WO2001053483A1 - Nouveau polypeptide, proteine humaine 30 a doigt de zinc, et polynucleotide codant pour ce polypeptide - Google Patents

Nouveau polypeptide, proteine humaine 30 a doigt de zinc, et polynucleotide codant pour ce polypeptide Download PDF

Info

Publication number
WO2001053483A1
WO2001053483A1 PCT/CN2001/000025 CN0100025W WO0153483A1 WO 2001053483 A1 WO2001053483 A1 WO 2001053483A1 CN 0100025 W CN0100025 W CN 0100025W WO 0153483 A1 WO0153483 A1 WO 0153483A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
zinc finger
polynucleotide
finger protein
human zinc
Prior art date
Application number
PCT/CN2001/000025
Other languages
English (en)
Chinese (zh)
Inventor
Yumin Mao
Yi Xie
Original Assignee
Biodoor Gene Technology Ltd. Shanghai
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Biodoor Gene Technology Ltd. Shanghai filed Critical Biodoor Gene Technology Ltd. Shanghai
Priority to AU29963/01A priority Critical patent/AU2996301A/en
Publication of WO2001053483A1 publication Critical patent/WO2001053483A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • the present invention belongs to the field of biotechnology. Specifically, the present invention describes a new polypeptide, human zinc finger protein 30, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and the polypeptide. Background technique
  • Zinc finger proteins are members of a multi-gene family encoding zinc ion-mediated nucleotide binding proteins.
  • the zinc finger structures of zinc finger proteins mainly include the following: C2H2 configuration, C2C2 configuration, C2HC configuration, C2HC4C configuration , C3H configuration, C3HC4 configuration (Dai KS et al., 1998).
  • Zinc finger proteins of various configurations have been isolated from a variety of organisms such as yeast, Drosophila, rat and human, among which the zinc finger protein genes containing the C2H2 configuration constitute the largest family of genes in the human genome (Berker et al ., 1995).
  • C2H2 zinc finger proteins are involved in the activation and suppression of gene transcription.
  • All C2H2 zinc finger proteins contain a conserved finger repeat (F / Y) XCXXCXXXFXXXXXLXXHXXXHTGEKP with a length of 28-30 amino acids, some of which are highly conserved in specific amino acid residues. This sequence contains multiple copies in many different zinc finger proteins, with different copy numbers (different number of zinc fingers) and different functions.
  • the zinc finger domain interconnected regions of many zinc finger proteins are also highly conserved, and this region usually contains the following sequences: His- Thr- Gly- Gly- Lys- Pro- (Tyr, Phe) -X- Cys, Among them, histidine and cysteine are the binding sites of metal ions, and X is a variable amino acid residue. This region is necessary for the formation of zinc finger structures.
  • the number of finger structures will directly affect the binding of zinc finger proteins to DNA of different lengths, and the multi-finger structure is related to the binding stability of the transcription regulation complex [Jeremy M. Berg, Annu. Rev. Biophys.
  • C2H2 zinc finger proteins can be divided into different protein families according to their different structural characteristics. Kruppel-related zinc finger proteins are one of the most widely distributed. Species. In addition, Bellefroid et al. Pointed out in 1991 that about one-third of the members of this subfamily also contained a conserved motif consisting of 75 amino acids at the N-terminus of their protein sequences, and named this motif as KRAB (Kruppel- associated box) domain. This domain is a zinc-binding protein N-terminal domain that binds DNA and is highly conserved in evolution [Judith F. Margolin et al., Proc. Nat 1. Acad. Sci.
  • This domain is divided into two box structures, A and B, which are rich in changing amino acid residues and form two hydrophilic helices.
  • Some members of the zinc finger protein KRAB subfamily contain both KRAB A-boxes and KRAB B-boxes, and some contain only KRAB A-boxes.
  • the study found that the KRAB domain is a potential transcriptional repression domain, in which a 45-amino-acid hydrophilic helical segment is necessary for transcriptional repression. The substitution of amino acids in the helical structure will weaken the protein's transcriptional repression function, thus Causes dysregulation of gene transcription and causes various developmental and malignant disorders-related diseases [N.
  • the KRAB domain works in concert with zinc finger structures to regulate the expression of various genes in vivo.
  • the KRAB domain and the first zinc finger structure also contain a conserved linking region that contains at least one nucleic acid localization signal, which is related to the correct localization and function of the protein.
  • the new human zinc finger protein of the present invention has 39% identity and 51% similarity with the known human zinc finger protein PZNF136 at the protein level, both of which are members of the human zinc finger protein KRAB subfamily and have similarities Physiological functions.
  • the new human zinc finger protein of the present invention is similar to it, and is involved in regulating the transcriptional expression of various genes in vivo.
  • the abnormal expression of this protein is usually closely related to the occurrence of some developmental disorders, neurological diseases, tumors and cancers of related tissues, Digeorg and so on. This protein can be used to diagnose and treat various diseases mentioned above.
  • the human zinc finger protein 30 protein plays an important role in regulating important functions of the body such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes, so there has been a need in the art to identify more of these processes Human zinc finger protein 30 protein, especially the amino acid sequence of this protein. Isolation of the new human zinc finger protein 30 protein encoding gene also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for developing diagnostic and / or therapeutic drugs, so isolating its coding DNA is important. Disclosure of invention
  • Another object of the invention is to provide a polynucleotide encoding the polypeptide.
  • Another object of the present invention is to provide a method for producing human zinc finger protein 30.
  • Another object of the present invention is to provide an antibody against the polypeptide of the present invention-human zinc finger protein 30.
  • Another object of the present invention is to provide mimic compounds, antagonists, agonists, and inhibitors against the polypeptide of the present invention-human zinc finger protein 30.
  • Another object of the present invention is to provide a method for diagnosing and treating diseases associated with abnormalities in human zinc finger protein 30.
  • the present invention relates to an isolated polypeptide, which is of human origin, and includes: a polypeptide having the amino acid sequence of SEQ ID D. 2, or a conservative variant, biologically active fragment, or derivative thereof.
  • the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
  • sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 89-922 in SEQ ID NO: 1; and (b) a sequence having 1 -1 in SEQ ID NO: 1 1 1 5 bit sequence.
  • the present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
  • the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
  • the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of human zinc finger protein 30 protein, which comprises utilizing the polypeptide of the invention.
  • the invention also relates to compounds obtained by this method.
  • the present invention also relates to a method for detecting a disease or disease susceptibility associated with abnormal expression of human zinc finger protein 30 protein in vitro, comprising detecting a mutation in the polypeptide or a polynucleotide sequence encoding the same in a biological sample, or detecting a biological sample.
  • the amount or biological activity of a polypeptide of the invention is not limited to a method for detecting a disease or disease susceptibility associated with abnormal expression of human zinc finger protein 30 protein in vitro, comprising detecting a mutation in the polypeptide or a polynucleotide sequence encoding the same in a biological sample, or detecting a biological sample.
  • the invention also relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
  • the present invention also relates to the use of the polypeptides and / or polynucleotides of the present invention in the preparation of a medicament for treating cancer, developmental or immune diseases, or other diseases caused by abnormal expression of human zinc finger protein 30.
  • Nucleic acid sequence refers to oligonucleotides, nucleotides or polynucleotides and fragments or parts thereof, and can also refer to genomic or synthetic DNA or RNA, which can be single-stranded or double-stranded, representing the sense strand or Antisense strand.
  • amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
  • a “variant" of a protein or polynucleotide refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it.
  • the changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence.
  • Variants can have "conservative" changes, in which the amino acid substituted has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine.
  • Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
  • “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
  • Insertion refers to an alteration in the amino acid sequence or nucleotide sequence that results in an increase in one or more amino acids or nucleotides compared to a naturally occurring molecule.
  • Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
  • Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
  • immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response in appropriate animals or cells and to bind to specific antibodies.
  • An "agonist” refers to a molecule that, when combined with human zinc finger protein 30, can cause the protein to change, thereby regulating the activity of the protein.
  • An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that can bind human zinc finger protein 30.
  • Antagonist refers to a molecule that can block or regulate the biological or immunological activity of human zinc finger protein 30 when combined with human zinc finger protein 30.
  • Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates, or any other molecule that can bind human zinc finger protein 30.
  • Regular refers to a change in the function of human zinc finger protein 30, including an increase or decrease in protein activity, a change in binding properties, and any other biological, functional, or immune properties of human zinc finger protein 30 Change.
  • substantially pure is meant substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated.
  • Those skilled in the art can purify human zinc finger protein 30 using standard protein purification techniques.
  • Substantially pure human zinc finger protein 30 produces a single main band on a non-reducing polyacrylamide gel.
  • the purity of human zinc finger protein 30 peptide can be analyzed by amino acid sequence.
  • Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
  • sequence C-T-G-A
  • complementary sequence G-A-C-T.
  • the complementarity between two single-stranded molecules may be partial or complete.
  • the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
  • “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
  • Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. The inhibition of such hybridization can be detected by performing hybridization (Southern imprinting or Northern blotting, etc.) under conditions of reduced stringency. Substantially homologous sequences or hybridization probes can compete and inhibit the binding of fully homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that conditions with reduced stringency allow non-specific binding, because conditions with reduced stringency require that the two sequences bind to each other as either specific or selective interactions.
  • Percent identity refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences.
  • the percentage identity can be determined electronically, such as by the MEGALIGN program (Lasergene software package, DNASTAR, Inc., Madison Wis.).
  • the MEGALIGN program can compare two or more sequences according to different methods such as the Cluster method (Higgins, DG and PM Sharp (1988) Gene 73: 237-244). 0
  • the C Luster method groups each group by checking the distance between all pairs. The sequences are arranged in clusters. The clusters are then assigned in pairs or groups.
  • sequence A and sequence B The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula: The number of residues matched between sequence A and sequence X 100 The number of residues in sequence A-the number of spacer residues in sequence A Number of interval residues in a sequence B
  • the percent identity between nucleic acid sequences can also be determined by the Cluster method or by methods known in the art such as Jotun Hein (Hein J., (1990) Methods in emzumology 183: 625-645) 0 "similarity" refers to the amino acid sequence The degree of identical or conservative substitutions of amino acid residues at corresponding positions when aligning between them.
  • Amino acids used for conservative substitutions may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; have uncharged Amino acids with similar hydrophilicity in the head group may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine Acid and tyrosine.
  • Antisense refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence.
  • Antisense strand refers to a nucleic acid strand that is complementary to a “sense strand.”
  • Derivative refers to a chemical modification of HFP or a nucleic acid encoding it. This chemical modification may be a substitution of a hydrogen atom with a fluorenyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
  • Antibody refers to a complete antibody molecule and its fragments, such as Fa,? (& 1) ') 2 and? ⁇ It can specifically bind to the epitope of human zinc finger protein 30.
  • a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
  • isolated refers to the removal of a substance from its original environment (for example, its natural environment if it is naturally occurring).
  • a naturally-occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
  • Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not part of its natural environment, they are still isolated.
  • isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
  • polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances in the natural state .
  • isolated human zinc finger protein 30 means that human zinc finger protein 30 is substantially free of other proteins, lipids, carbohydrates, or other substances with which it is naturally associated. Those skilled in the art can purify human zinc finger protein 30 using standard protein purification techniques. Substantially pure polypeptides produce a single main band on non-reducing polyacrylamide gels. The purity of the human zinc finger protein 30 polypeptide can be analyzed by amino acid sequence.
  • the present invention provides a new polypeptide, human zinc finger protein 30, which basically consists of the amino acid sequence shown in SEQ ID NO: 2.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
  • the polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques.
  • polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
  • the invention also includes fragments, derivatives and analogs of human zinc finger protein 30. As used in the present invention, the terms “fragment”, “derivative” and “analog” refer to a polypeptide that substantially maintains the same biological function or activity of the human zinc finger protein 30 of the present invention.
  • a fragment, derivative, or analog of the polypeptide of the present invention may be: (I) a type in which one or more amino acid residues are replaced with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution is The amino acid may or may not be encoded by a genetic codon; or ( ⁇ ) such a type in which one or more amino acid residues are substituted with other groups to include a substituent; or (III) such A type in which a mature polypeptide is fused to another compound (such as a compound that extends the half-life of a polypeptide, such as polyethylene glycol); or (IV) a type of polypeptide sequence in which an additional amino acid sequence is fused into a mature polypeptide (such as the leader sequence or secreted sequence or the sequence used to purify this polypeptide or protease sequence) As explained herein, such fragments, derivatives and analogs are considered to be within the knowledge of those skilled in the art.
  • the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
  • the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a polynucleotide sequence of 1 115 bases in length and its open reading frame (89-922) encodes 277 amino acids. According to the amino acid sequence homology comparison, it was found that this polypeptide has 39% homology with the human zinc finger protein PZNF1 36. It can be deduced that the human zinc finger protein 30 has a similar structure and function to the human zinc finger protein pZNF1 36.
  • the polynucleotide of the present invention may be in the form of DNA or RNA.
  • DNA forms include cDNA, genomic DNA, or synthetic DNA.
  • DNA can be single-stranded or double-stranded.
  • DNA can be coding or non-coding.
  • the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
  • a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but having a sequence different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
  • the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
  • polynucleotide encoding a polypeptide refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.
  • the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
  • Variants of this polynucleotide may be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants Body, deletion variant, and insertion variant.
  • an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
  • the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity, between the two sequences).
  • the present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions.
  • "strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60 ° C; or (2) hybridization When using denaturing agents, such as 50% (v / v) formamide, 0.1 ° /.
  • Hybridization occurs only when the identity between the two sequences is at least 95%, and more preferably 97%.
  • the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
  • nucleic acid fragments that hybridize to the sequences described above.
  • a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 nuclei. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques such as PCR to identify and / or isolate polynucleotides encoding human zinc finger protein 30.
  • polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
  • the specific polynucleotide sequence encoding the human zinc finger protein 30 of the present invention can be obtained by various methods.
  • polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
  • the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.
  • genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences.
  • the standard method for isolating the cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library.
  • the construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989).
  • Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
  • genes can be screened from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DNA-RNA hybridization; (2) the appearance or loss of marker gene function; (3) measurement Set the transcript level of human zinc finger protein 30; (4) Detect the protein product of gene expression by immunological techniques or by measuring biological activity. The above methods can be used singly or in combination.
  • the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
  • the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
  • the probe used here is generally a DNA sequence chemically synthesized based on the gene sequence information of the present invention.
  • the genes or fragments of the present invention can of course be used as probes.
  • DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
  • the protein product of human zinc finger protein 30 gene expression can be detected by immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA).
  • immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA).
  • a method of applying a PCR technique to amplify DNA / RNA is preferably used to obtain the gene of the present invention.
  • the RACE method RACE-Rapid Amplification of cDNA Ends
  • the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Select and synthesize using conventional methods.
  • the amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
  • polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, the sequencing must be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
  • the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell that is genetically engineered using the vector of the present invention or directly using a human zinc finger protein 30 coding sequence, and a method for producing the polypeptide of the present invention by recombinant technology.
  • a polynucleotide sequence encoding human zinc finger protein 30 may be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
  • vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
  • Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al.
  • any plasmid and vector can be used to construct a recombinant expression vector.
  • An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements. Methods known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding human zinc finger protein 30 and appropriate transcription / translation regulatory elements.
  • DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis.
  • promoters are: the lac or trp promoter of E.
  • the expression vector also includes a ribosome binding site and a transcription terminator for translation initiation. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers on the late side of the origin of replication, and adenoviral enhancers.
  • the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • GFP fluorescent protein
  • tetracycline or ampicillin resistance for E. coli.
  • a polynucleotide encoding human zinc finger protein 30 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a genetically engineered host cell containing the polynucleotide or the recombinant vector.
  • host cell refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell.
  • Escherichia coli, Streptomyces bacterial cells such as Salmonella typhimurium
  • fungal cells such as yeast
  • plant cells insect cells
  • fly S2 or Sf9 animal cells
  • animal cells such as CH0, COS or Bowes melanoma cells.
  • Transformation of a host cell with a DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art.
  • the host is a prokaryote, such as E. coli
  • competent cells capable of absorbing DNA can be harvested after the exponential growth phase and treated with the CaCl 2 method. The steps used are well known in the art. Alternatively, MgCl 2 is used. If necessary, transformation can also be performed by electroporation.
  • the host is a eukaryotic organism, the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
  • the polynucleotide sequence of the present invention can be used for expression or production Recombinant human zinc finger protein 30 (Science, 1984; 224: 1431). Generally there are the following steps:
  • the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
  • a suitable method such as temperature conversion or chemical induction
  • the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell.
  • recombinant proteins can be separated and purified by various separation methods using their physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
  • conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography
  • FIG. 1 is a comparison diagram of amino acid sequence homology of human zinc finger protein 30 and human zinc finger protein pZNFl 36 of the present invention.
  • the upper sequence is human zinc finger protein 30, and the lower sequence is human zinc finger protein pZNF136.
  • Identical amino acids are represented by single-character amino acids between the two sequences, and similar amino acids are represented by "+”.
  • Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of human zinc finger protein 30 isolated.
  • 30kDa is the molecular weight of the protein.
  • the arrow indicates the isolated protein band.
  • Example 1 Cloning of human zinc finger protein 30
  • Total human fetal brain RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform.
  • Poly (A) mRNA was isolated from total RNA using Quik mRNA Isolation Kit (Qiegene). 2ug poly (A) mRNA is reverse transcribed to form cDNA.
  • a Smart cDNA cloning kit purchased from Clontech was used to orient the 00 ⁇ fragment into the multicloning site of the pBSK (+) vector (Clontech) to transform DH5 ⁇ to form a cDNA library.
  • Dye terminate cycle react ion sequencing kit Perkin-Elmer
  • ABI 377 automatic sequencer Perkin-Elmer
  • the determined cDNA sequence was compared with the existing public DNA sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 0635hl2 was new DNA.
  • a series of primers were synthesized to determine the inserted cDNA fragments of the clone in both directions.
  • CDNA was synthesized using fetal brain total RNA as a template and oligo-dT as a primer for reverse transcription reaction. After purification using Qiagene's kit, the following primers were used for PCR amplification:
  • Primerl 5'- CAAACACACATAATGCACTCTGTA -3 '(SEQ ID NO: 3)
  • Primer2 5'- ATAAAAAGATGTCTGGCATTTTAT -3 '(SEQ ID NO: 4)
  • Primerl is a forward sequence starting at lbp at the 5 ′ end of SEQ ID NO: 1;
  • Primer2 is the 3 'end reverse sequence in SEQ ID NO: 1.
  • Amplification conditions 50 ol / L KC1, 10 mmol / L Tris-CI, (pH8.5), 1.5 mmol / L MgCl 2 , 200 ⁇ mol / L dNTP, lOpmol primers in a 50 ⁇ 1 reaction volume , 1U of Taq DNA polymerase (C 1 on Tech).
  • the reaction was performed on a PE 9600 DNA thermal cycler (Perkin-Elmer) for 25 cycles under the following conditions: 94 ° C 30sec; 55 ° C 30sec; 72 Q C 2min.
  • RT-PCR 3 -act in For positive control and template blank as negative control.
  • the amplified product was purified using a QIAGEN kit and ligated to a PCR vector using a TA cloning kit (Invitrogen).
  • the DNA sequence analysis results showed that the DM sequence of the PCR product was exactly the same as the 1-1111bp shown in SEQ ID NO: 1.
  • Example 4 Northern blot analysis of human zinc finger protein 30 gene expression:
  • This method involves acid guanidinium thiocyanate phenol-chloroform extraction. That is, the tissue is homogenized with 4M guanidine isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1) are added. ), Mix and centrifuge. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water.
  • the 32P- labeled probe (approximately 2 X 10 6 cpm / ml) and RNA was transferred to a nitrocellulose membrane overnight at 42 ° C in a hybridization solution, the solution comprising 50% formamide -25mM KH 2 P0 4 (pH7.4) -5 x SSC-5 x Denhardt's solution and 200 g / ml salmon sperm DNA. After hybridization, the filter was washed in 1 x SSC-0.1% SDS at 55 ° C for 30 min. Then, Phosphor Imager was used for analysis and quantification.
  • Example 5 In vitro expression, isolation and purification of recombinant human zinc finger protein 30
  • Primer3 5'- CCCCATATGATGAAAAATCTTACACTGGAGAGA -3 '(Seq ID No: 5)
  • Priraer4 5'- CATGGATCCTCAAAGAATCTTGTCAGGTCTGAA -3' (Seq ID No: 6)
  • These two primers contain Ndel and BamHI restriction sites, respectively.
  • the coding sequences of the 5 'and 3' ends of the gene of interest are followed, respectively.
  • the Ndel and BamHI restriction sites correspond to the selectivity within the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865.3). Digestion site.
  • the pBS-0635hl2 plasmid containing the full-length target gene was used as a template for the PCR reaction.
  • the PCR reaction conditions were as follows: a total volume of 50 ⁇ 1 containing 10 pg of pBS-0635hl2 plasmid, primers Primer 3 and Primer- 4 points, and 1 J was 1 Opmol, Advantage polymerase Mix (Clontech) 1 ⁇ 1.
  • Ndel and BamHI were used to double digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase.
  • the ligation product was transformed into Ca. bacillus DH5a by the calcium chloride method. After being cultured on LB plates containing kanamycin (final concentration 30 ⁇ ⁇ / ⁇ 1) overnight, positive clones were selected by colony PCR method and performed. Sequencing. A positive clone (pET-0635hl2) with the correct sequence was selected, and the recombinant plasmid was transformed into E. coli BL21 (DE3) plySs (product of Novagen) by the calcium chloride method. The host strain BL21 (pET-0635hl2) was 37 in LB liquid medium containing kanamycin (final concentration 30 g / ml). C.
  • a peptide synthesizer (product of PE company) was used to synthesize the following human zinc finger protein 30-specific peptides:
  • the polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex, respectively.
  • hemocyanin and bovine serum albumin For the method, see: Avraraeas, et al. Immimochemistry, 1969; 6: 43. Rabbits were immunized with 4 mg of the hemocyanin peptide complex plus complete Freund's adjuvant, and 15 days later, the hemocyanin peptide complex plus incomplete Freund's adjuvant was used to boost immunity once.
  • a titer plate coated with a 15 g / ml bovine serum albumin peptide complex was used as an ELISA to determine antibody titers in rabbit serum.
  • Protein A-Sepharose was used to isolate total IgG from antibody-positive rabbit sera.
  • the peptide was bound to a cyanogen bromide-activated Sepharose4B column, and anti-peptide antibodies were separated from the total IgG by affinity chromatography.
  • the immunoprecipitation method demonstrated that the purified antibody specifically binds to human zinc finger protein 30.
  • Example 7 Application of the polynucleotide fragment of the present invention as a hybridization probe
  • Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
  • the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
  • the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
  • the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method.
  • Filter hybridization methods include dot blotting, Southern blotting, Northern blotting, and copying methods. They all use the same steps of hybridization after fixing the polynucleotide sample to be tested on the filter.
  • the sample-fixed filter is first applied
  • the probe-free hybridization buffer is pre-hybridized so that the non-specific binding site of the sample on the filter is saturated with the carrier and the synthetic polymer.
  • the pre-hybridization solution is then replaced with a hybridization buffer containing the labeled probe and incubated to hybridize the probe to the target nucleic acid.
  • the unhybridized probes are removed by a series of membrane washing steps.
  • This embodiment utilizes higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals.
  • the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
  • the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
  • the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
  • oligonucleotide fragments for use as hybridization probes from the polynucleotide SEQ ID NO: 1 of the present invention should follow the following principles and several aspects to be considered:
  • the preferred range of probe size is 18-50 nucleotides
  • the GC content is 30% -70%, and the non-specific hybridization increases when it exceeds;
  • Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements The regions are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, the primary probe should not be used;
  • Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
  • Probe 1 which belongs to the second type of probe, is equivalent to the replacement mutation sequence of the gene fragment of SEQ ID NO: 1 or its complementary fragment (41Nt):
  • PBS phosphate buffered saline
  • step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
  • NC membranes nitrocellulose membranes
  • Two NC membranes are required for each probe for subsequent experiments.
  • the film is washed with high-strength conditions and strength conditions, respectively.
  • pre-hybridization solution 10xDenhardt's; 6xSSC, 0.1 mg / ml CT DNA (calf thymus DNA).
  • Gene microarrays or DNA microarrays are new technologies currently being developed by many national laboratories and large pharmaceutical companies. It refers to the orderly and high-density arrangement of large numbers of target gene fragments on glass, The data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software to achieve the purpose of rapid, efficient, and high-throughput analysis of biological information.
  • the polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research of new gene functions; search for and screen new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases .
  • the specific method steps have been reported in the literature. For example, see the literature DeRisi, JL, Lyer, V. & Brown, P.0. (1997) Science 278, 680-686. And the literature Helle, RA, Schema, M. , Chai, A., Shalom, D., (1997) PNAS 94: 2150-2155.
  • a total of 4,000 polynucleotide sequences of various full-length cDNAs are used as target DNA, including the polynucleotide of the present invention. Amplify them separately by PCR, and adjust the concentration of the amplified products to At about 500ng / ul, a Cartesian 7500 spotter (purchased from Cartesian, USA) was used to spot the glass medium. The distance between the spots was 280 ⁇ . The spotted slides were hydrated, dried, and cross-linked in a UV cross-linking instrument. After elution, the DNA was fixed on a glass slide to prepare a chip. The specific method steps have been variously reported in the literature. The post-spot processing steps of this embodiment are:
  • Total mRNA was extracted from normal liver and liver cancer in one step, and mRNA was purified using Oligotex mRNA Midi Kit (purchased from QiaGen).
  • the fluorescent reagent Cy3dUTP (5- Amino- propargy 1-2 '-deoxyur i dine 5'-tr iphate coupled to Cy3 fluorescent dye (purchased from Amersham Phamacia Biotech) was used to label the mRNA of normal liver tissue, and the fluorescent reagent Cy5dUTP (5-Amino-propa rgy 1-2 '-deoxyur dine 5'- tr iphate coupled to Cy5 fluorescent dye (purchased from Amersham Phamacia Biotech) was used to label liver cancer tissue mRNA, and the probe was prepared after purification.
  • Cy3dUTP 5- Amino- propargy 1-2 '-deoxyur i dine 5'-tr iphate coupled to Cy3 fluorescent dye (purchased from Amersham P
  • polypeptides of the present invention can be directly used in the treatment of diseases, for example, they can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection and immune diseases.
  • Zinc-binding proteins are usually involved in gene expression and regulation as transcription factors and signal transduction molecules. Zinc finger proteins are expressed in various tissues of different organisms, including hematopoietic cells, brain, nervous system, various tumors and tumors. Related tissues and tissues of immortalized cell lines.
  • the C2 H2 type zinc finger domain-containing protein not only plays an important role in regulating gene expression in some tissues, but also plays a key role in developmental regulation.
  • Kruppe l-type zinc finger proteins containing the KRAB domain constitute a subfamily. The KRAB domain is related to the correct localization and function of the protein.
  • C2H2 type zinc finger domains are related to the following diseases: solid tumors such as thyroid adenoma, uterine fibroids, neurological diseases such as extrapyramidal dysfunction, Parkinson's syndrome, ataxia, nerve cells Tumors, glioblastomas, hematological malignancies such as leukemia, non-Hodgkin's lymphoma, developmental disorders such as Willi Ams syndrome, cleft-hand and cracked feet syndrome, Bayesian syndrome, other tumors such as neuroblasts Cell tumor, colon cancer, breast cancer, etc.
  • solid tumors such as thyroid adenoma, uterine fibroids
  • neurological diseases such as extrapyramidal dysfunction, Parkinson's syndrome, ataxia
  • nerve cells Tumors such as leukemia, non-Hodgkin's lymphoma
  • developmental disorders such as Willi Ams syndrome, cleft-hand and cracked feet syndrome
  • Bayesian syndrome other tumors such as neuroblasts Cell tumor, colon cancer, breast cancer, etc.
  • the polypeptide of the present invention and the known human zinc finger protein PZNF 1 36 are homologous proteins, and both are members of the human zinc finger protein KRAB subfamily and have similar physiological functions.
  • the new human zinc finger protein 30 of the present invention is similar to it, and participates in various RNA metabolism processes in the body, and regulates the expression and function of various genes from the RNA level.
  • human zinc finger protein 30 of the present invention will produce various diseases, especially various tumors, neurological diseases, hematological malignant diseases, and developmental disorders.
  • diseases include, but are not limited to: Tumors: Thyroid tumors, uterine fibroids, neuroblastomas, ependymomas, colon cancer, breast cancer, leukemia, lymphoma, malignant histiocytosis, melanoma, sarcoma, gastric cancer, liver cancer, lung cancer, esophageal cancer, bone marrow Tumor, teratoma, adrenal cancer, bladder cancer, bone cancer, osteosarcoma, brain cancer, uterine cancer, gallbladder cancer, liver cancer, thymic tumor, uterine fibroid, astrocytoma, ependymoma, glioblastoma , Neurofibromas, colon cancer, myeloma, bone marrow cancer, endometrial cancer, gallbladder cancer, nasal cavity
  • Nervous system diseases neural tube insufficiency such as spina bifida, anencephaly malformation, brain (meningeal) bulge, craniocerebral fissure, neural tube cyst, brain developmental abnormalities such as foramen malformation, tetanus, hydrocephalus, neuron migration Obstacles such as abnormal brain gyrus formation, other malformations such as aqueduct malformations, cerebellar dysplasia, Down syndrome, spinal deformity, congenital hydrocephalus, congenital cerebral nucleus dysplasia syndrome, glioma, meningiomas, Neurofibromas, Pituitary Adenoma, Intracranial Granuloma, Alzheimer's Disease, Parkinson's Disease, Dance, Depression, Amnesia, Huntington's Disease, Epilepsy, Migraine, Dementia, Multiple Sclerosis, Mental Schizophrenia, depression, paranoia, anxiety, obsessive-compulsive disorder, phobia, neuro
  • Hematological malignancies Leukemia, non-Hodgkin's lymphoma
  • the abnormal expression of the human zinc finger protein 30 of the present invention will also produce certain genetic diseases, endocrine system diseases such as endocrine adenoma, and immune system diseases.
  • the polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat various diseases, especially various tumors, nervous system diseases, hematological malignant diseases, development disorders, etc. Some genetic diseases, endocrine system diseases such as endocrine adenoma, immune system diseases, etc.
  • the invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) human zinc finger protein 30. Agonists enhance human zinc finger protein 30 to stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
  • mammalian cells or membrane preparations expressing human zinc finger protein 30 can be cultured with labeled human zinc finger protein 30 in the presence of a drug. The ability of the drug to increase or block this interaction is then determined.
  • Antagonists of human zinc finger protein 30 include antibodies, compounds, receptor deletions, and the like that have been screened. Antagonists of human zinc finger protein 30 can bind to human zinc finger protein 30 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot perform biological functions.
  • human zinc finger protein 30 can be added to a bioanalytical assay to determine whether the compound is an antagonist by measuring the effect of the compound on the interaction between human zinc finger protein 30 and its receptor.
  • Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds.
  • Polypeptide molecules capable of binding to human zinc finger protein 30 can be The combinable amino acids are obtained by binding to a random peptide library composed of a solid phase.
  • 30 molecules of human zinc finger protein should generally be labeled.
  • the present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies.
  • the invention also provides antibodies against human zinc finger protein 30 epitopes. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by Fab expression libraries.
  • Polyclonal antibodies can be produced by injecting human zinc finger protein 30 directly into immunized animals (such as rabbits, mice, rats, etc.).
  • immunized animals such as rabbits, mice, rats, etc.
  • a variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's adjuvant.
  • Techniques for preparing monoclonal antibodies to human zinc finger protein 30 include, but are not limited to, hybridoma technology (Kohler and Milstein. Nature, 1975, 256: 495-497), triple tumor technology, human beta-cell hybridoma technology, and EBV-hybridization Tumor technology, etc.
  • Chimeric antibodies that bind human constant regions and non-human-derived variable regions can be produced using existing techniques (Morrison et al, PNAS, 1985, 81: 6851).
  • the existing technology for producing single chain antibodies (U. S. Pat No. 4946778) can also be used to produce single chain antibodies against human zinc finger protein 30.
  • Anti-human zinc finger protein 30 antibodies can be used in immunohistochemical techniques to detect human zinc finger protein 30 in biopsy specimens.
  • Monoclonal antibodies that bind to human zinc finger protein 30 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
  • Antibodies can also be used to design immunotoxins that target a particular part of the body.
  • human zinc finger protein 30 high affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
  • a common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
  • This hybrid antibody can be used to kill 30 positive cells of human zinc finger protein.
  • the antibodies of the present invention can be used to treat or prevent diseases related to human zinc finger protein 30.
  • Administration of an appropriate dose of antibody can stimulate or block the production or activity of human zinc finger protein 30.
  • the invention also relates to a diagnostic test method for quantitative and localized detection of human zinc finger protein 30 levels. These tests are well known in the art and include FISH assays and radioimmunoassays. The level of human zinc finger protein 30 detected in the test can be used to explain the importance of human zinc finger protein 30 in various diseases and to diagnose diseases in which human zinc finger protein 30 plays a role.
  • the polypeptide of the present invention can also be used for peptide mapping analysis.
  • the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
  • the polynucleotide encoding human zinc finger protein 30 can also be used for a variety of therapeutic purposes.
  • Gene therapy technology can be used to treat abnormal cell proliferation, development or metabolism caused by the non-expression or abnormal / inactive expression of human zinc finger protein 30.
  • Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated human zinc finger protein 30 to inhibit endogenous human zinc finger protein 30 activity.
  • a mutated human zinc finger protein 30 may be a shortened human zinc finger protein 30 lacking a signaling domain. Although it can bind to downstream substrates, it lacks signaling activity. Therefore, the recombinant gene therapy vector can be used for treating diseases caused by abnormal expression or activity of human zinc finger protein 30.
  • Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to transfer a polynucleotide encoding human zinc finger protein 30 into cells. Methods for constructing a recombinant viral vector carrying a polynucleotide encoding human zinc finger protein 30 can be found in existing literature (Sambrook, etal.). In addition, a recombinant polynucleotide encoding human zinc finger protein 30 can be packaged into liposomes and transferred into cells.
  • Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
  • a vector such as a virus, phage, or plasmid
  • Oligonucleotides including antisense RNA and DNA
  • ribozymes that inhibit human zinc finger protein 30 mRNA are also within the scope of the present invention.
  • a ribozyme is an enzyme-like RNA molecule that specifically decomposes specific RNA. Its mechanism is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation.
  • Antisense RNA, DNA, and ribozymes can be obtained using any existing RNA or DNA synthesis techniques, such as solid-phase phosphate amide chemical synthesis to synthesize oligonucleotides.
  • Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA.
  • This DNA sequence has been integrated downstream of the vector's RNA polymerase promoter.
  • it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the phosphorothioate or peptide bond instead of the phosphodiester bond is used for the ribonucleoside linkage.
  • the polynucleotide encoding human zinc finger protein 30 is useful for the diagnosis of diseases related to human zinc finger protein 30.
  • the polynucleotide encoding human zinc finger protein 30 can be used to detect the expression of human zinc finger protein 30 or the abnormal expression of human zinc finger protein 30 in a disease state.
  • a DNA sequence encoding human zinc finger protein 30 can be used to hybridize biopsy specimens to determine the expression of human zinc finger protein 30.
  • Hybridization techniques include Sou thern blotting, Nor thern blotting, and in situ hybridization. These techniques and methods are publicly available and mature, and related kits are commercially available.
  • a part or all of the polynucleotides of the present invention can be used as probes to be fixed on a microarray (Microcroix) or a DNA chip (also known as a "gene chip") for analyzing differential expression analysis of genes in tissues and Genetic diagnosis.
  • Human zinc finger protein 30 specific primers can also be used to detect human zinc finger protein 30 transcripts by RNA-polymerase chain reaction (RT-PCR) in vitro amplification.
  • Human zinc finger protein 30 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild type human zinc finger protein 30 DNA sequence. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression, so Northern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
  • the sequences of the invention are also valuable for chromosome identification.
  • the sequence specifically targets a specific position on a human chromosome and can hybridize to it.
  • specific sites for each gene on the chromosome need to be identified.
  • only a few chromosome markers based on actual sequence data are available for marking chromosome positions.
  • an important first step is to locate these DNA sequences on a chromosome.
  • PCR primers (preferably 15-35bp) are prepared from the cDNA, and the sequences can be located on the chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
  • PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
  • oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
  • Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.
  • Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step.
  • FISH Fluorescent in situ hybridization
  • the physical location of the sequence on the chromosome can be correlated with the genetic map data. These data can be found in, for example, V. Mckusick, Mendel ian Inheritance in Man (available online with Johns Hopkins University Welch Medical Library). Linkage analysis can then be used to determine the relationship between genes and diseases that have been mapped to chromosomal regions.
  • the differences in cDNA or genomic sequences between the affected and unaffected individuals need to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in the chromosome, such as deletions or translocations that are visible at the chromosomal level or detectable using cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).
  • the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
  • suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
  • the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients that do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
  • the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell.
  • the polypeptides of the invention can be used in combination with other therapeutic compounds.
  • the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
  • Human zinc finger protein 30 is administered in an amount effective to treat and / or prevent a specific indication.
  • the amount and range of human zinc finger protein 30 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Toxicology (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

L'invention concerne un nouveau polypeptide, une protéine humaine 30 à doigt de zinc, et un polynucléotide codant pour ce polypeptide ainsi qu'un procédé d'obtention de ce polypeptide par des techniques recombinantes d'ADN. L'invention concerne en outre les applications de ce polypeptide dans le traitement de maladies, notamment des tumeurs malignes, de l'hémopathie, de l'infection par VIH, de maladies immunitaires et de diverses inflammations. L'invention concerne aussi l'antagoniste agissant contre le polypeptide et son action thérapeutique ainsi que les applications de ce polynucléotide codant pour la protéine humaine 30 à doigt de zinc.
PCT/CN2001/000025 2000-01-21 2001-01-15 Nouveau polypeptide, proteine humaine 30 a doigt de zinc, et polynucleotide codant pour ce polypeptide WO2001053483A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU29963/01A AU2996301A (en) 2000-01-21 2001-01-15 A novel polypeptide, a human zinc finger protein 30 and the polynucleotide encoding the polypeptide

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN 00111480 CN1306966A (zh) 2000-01-21 2000-01-21 一种新的多肽——人锌指蛋白30和编码这种多肽的多核苷酸
CN00111480.8 2000-01-21

Publications (1)

Publication Number Publication Date
WO2001053483A1 true WO2001053483A1 (fr) 2001-07-26

Family

ID=4581390

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2001/000025 WO2001053483A1 (fr) 2000-01-21 2001-01-15 Nouveau polypeptide, proteine humaine 30 a doigt de zinc, et polynucleotide codant pour ce polypeptide

Country Status (3)

Country Link
CN (1) CN1306966A (fr)
AU (1) AU2996301A (fr)
WO (1) WO2001053483A1 (fr)

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
DATABASE GENBANK [online] 15 October 1997 (1997-10-15), Database accession no. AF024693 *
DATABASE GENBANK [online] 9 November 1995 (1995-11-09), Database accession no. U09367 *
GENOMICS, vol. 27, no. 2, 20 May 1995 (1995-05-20), pages 259 - 264 *
NEW BIOL., vol. 2, no. 4, April 1990 (1990-04-01), pages 363 - 374 *

Also Published As

Publication number Publication date
CN1306966A (zh) 2001-08-08
AU2996301A (en) 2001-07-31

Similar Documents

Publication Publication Date Title
WO2001072812A1 (fr) Nouveau polypeptide, bromodomaine humain 10, et polynucleotide codant pour ce polypeptide
WO2001053483A1 (fr) Nouveau polypeptide, proteine humaine 30 a doigt de zinc, et polynucleotide codant pour ce polypeptide
WO2001079432A2 (fr) Nouveau polypeptide, facteur humain de transcription de la differentiation cellulaire 58, et polynucleotide codant pour ce polypeptide
WO2001081594A1 (fr) Nouveau polypeptide, proteine pax humaine 17, et polynucleotide codant pour ce polypeptide
WO2001049724A1 (fr) Nouveau polypeptide, proteine lissencephale humaine 43, et polynucleotide codant pour ce polypeptide
WO2001079429A2 (fr) Nouveau polypeptide, facteur humain d'echange guanine nucleotide 10, et polynucleotide codant pour ce polypeptide
WO2001072796A1 (fr) Nouveau polypeptide, facteur humain de transcription de la differentiation cellulaire 11, et polynucleotide codant pour ce polypeptide
WO2001070800A1 (fr) Nouveau polypeptide, proteine humaine 11 helicase atp-dependante, et polynucleotide codant pour ce polypeptide
WO2001048004A1 (fr) Nouveau polypeptide, proteine de liaison de l'heparine 10, et polynucleotide codant pour ce polypeptide
WO2001079434A2 (fr) Nouveau polypeptide, signal peptidase humaine 10, et polynucleotide codant pour ce polypeptide
WO2001047975A1 (fr) Nouveau polypeptide, proteine 10 contenant un domaine chromo, et polynucleotide codant pour ce polypeptide
WO2001046409A1 (fr) Nouveau polypeptide, proteine ribosomale s7 9, et polynucleotide codant pour ce polypeptide
WO2001075048A2 (fr) Nouveau polypeptide, proteine ribosomale humaine s11 23, et polynucleotide codant pour ce polypeptide
WO2001070965A1 (fr) Nouveau polypeptide, facteur humain de regulation de la transcription 15, et polynucleotide codant pour ce polypeptide
WO2001053341A1 (fr) Nouveau polypeptide, proteine humaine 13 a doigt de zinc, et polynucleotide codant pour ce polypeptide
WO2001081399A1 (fr) Nouveau polypeptide, proteine pax humaine 14, et polynucleotide codant pour ce polypeptide
WO2001073011A1 (fr) Nouveau polypeptide, proteine humaine a doigt de zinc 38, et polynucleotide codant pour ce polypeptide
WO2001066731A1 (fr) Nouveau polypeptide, proteine humaine a doigt de zinc 32, et polynucleotide codant pour ce polypeptide
WO2001079437A2 (fr) Nouveau polypeptide, facteur humain de transcription de la differentiation cellulaire 14, et polynucleotide codant pour ce polypeptide
WO2001055188A1 (fr) Nouveau polypeptide, proteine humaine a doigt de zinc 46, et polynucleotide codant pour ce polypeptide
WO2001081386A1 (fr) Nouveau polypeptide, proteine pax humaine 12.5, et polynucleotide codant pour ce polypeptide
WO2001055187A1 (fr) Nouveau polypeptide, proteine humaine 49 a doigt de zinc, et polynucleotide codant pour ce polypeptide
WO2001090171A1 (fr) Nouveau polypeptide, proteine humaine ribosomale sii 12, et polynucleotide codant ce polypeptide
WO2001079436A2 (fr) Nouveau polypeptide, facteur humain de transcription de la differentiation cellulaire 10, et polynucleotide codant pour ce polypeptide
WO2001081398A1 (fr) Nouveau polypeptide, proteine pax humaine 16, et polynucleotide codant pour ce polypeptide

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP