 (fr) Nouveau polypeptide, proteine humaine krab kraz2-12 a doigt de zinc, et polynucleotide codant pour ce polypeptide
WO2001053341A1 (fr) Nouveau polypeptide, proteine humaine 13 a doigt de zinc, et polynucleotide codant pour ce polypeptide
WO2001094395A1 (fr) Nouveau polypeptide, proteine humaine a doigt de zinc 38, et polynucleotide codant ce polypeptide
WO2001081399A1 (fr) Nouveau polypeptide, proteine pax humaine 14, et polynucleotide codant pour ce polypeptide
WO2001083541A1 (fr) Nouveau polypeptide, proteine humaine 42 de liaison a l'adn associee a kruppel, et polynucleotide codant pour ce polypeptide
WO2001071000A1 (fr) Nouveau polypeptide, znt-1-22, et polynucleotide codant pour ce polypeptide
WO2001066731A1 (fr) Nouveau polypeptide, proteine humaine a doigt de zinc 32, et polynucleotide codant pour ce polypeptide
WO2001055186A1 (fr) Nouveau polypeptide, proteine humaine a doigt de zinc 14, et polynucleotide codant pour ce polypeptide
WO2001064732A1 (fr) Nouveau polypeptide, facteur humain associe a la retrotransposition 14, et polynucleotide codant pour ce polypeptide

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP