WO2001055188A1 - Nouveau polypeptide, proteine humaine a doigt de zinc 46, et polynucleotide codant pour ce polypeptide - Google Patents

Nouveau polypeptide, proteine humaine a doigt de zinc 46, et polynucleotide codant pour ce polypeptide Download PDF

Info

Publication number
WO2001055188A1
WO2001055188A1 PCT/CN2001/000044 CN0100044W WO0155188A1 WO 2001055188 A1 WO2001055188 A1 WO 2001055188A1 CN 0100044 W CN0100044 W CN 0100044W WO 0155188 A1 WO0155188 A1 WO 0155188A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
polynucleotide
zinc finger
finger protein
human zinc
Prior art date
Application number
PCT/CN2001/000044
Other languages
English (en)
Chinese (zh)
Inventor
Yumin Mao
Yi Xie
Original Assignee
Biodoor Gene Technology Ltd. Shanghai
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Biodoor Gene Technology Ltd. Shanghai filed Critical Biodoor Gene Technology Ltd. Shanghai
Priority to AU2001229980A priority Critical patent/AU2001229980A1/en
Publication of WO2001055188A1 publication Critical patent/WO2001055188A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/4702—Regulators; Modulating activity
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • the present invention belongs to the field of biotechnology. Specifically, the present invention describes a new polypeptide, a human zinc finger protein 46, and a polynucleotide sequence encoding the polypeptide. The invention also relates to methods and applications for preparing such polynucleotides and polypeptides. Background technique
  • Zinc finger protein is a member of a multi-gene family encoding a zinc ion-mediated nucleotide binding protein. It has very important physiological functions in the body and is involved in regulating the transcription and expression of various genes in the body. Studies have found that members of the zinc finger protein family are expressed in various tissues in different organisms, including hematopoietic cells, brain, nervous system, various tumor-related tissues, and tissues of immortalized cell lines. Tissue genes play an extremely important role in the transcription and expression process.
  • the zinc finger structures of zinc finger proteins mainly have the following types: C2H2 configuration, C2C2 configuration, C2HC configuration, C2HC4C configuration, C3H configuration, C3HC4 configuration (Da i S et al., 1998).
  • Zinc finger proteins of various configurations have been isolated from a variety of organisms such as yeast, fruit fly, rat and human. Among them, the zinc finger protein genes containing the C2H2 configuration constitute the largest family of genes in the human genome (Berker et a l., 1995). C2H2 zinc finger proteins are involved in the activation and suppression of gene transcription.
  • the C2H2 type zinc atom binding domain was first obtained in the protein transcription factor I I IA and is the most widely distributed DM binding domain in eukaryotic transcription factors.
  • the protein sequence of C2H2 type zinc finger protein contains the following conserved sequence features: (Tyr 'Phe) -X-Cys-X (2, 4) -Cys-X3-Phe-X5-Leu-X2-Hi s- X (3, 5) -His (where X represents an arbitrary amino acid residue; cysteine forms a coordination bond with histidine and a zinc atom, and binds to the zinc atom; the other three conservative amino acid residues form a hydrophobic center region ; Other changed amino acid residues are responsible for mediating protein interactions with other molecules).
  • a zinc finger protein may contain one or more zinc finger domains, which independently perform their own physiological functions in the body.
  • proteins containing zinc finger domains interact with special double- and single-stranded DM sequences and act as transcriptional regulators.
  • C2H2 zinc finger domains not only play an important regulatory role in the gene expression process of some tissues, but also play a very critical role in the developmental regulation process.
  • the transcription factor SI I (TFI IS) is a eukaryotic protein that is required for the transcriptional extension of RNA polymerase II. This transcription factor exhibits binding activity to DNA only in the presence of RNA polymerase II.
  • the egg White consists of about 300 amino acid residues, and it is highly conserved in mammals, fruit flies, and yeast.
  • Members of the transcription factor family all contain a highly conserved region containing four cysteine residues that bind to zinc ions and fold into a zinc band structure. In addition to cysteine, this conserved region also contains other conserved amino acid residues.
  • the conserved region consists of consensus sequence fragments as shown below: C- X (2) -CX (9)-[LIVMQSAR]- [QH]-[STQL]-[RA]-[SACR] -X- [DE]-[DET]-[PGSEA] -X (6) -CX (2, 5) -CX (3)-[FW] ;
  • All members of this protein family contain this conserved sequence fragment.
  • the sequence fragment may be a recognition site for the binding of the protein to the nucleotide sequence, and mutations in its special site will cause the protein to not normally bind to DNA, thereby affecting the expression of related genes in vivo.
  • RNA polymerase II extension complex regulates the transcriptional activity of the RM polymerase II extension complex in vivo, which regulates the expression of some proto-oncogenes and viruses, including the expression of human immunodeficiency virus HIV-1 [Qian X, Jeon C. et al., 1993, Nature, 365: 277-279].
  • the role of the protein in vivo is mainly its highly conserved sequence fragment, which regulates the transcriptional extension of RNA polymerase II by regulating the binding of protein to D in vivo. Its abnormal expression will lead to the abnormal proliferation of some genes in the body, which is usually related to the occurrence of some immunodeficiency diseases, various tumors and cancers in the body.
  • the PHD zinc finger domain is a C4HC3-type zinc finger structural motif that was first discovered in nuclear proteins. It has been found that this structural motif is contained in a variety of different proteins, which are involved in various chromatin-mediated transcriptional regulation processes in vivo.
  • the PHD domain usually involves protein-protein interactions during protein interactions. It plays an extremely important role in the aggregation and activation of some multi-component complexes in the organism, and these multi-component complexes usually involve Regulates transcriptional activation or suppression of some genes in the body. Therefore, this structural motif also plays an important role in the transcription and expression of some genes in the organism.
  • the structural motif consists of consensus sequence fragments as shown below: C (X) ⁇ 1, 2 ⁇ C (X) ⁇ 5, 45 ⁇ (V, W, F, L, W, I, E) XC ( X) ⁇ 1, 4 ⁇ C (X) ⁇ 1, 4 ⁇ (W, Y, F, V, Q, H, L, T) HXXC (X) ⁇ 5, 45 ⁇ (W, F, L, Y , I) XCXXC;
  • This consensus sequence fragment is also an important site for the physiological function of the protein, which is similar to the C4HC3 zinc finger domain, and combines with two zinc ions to form an active conformation.
  • the sequence fragment regulates the expression of some genes in the body by regulating the interaction of related proteins, thereby affecting the proliferation and differentiation of related tissue cells.
  • This domain plays an important role in the development of organisms, and its mutations will cause protein dysfunction, which is usually related to the development of some related tissues and developmental disorders.
  • the novel human zinc finger protein of the present invention contains both a zinc finger protein C2H2 type zinc finger domain, a PHD domain, and a characteristic sequence fragment of the TFIIS family of transcription factors.
  • the protein is a new transcription regulation factor. Its It may have a higher expression level in nuclear proteins, and regulate the expression of proto-oncogenes, viral genes and genes in related tissues in vivo.
  • the abnormal expression of this protein is usually associated with the occurrence of developmental disorders, immunodeficiency diseases, tumors, and cancers in organism-related tissues. It can also be used for diagnosis and treatment of various diseases mentioned above. Since the human zinc finger protein 46 protein plays an important role in important functions of the body as described above, and it is believed that a large number of proteins are involved in these regulatory processes, there has been a need in the art to identify more human zinc finger protein 46 proteins involved in these processes. In particular, the amino acid sequence of this protein is identified. Isolation of the new human zinc finger protein 46 protein encoding gene also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for developing diagnostic and / or therapeutic drugs for the disease, so isolating its coding for DM is very important. Disclosure of invention
  • Another object of the invention is to provide a polynucleotide encoding the polypeptide.
  • Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding human zinc finger protein 46.
  • Another object of the invention is to provide a genetically engineered host cell containing a polynucleotide encoding human zinc finger protein 46.
  • Another object of the present invention is to provide a method for producing human zinc finger protein 46.
  • Another object of the present invention is to provide an antibody against the polypeptide-human zinc finger protein 46 of the present invention.
  • Another object of the present invention is to provide mimic compounds, antagonists, agonists, and inhibitors directed to the polypeptide of the present invention-human zinc finger protein 46.
  • Another object of the present invention is to provide a method for diagnosing and treating diseases associated with abnormalities in human zinc finger protein 46.
  • the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
  • the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
  • sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 2-1261 in SEQ ID NO: 1; and (b) a sequence having positions 1-1 in SEQ ID NO: 1 355-bit sequence.
  • the invention further relates to a vector, in particular an expression vector, containing the polynucleotide of the invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; and a method comprising culturing said Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
  • a vector in particular an expression vector, containing the polynucleotide of the invention
  • a host cell genetically engineered with the vector including a transformed, transduced or transfected host cell
  • a method comprising culturing said Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
  • the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
  • the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of human zinc finger protein 46 protein, which comprises utilizing the polypeptide of the invention.
  • the invention also relates to compounds obtained by this method.
  • the present invention also relates to a method for detecting a disease or susceptibility to disease associated with abnormal expression of human zinc finger protein 46 protein in vitro, comprising detecting a mutation in the polypeptide or a polynucleotide sequence encoding the same in a biological sample, or detecting a biological sample.
  • the amount or biological activity of a polypeptide of the invention comprising detecting a mutation in the polypeptide or a polynucleotide sequence encoding the same in a biological sample, or detecting a biological sample.
  • the invention also relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
  • the present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention in the preparation of a medicament for treating cancer, developmental disease or immune disease or other diseases caused by abnormal expression of human zinc finger protein 46.
  • Nucleic acid sequence refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
  • amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
  • amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
  • a protein or polynucleotide “variant” refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it. The changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence. Variants can have "conservative" changes in which the substituted amino acid has a structural or chemical property similar to the original amino acid, such as the replacement of isoleucine with leucine. Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
  • “Deletion” refers to the absence of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence. Missed.
  • Insertion means that a change in the amino acid sequence or nucleotide sequence results in an increase in one or more amino acids or nucleotides compared to a molecule that exists in nature.
  • Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
  • Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
  • immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response in appropriate animals or cells and to bind to specific antibodies.
  • An "agonist” refers to a molecule that, when combined with human zinc finger protein 46, causes a change in the protein to regulate the activity of the protein.
  • An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that can bind human zinc finger protein 46.
  • Antagonist refers to a molecule that can block or regulate the biological or immunological activity of human zinc finger protein 46 when combined with human zinc finger protein 46.
  • Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates, or any other molecule that can bind human zinc finger protein 46.
  • Regular refers to a change in the function of human zinc finger protein 46, including an increase or decrease in protein activity, a change in binding properties, and any other biological, functional, or immune properties of human zinc finger protein 46.
  • substantially pure is meant substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated.
  • Those skilled in the art can purify human zinc finger protein 46 using standard protein purification techniques.
  • Substantially pure human zinc finger protein 46 produces a single main band on a non-reducing polyacrylamide gel.
  • the purity of human zinc finger protein 46 peptide can be analyzed by amino acid sequence.
  • Complementary refers to the natural binding of a nucleotide by base-pairing under conditions of acceptable salt concentration and temperature.
  • sequence "C-T-G-A” can be combined with the complementary sequence "G-A-C-T”.
  • the complementarity between two single-stranded molecules may be partial or complete.
  • the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
  • “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
  • Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Southern blotting or Nor thern blotting, etc.) under conditions of reduced stringency.
  • Substantially homologous sequences or hybridization probes can compete and inhibit the binding of completely homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other specifically or selectively.
  • Percent identity refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALIGN program (Lasergene sof tware package, DNASTAR, Inc., Madi son Wi s.). The MEGALIGN program can compare two or more sequences according to different methods such as the Clus ter method (Higgins, DG and PM Sharp (1988) Gene 73: 237-244). The Cl uster method arranges groups of sequences into clusters by checking the distance between all pairs. The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula:
  • the percent identity between nucleic acid sequences can also be determined by the Cluster method or by methods known in the art, such as Jotun He in (He i n J., (1990) Methods in emzumo logy 183: 625-645).
  • Similarity refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
  • Amino acids used for conservative substitutions for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
  • Antisense refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence.
  • Antisense strand refers to a nucleic acid strand that is complementary to the “sense strand”.
  • Derivative refers to a chemical modification of HFP or a nucleic acid encoding it. Such a chemical modification may be the replacement of a hydrogen atom with an alkyl group, an acyl group or an amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological characteristics of natural molecules.
  • Antibody refers to a complete antibody molecule and its fragments, such as Fa,? ( ⁇ ) 2 and?, Which can specifically bind to the epitope of human zinc finger protein 46.
  • a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
  • isolated refers to the removal of a substance from its original environment (for example, its natural environment if it occurs naturally).
  • a naturally occurring polynucleotide or polypeptide is not isolated when it is present in a living animal, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
  • Such a polynucleotide may be part of a vector, or such a polynucleotide or polypeptide may be part of a composition. Since the carrier or composition is not part of its natural environment, they are still isolated.
  • isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment). Polynucleotides and peptides in their natural state in living cells It is not isolated and purified, but the same polynucleotide or polypeptide is separated and purified if it is separated from other substances in its natural state.
  • isolated human zinc finger protein 46 means that human zinc finger protein 46 is substantially free of other proteins, lipids, sugars, or other substances with which it is naturally associated. Those skilled in the art can purify human zinc finger protein 46 using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of human zinc finger protein 46 polypeptide can be analyzed by amino acid sequence.
  • the present invention provides a new polypeptide, human zinc finger protein 46, which basically consists of the amino acid sequence shown in SEQ ID NO: 2.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
  • the polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques. Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
  • the invention also includes fragments, derivatives and analogs of human zinc finger protein 46.
  • fragment refers to a polypeptide that substantially retains the same biological function or activity of the human zinc finger protein 46 of the present invention.
  • a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution
  • the amino acid may or may not be encoded by a genetic codon; or (II) a type in which a group on one or more amino acid residues is replaced by another group to include a substituent; or ( ⁇ ⁇ )
  • Such a polypeptide sequence in which the mature polypeptide is fused with another compound such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol
  • a polypeptide sequence in which an additional amino acid sequence is fused into the mature polypeptide (Such as a leader sequence or a secreted sequence or a sequence used to purify this polypeptide or a protease sequence)
  • an additional amino acid sequence is fused into the mature polypeptide (Such as a leader sequence or a secreted sequence
  • the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
  • the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a polynucleotide sequence of 1355 bases in length and its open reading frame 2-1261 encodes 419 amino acids.
  • This polypeptide has the characteristic sequence of members of the zinc finger protein family, and it can be deduced that the human zinc finger protein 46 has the structure and function represented by the members of the zinc finger protein family.
  • the polynucleotide of the present invention may be in the form of DNA or RM.
  • DNA forms include cDNA, genomic DNA, or synthetic DNA.
  • DNA can be single-stranded or double-stranded.
  • DNA can be coding or non-coding.
  • the coding region sequence encoding the mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 Or a degenerate variant.
  • degenerate variant means in the present invention that the code has
  • the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
  • polynucleotide encoding a polypeptide refers to a polynucleotide that includes the polypeptide and a polynucleotide that includes additional coding and / or non-coding sequences.
  • the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
  • This polynucleotide variant can be a naturally occurring allelic variant or a non-naturally occurring variant.
  • These nucleotide variants include substitution variants, deletion variants, and insertion variants.
  • an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
  • the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity between the two sequences).
  • the present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions.
  • "strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1 ° /.
  • Hybridization occurs only when the identity between the two sequences is at least 95%, more preferably 97%, and the polypeptide encoded by the hybridizable polynucleotide is mature as shown in SEQ ID NO: 2 Polypeptides have the same biological function and activity.
  • nucleic acid fragments that hybridize to the sequences described above.
  • a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 nuclei. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques, such as PCR, to identify and / or isolate polynucleotides encoding human zinc finger protein 46.
  • polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
  • the specific polynucleotide sequence encoding the human zinc finger protein 46 of the present invention can be obtained by various methods.
  • polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
  • the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.
  • genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences.
  • the standard method for isolating cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library. There are many mature techniques for extracting mRNA, and kits are also commercially available (Qiagene :).
  • cDNA libraries are also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989).
  • CDM libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
  • genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DNA-RNA hybrids; (2) the presence or absence of marker gene functions; (3) determining the level of human zinc finger protein 46 transcripts; (4) Detection of gene-expressed protein products by immunological techniques or determination of biological activity. The above methods can be used singly or in combination.
  • the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
  • the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
  • the probe used here is usually a DM sequence chemically synthesized based on the gene sequence information of the present invention.
  • the genes or fragments of the present invention can of course be used as probes.
  • DM probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
  • the protein product of human zinc finger protein 46 gene expression can be detected by immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA).
  • immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA).
  • a method using DNA technology to amplify DNA / RNA is preferably used to obtain the gene of the present invention.
  • the RACE method RACE-Rapid Amplification of cDNA Ends
  • the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Select and synthesize using conventional methods.
  • the amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
  • polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, the sequencing must be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
  • the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using a human zinc finger protein 46 coding sequence, and the recombinant technology to produce A method of inventing the polypeptide.
  • a polynucleotide sequence encoding human zinc finger protein 46 may be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
  • vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
  • Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al.
  • any plasmid and vector can be used to construct a recombinant expression vector.
  • An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
  • Methods known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding human zinc finger protein 46 and appropriate transcriptional / translational regulatory elements. These methods include in vitro recombinant DNA technology, DNA synthesis technology, and in vivo recombination technology (Sambroook, et al. Molecular Cloning, a Laboratory Manual, cold Spring Harbor Laboratory. New York, 1989).
  • the DNA sequence can be operably linked to an appropriate promoter in an expression vector to direct mRNA synthesis. Representative examples of these promoters are: the lac or trp promoter of E.
  • the expression vector also includes a ribosome binding site for translation initiation, a transcription terminator, and the like. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polytumor enhancers on the late side of the origin of replication, and adenoviral enhancers.
  • the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • GFP fluorescent protein
  • tetracycline or ampicillin resistance for E. coli.
  • a polynucleotide encoding human zinc finger protein 46 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a genetically engineered host cell containing the polynucleotide or the recombinant vector.
  • the term "host cell” refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast Mother cells; or higher eukaryotic cells, such as mammalian cells. Representative examples are: E.
  • coli Streptomyces
  • bacterial cells such as Salmonella typhimurium
  • fungal cells such as yeast
  • plant cells such as fly S2 or Sf 9
  • animal cells such as CH0, COS, or Bowes melanoma cells.
  • Transformation of a host cell with a DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art.
  • the host is a prokaryote such as E. coli
  • competent cells capable of DNA uptake can be in the exponential growth phase were harvested, treated with (Method 12, using the procedure well known in the art.
  • Alternative is MgC l 2.
  • transformation can also be performed by electroporation.
  • the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposomes Packaging, etc.
  • the polynucleotide sequence of the present invention can be used to express or produce recombinant human zinc finger protein 46 (Scence, 1984; 224: 1431). Generally there are the following steps:
  • the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
  • a suitable method such as temperature conversion or chemical induction
  • the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell.
  • recombinant proteins can be separated and purified by various separation methods using their physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
  • Zinc binding protein is usually used as a transcription factor and signal transduction molecule to participate in gene expression and regulation.
  • Zinc finger protein is expressed in blood cells, brain, nervous system, various tumor-related tissues and tissues of immortal cell lines, including C2H2 Proteins of type zinc finger domain also play a key role in developmental regulation.
  • C2H2 type zinc finger domains are related to the following diseases: solid tumors such as thyroid adenoma, uterine fibroids, neurological diseases such as extrapyramidal dysfunction, Parkinson's syndrome, ataxia, nerve cells Tumors, glioblastomas, hematological malignancies such as leukemia, non-Hodgkin's lymphoma, developmental disorders such as Williams syndrome, cracked hands and feet, Bayesian syndrome, and other tumors such as the god Meningioma, colon cancer, breast cancer, etc.
  • solid tumors such as thyroid adenoma, uterine fibroids
  • neurological diseases such as extrapyramidal dysfunction, Parkinson's syndrome, ataxia
  • nerve cells Tumors such as leukemia, non-Hodgkin's lymphoma
  • developmental disorders such as Williams syndrome, cracked hands and feet
  • Bayesian syndrome Bayesian syndrome
  • other tumors such as the god Meningioma, colon cancer, breast cancer, etc.
  • the polypeptide of the present invention is a C2H2 type zinc finger protein, and it also contains a characteristic sequence fragment of the TFI IS family of transcription factors.
  • This transcription factor shows binding activity to DNA only in the presence of RNA polymerase II. It regulates the transcription activity of RNA polymerase II extension complexes in vivo, and it regulates the expression of some proto-oncogenes and viruses, including human immunity Expression of the defective virus HIV-1.
  • the polypeptide of the present invention also contains a characteristic PHD domain.
  • the PHD domain usually involves protein-protein interactions during protein interactions.
  • human zinc finger protein 46 of the present invention will produce various diseases, especially various tumors, neurological diseases, hematological malignant diseases, and developmental disorders.
  • diseases include, but are not limited to: Tumors: thyroid tumors, uterine fibroids, neuroblastomas, ependymal tumors, colon cancer, breast cancer, leukemia, lymphoma, malignant histiocytosis, melanoma, sarcoma, myeloma, teratoma, adrenal cancer, Bladder cancer, Bone cancer, Bone marrow cancer, Brain cancer, Uterine cancer, Gallbladder cancer, Liver cancer, Lung cancer, Thymic tumor
  • Nervous system diseases neural tube insufficiency such as spina bifida, anencephaly malformation, brain (meningeal) bulge, craniocerebral fissure, neural tube cysts, brain developmental abnormalities such as foramen malformations, tetanus, hydrocephalus, neuronal migration Obstacles such as abnormal formation of the brain gyrus, other malformations such as aqueduct malformations, cerebellar dysplasia, Down syndrome, spinal deformity, congenital hydrocephalus, congenital cerebral nucleus dysplasia syndrome, glioma, meningiomas, Neurofibromas, Pituitary Adenomas, Intracranial Granuloma, Alzheimer's Disease, Parkinson's Disease, Dance, Depression, Amnesia, Huntington's Disease, Epilepsy, Migraine, Dementia, Multiple Sclerosis, Mental Schizophrenia, depression, paranoia, anxiety, obsessive-compulsive disorder
  • Hematological malignancies Leukemia, non-Hodgkin's lymphoma
  • Abnormal expression of the human zinc finger protein 46 of the present invention will also produce certain genetic diseases, such as endocrine system diseases such as endocrine adenoma, and immune system diseases.
  • the polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat various diseases, especially various tumors, nervous system diseases, hematological malignant diseases, development Disorders, certain hereditary diseases, endocrine system diseases such as endocrine adenoma, immune system diseases, etc.
  • various diseases especially various tumors, nervous system diseases, hematological malignant diseases, development Disorders, certain hereditary diseases, endocrine system diseases such as endocrine adenoma, immune system diseases, etc.
  • Fig. 1 is a comparison diagram of the amino acid sequences of the functional domains of human zinc finger protein 46 and zinc finger protein family members of the present invention.
  • Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of human zinc finger protein 46 isolated.
  • 46 Da is the molecular weight of the protein.
  • the arrow indicates the isolated protein band. The best way to implement the invention
  • Total human fetal brain RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform.
  • Poly (A) mRNA was isolated from total RNA using Quik mRNA Isolation Kit (Qiegene). 2ug poly (A) mRNA is reverse transcribed to form cDNA. Using Smart cDNA cloning kit (purchased from Clontech), the 00 fragment was inserted into the multiple cloning site of pBSK (+) vector (Clontech) to transform DH5 ⁇ , and the bacteria formed a cDNA library.
  • Dye terminate cycle react ion sequencing kit Perkin-Elmer
  • ABI 377 automatic sequencer Perkin-Elmer
  • the determined cDNA sequence was compared with the existing public DNA sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 0459a08 was new DNA.
  • a series of primers were synthesized to determine the inserted cDNA fragments of the clone in both directions.
  • the human zinc finger protein 46 of the present invention is homologous with members of the domain zinc finger protein family, and the results of the homology are shown in Figure 1.
  • Example 3 Cloning of the gene encoding human zinc finger protein 46 by RT-PCR
  • CDNA was synthesized using fetal brain total RNA as a template and oligo-dT as a primer for reverse transcription reaction. After purification with Qiagene's kit, the following primers were used for PCR amplification:
  • Primerl 5'- GATGAGAGTATGTGGAGGTAATGA -3 '(SEQ ID NO: 3)
  • Primer2 5'- ACAATCATTACATTTATTAGGTTT -3 '(SEQ ID NO: 4)
  • Primerl is a forward sequence located at the 5th end of SEQ ID NO: 1, starting at lbp;
  • Primer2 is the 3, terminal reverse sequence of SEQ ID NO: 1.
  • Conditions for the amplification reaction 50 ol / L KC1, 10 mmol / L Tris-Cl, (pH8.5), 1.5 mmol / L MgCl 2 , 200 ⁇ mol / L dNTP, lOpmol primers in a 50 ⁇ 1 reaction volume, 1U of Taq DNA polymerase (Clontech).
  • the reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) under the following conditions for 25 cycles: 94 ° C 30sec; 55 ° C 30sec; 72 C 2min.
  • RT-PCR set ⁇ -act in as a positive control and template blank as a negative control.
  • the amplified product was purified using a QIAGEN kit and ligated to a PCR vector (Invitrogen product) using a TA cloning kit.
  • the DNA sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as that of 1-1355bp shown in SEQ ID NO: 1.
  • Example 4 Northern blot analysis of human zinc finger protein 46 gene expression:
  • RNA extraction in one step [Anal. Biochem 1987, 162, 156-159] 0
  • This method involves acid guanidinium thiocyanate-chloroform extraction. That is, the tissue is homogenized with 4M guanidine isothiocyanate-25mM sodium citrate, 0.2M sodium acetate ( ⁇ 4.0), and 1 time volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1 ), Mix and centrifuge. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water.
  • RNA was synthesized by electrophoresis on a 1.2% agarose gel containing 20 mM 3- (N-morpholino) propanesulfonic acid (pH 7.0)-5 mM sodium acetate-ImM EDTA-2.2M formaldehyde. It was then transferred to a nitrocellulose membrane.
  • the DNA probe used was the human zinc finger protein 46 coding region sequence (2bp to 1261bp) amplified by PCR as shown in FIG. 1.
  • a 32P-labeled probe (about 2 x 10 6 cpm / ml) was hybridized with a nitrocellulose membrane to which RNA was transferred at 42 ° C overnight in a solution containing 50% formamide-25mM KH 2 P0 4 (pH7.4) -5 SSC-5 x Denhardt's solution and 200 g / ml salmon sperm DNA. After hybridization, place the filter in 1 x SSC-0.1 ° / SDS on Wash at 55 ° C for 30min. Then, Phosphor Imager was used for analysis and quantification.
  • Example 5 In vitro expression, isolation and purification of recombinant human zinc finger protein 46
  • Primer3 5'- CATGCTAGCATGAGAGTATGTGGAGGTAATGAA -3 '(Seq ID No: 5)
  • Primer4 5'- CATGGATCCTCACGTATGAGTTCTTTGATGTCG -3' (Seq ID No: 6)
  • Nhel and BamHI restriction sites correspond to the selective endonucleases on the expression vector plasmid pET 28b (+) (Novagen, Cat. No. 69865.3) Enzyme site.
  • PCR was performed using the pBS-0459a08 plasmid containing the full-length target gene as a template.
  • the PCR reaction conditions were as follows: a total volume of 50 ⁇ 1 containing 10 pg of pBS-0459a08 plasmid, Primer-3 and Primer-4; g 10 pmol, Advantage polymerase Mix (Clontech) 1 ⁇ 1. Cycle parameters: 94. C 20s, 60 ° C 30s, 68 ° C 2 min, a total of 25 cycles. Nhel and BamHI were used to double-digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase.
  • the ligation product was transformed into coliform bacteria DH5a by the calcium chloride method. After being cultured overnight on LB plates containing kanamycin (final concentration 30 g / ml), positive clones were screened by colony PCR method and sequenced. A positive clone (pET-0459a08) with the correct sequence was selected, and the recombinant plasmid was transformed into E. coli BL21 (DE3) plySs (product of Novagen) using the calcium chloride method. The host strain BL21 (pET-0459a08) was 37 in LB liquid medium containing kanamycin (final concentration 30 g / ml). C.
  • a peptide synthesizer (product of PE company) was used to synthesize the following human zinc finger protein 46-specific peptides:
  • the polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex, respectively.
  • hemocyanin and bovine serum albumin For methods, see: Avrameas, et al. Immunochemistry, 1969; 6: 43. Rabbits were immunized with 4mg of the hemocyanin polypeptide complex and complete Freund's adjuvant, and the hemocyanin polypeptide complex could not be added after 15 days. Full Freund's adjuvant boosts immunity once.
  • a titer plate coated with a 15 g / ml bovine serum albumin peptide complex was used as an ELISA to determine antibody titers in rabbit serum.
  • Total IgG was isolated from antibody-positive rabbit sera using protein A-Sepharose.
  • the peptide was bound to a cyanogen bromide-activated Sepharose4B column, and anti-peptide antibodies were separated from the total IgG by affinity chromatography.
  • the immunoprecipitation method proved that the purified antibody could specifically bind to human zinc finger protein 46.
  • Example 7 Use of a polynucleotide fragment of the present invention as a hybridization probe
  • Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
  • the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
  • the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
  • the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method.
  • Filter hybridization methods include dot blotting, Sou thern imprinting, Nor thern blotting, and copying methods. They are all used to fix the polynucleotide sample to be tested on the filter and then hybridize using basically the same steps.
  • the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer to saturate the non-specific binding site of the sample on the filter with the carrier and the synthesized polymer.
  • the pre-hybridization solution is then replaced with a hybridization buffer containing labeled probes and incubated to hybridize the probes to the target nucleic acid.
  • the unhybridized probes are removed by a series of membrane washing steps.
  • This embodiment uses higher-intensity washing conditions (such as lower salt concentration and higher temperature), so that the hybridization background is reduced and only strong specific signals are retained.
  • the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
  • the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
  • the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
  • oligonucleotide fragments for use as hybridization probes from the polynucleotide SEQ ID NO: 1 of the present invention should follow the following principles and several aspects to be considered:
  • the preferred range of probe size is 18-50 nucleotides
  • the primary probe is compared with its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complementary regions. If the homology with the non-target molecular region is greater than 85% or more than 15 consecutive bases are exactly the same, the primary probe should not be used in general;
  • Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
  • Probe 2 which belongs to the second type of probe, is equivalent to the replacement mutation sequence (41Nt) of the gene fragment of SEQ ID NO: 1 or its complementary fragment:
  • PBS phosphate buffered saline
  • step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
  • NC membranes nitrocellulose membranes
  • Two NC membranes are required for each probe for subsequent experiments.
  • the film is washed with high-strength conditions and strength conditions, respectively.
  • the 32 P-Probe (the second peak is free ⁇ - 32 P-dATP) is prepared.
  • the sample membrane was placed in a plastic bag, and 3-10 mg of prehybridization solution (10xDenhardt's; 6xSSC, 0.1 mg / ml) was added.
  • CT DNA (calf thymus DNA).
  • probe 1 can be used to qualitatively and quantitatively analyze the presence and differential expression of the polynucleotide of the present invention in different tissues.
  • Gene chip or DNA microarray is a new technology that many national laboratories and large pharmaceutical companies are currently developing and developing. It refers to the orderly and high-density arrangement of large numbers of target gene fragments on glass, The data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software to achieve the purpose of rapid, efficient, and high-throughput analysis of biological information.
  • the polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research of new gene functions; search for and screen new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases .
  • the specific method steps have been reported in the literature, for example, refer to the documents DeRisi, JL, Lyer, V. & Brown, P.0. (1997) Science 278, 680-686. And the documents Helle, RA, Schema, M. , Chai, A., Shalom, D., (1997) PNAS 94: 2150-2155.
  • a total of 4,000 polynucleotide sequences of various full-length cDNAs are used as target DNA, including the polynucleotide of the present invention. They were respectively amplified by PCR. After purification, the amplified product was adjusted to a concentration of about 500 ng / ul, and spotted on a glass medium using a Cartesian 7500 spotter (purchased from Cartesian Company, USA), between points. The distance is 280 ⁇ . The spotted slides were hydrated, dried, and cross-linked in a purple diplomatic coupling instrument. After elution, the DNA was fixed on a glass slide to prepare a chip.
  • the specific method steps have been reported in the literature in various ways. The post-spot processing steps of this embodiment are:
  • Total mRNA was extracted from normal laryngeal and laryngeal cancers in one step, and mRNA was purified with Oligotex mRNA Midi Kit (purchased from QiaGen).
  • the fluorescent reagent Cy3dUTP -Amino- propargyl-2'-deoxyur idine 5 was reversely transcribed.
  • '-tr iphate coupled to Cy3 fluorescent dye purchased from Amersham Phamacia Biotech
  • Cy5dUTP (5-Amino-propargyl-2'-deoxyur idine 5'-tr iphate coupled to Cy5 fluorescent dye) was used as a fluorescent reagent.
  • Probes were prepared after purification. For specific steps and methods, see:
  • Probes from the above two tissues and chips were hybridized in a UniHyb TM Hybridization Solution (purchased from TeleChem) hybridization solution for 16 hours, washed with a washing solution (1 x SSC, 0.2% SDS) at room temperature, and then scanned with ScanArray 3000.
  • Scanner purchased from General Scanning Company, USA
  • the scanned image was processed by Imagene software (Biodiscovery Company, USA) to calculate the Cy3 / Cy5 ratio of each point. The points with the ratio less than 0.5 and greater than 2 were considered.
  • Genes with differential expression were used to calculate the Cy3 / Cy5 ratio of each point.
  • the polypeptides of the present invention can be directly used in the treatment of diseases, for example, they can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection, and immune diseases.
  • the invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) human zinc finger protein 46.
  • Agonists enhance human zinc finger protein 46 to stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
  • mammalian cells or a membrane preparation expressing human zinc finger protein 46 can be cultured with labeled human zinc finger protein 46 in the presence of a drug. The ability of the drug to increase or block this interaction is then determined.
  • Antagonists of human zinc finger protein 46 include antibodies, compounds, receptor deletions, and the like that have been screened. Antagonists of human zinc finger protein 46 can bind to human zinc finger protein 46 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot perform biological functions.
  • human zinc finger protein 46 When screening compounds as antagonists, human zinc finger protein 46 can be added to a bioanalytical assay to determine whether a compound is an antagonist by measuring the effect of the compound on the interaction between human zinc finger protein 46 and its receptor. Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds.
  • Polypeptide molecules capable of binding to human zinc finger protein 46 can be The combinable amino acids are obtained by binding to a random peptide library composed of a solid phase. When screening, human zinc finger protein 46 molecules should generally be labeled.
  • the present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies.
  • the invention also provides antibodies directed against the human zinc finger protein 46 epitope. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by Fab expression libraries.
  • Polyclonal antibodies can be produced by injecting human zinc finger protein 46 directly into immunized animals (such as rabbits, mice, rats, etc.). A variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's adjuvant. .
  • Techniques for preparing monoclonal antibodies to human zinc finger protein 46 include, but are not limited to, hybridoma technology (Koh ler and Milstein. Nature, 1975, 256: 495-497), triple tumor technology, human beta-cell hybridization Tumor technology, EBV-hybridoma technology, etc. Chimeric antibodies combining human constant regions and non-human variable regions can be produced using existing techniques (Morr et al, PNAS, 1985, 81: 6851). 0 Existing techniques for producing single-chain antibodies (US Pa t No. 4946778) can also be used to produce single chain antibodies against human zinc finger protein 46.
  • Anti-human zinc finger protein 46 antibodies can be used in immunohistochemical techniques to detect human zinc finger protein 46 in biopsy specimens.
  • Monoclonal antibodies that bind to human zinc finger protein 46 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
  • Antibodies can also be used to design immunotoxins that target a particular part of the body.
  • human zinc finger protein 46 high affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
  • a common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
  • This hybrid antibody can be used to kill human zinc finger protein 46 positive cells.
  • the antibodies of the present invention can be used to treat or prevent diseases related to human zinc finger protein 46.
  • Administration of an appropriate amount of antibody can stimulate or block the production or activity of human zinc finger protein 46.
  • the invention also relates to a diagnostic test method for quantitative and localized detection of human zinc finger protein 46 levels. These tests are well known in the art and include FI SH assays and radioimmunoassays. The level of human zinc finger protein 46 detected in the test can be used to explain the importance of human zinc finger protein 46 in various diseases and to diagnose diseases in which human zinc finger protein 46 functions.
  • the polypeptide of the present invention can also be used for peptide mapping analysis.
  • the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
  • the polynucleotide encoding human zinc finger protein 46 can also be used for a variety of therapeutic purposes.
  • Gene therapy technology can be used to treat abnormal cell proliferation, development, or metabolism caused by the non-expression or abnormal / inactive expression of human zinc finger protein 46.
  • Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated human zinc finger protein 46 to inhibit endogenous human zinc finger protein 46 activity.
  • a variant human zinc finger protein 46 may be a shortened human zinc finger protein 46 that lacks a signaling domain. Although it can bind to downstream substrates, it lacks signaling activity. Therefore, the recombinant gene therapy vector can be used for treating diseases caused by abnormal expression or activity of human zinc finger protein 46.
  • Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to transfer a polynucleotide encoding human zinc finger protein 46 into cells. Methods for constructing recombinant viral vectors carrying a polynucleotide encoding human zinc finger protein 46 can be found in existing literature (Sarabrook, et al.). In addition, a recombinant polynucleotide encoding human zinc finger protein 46 can be packaged into liposomes and transferred into cells.
  • Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
  • a vector such as a virus, phage, or plasmid
  • Oligonucleotides including antisense RNA and DNA
  • ribozymes that inhibit human zinc finger protein 46 mRNA are also within the scope of the present invention.
  • a ribozyme is an enzyme-like RNA molecule that specifically decomposes specific RNA. Its mechanism is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation.
  • Antisense RNA, DNA, and ribozymes can be obtained using any existing RNA or DNA synthesis techniques, such as solid-phase phosphate amide chemical synthesis to synthesize oligonucleotides.
  • Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA.
  • This DNA sequence has been integrated downstream of the RM polymerase promoter of the vector.
  • it can be modified in a variety of ways, such as increasing the sequence length of the two pyrenes, and using phosphorothioate or peptide bonds instead of phosphodiester bonds for the linkage between ribonucleosides.
  • the polynucleotide encoding human zinc finger protein 46 can be used for the diagnosis of diseases related to human zinc finger protein 46.
  • the polynucleotide encoding human zinc finger protein 46 can be used to detect the expression of human zinc finger protein 46 or the abnormal expression of human zinc finger protein 46 in a disease state.
  • the DNA sequence encoding human zinc finger protein 46 can be used to hybridize biopsy specimens to determine the expression of human zinc finger protein 46.
  • Hybridization techniques include Southern blotting, Nor thern blotting, and in situ hybridization. These techniques and methods are publicly available and mature, and related kits are commercially available.
  • a part or all of the polynucleotide of the present invention can be used as a probe to be fixed on a microarray or a DNA chip (also referred to as a "gene chip") for analyzing differential expression analysis and gene diagnosis of genes in a tissue.
  • Human zinc finger protein 46 specific primers can also be used to detect the transcription products of human zinc finger protein 46 by performing RM-polymerase chain reaction (RT-PCR) in vitro amplification.
  • Detection of mutations in the human zinc finger protein 46 gene can also be used to diagnose human zinc finger protein 46-related diseases.
  • Human zinc finger protein 46 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild type human zinc finger protein 46 DNA sequence. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression. Therefore, Northern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
  • the sequences of the invention are also valuable for chromosome identification.
  • the sequence specifically targets a specific position on a human chromosome and can hybridize to it.
  • specific sites for each gene on the chromosome need to be identified.
  • only a few chromosome markers based on actual sequence data are available for marking chromosome positions.
  • an important first step is to locate these DNA sequences on a chromosome.
  • a PCR primer (preferably 15-35bp) is prepared from the cDNA, and the sequence can be located on the chromosome. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
  • PCR localization of somatic hybrid cells is a quick way to localize DM to specific chromosomes.
  • oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
  • Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.
  • Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step.
  • FISH Fluorescent in situ hybridization
  • the physical location of the sequence on the chromosome can be correlated with the genetic map data. These data can be found in, for example, V. Mckusick, Mendel ian Inheritance in Man (available online with Johns Hopkins University Welch Medical Library). Linkage analysis can then be used to determine the relationship between genes and diseases that have been mapped to chromosomal regions.
  • the differences in cDNA or genomic sequences between the affected and unaffected individuals need to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in the chromosome, such as deletions or translocations that are visible at the chromosomal level or detectable using cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).
  • the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
  • suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
  • the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients that do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
  • the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell.
  • the polypeptides of the invention can be used in combination with other therapeutic compounds.
  • the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
  • Human zinc finger protein 46 is administered in an amount effective to treat and / or prevent a particular indication.
  • the amount and dosage range of human zinc finger protein 46 to be administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Veterinary Medicine (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Biochemistry (AREA)
  • Toxicology (AREA)
  • Molecular Biology (AREA)
  • Genetics & Genomics (AREA)
  • Biophysics (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Zoology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Immunology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

L'invention concerne un nouveau polypeptide, une protéine humaine à doigt de zinc 46, et un polynucléotide codant pour ce polypeptide ainsi qu'un procédé d'obtention de ce polypeptide par des techniques recombinantes d'ADN. L'invention concerne en outre les applications de ce polypeptide dans le traitement de maladies, notamment des tumeurs malignes, de l'hémopathie, de l'infection par VIH, de maladies immunitaires et de diverses inflammations. L'invention concerne aussi l'antagoniste agissant contre le polypeptide et son action thérapeutique ainsi que les applications de ce polynucléotide codant pour la protéine humaine à doigt de zinc 46.
PCT/CN2001/000044 2000-01-26 2001-01-15 Nouveau polypeptide, proteine humaine a doigt de zinc 46, et polynucleotide codant pour ce polypeptide WO2001055188A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU2001229980A AU2001229980A1 (en) 2000-01-26 2001-01-15 A new polypeptide-human zinc finger protein 46 and the polynucleotide encoding it

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN00111506A CN1307017A (zh) 2000-01-26 2000-01-26 一种新的多肽——人锌指蛋白46和编码这种多肽的多核苷酸
CN00111506.5 2000-01-26

Publications (1)

Publication Number Publication Date
WO2001055188A1 true WO2001055188A1 (fr) 2001-08-02

Family

ID=4581416

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2001/000044 WO2001055188A1 (fr) 2000-01-26 2001-01-15 Nouveau polypeptide, proteine humaine a doigt de zinc 46, et polynucleotide codant pour ce polypeptide

Country Status (3)

Country Link
CN (1) CN1307017A (fr)
AU (1) AU2001229980A1 (fr)
WO (1) WO2001055188A1 (fr)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999021991A1 (fr) * 1997-10-29 1999-05-06 Shanghai Second Medical University Bmzf12: gene a doigt de zinc clone a partir de la moelle osseuse
WO1999062951A1 (fr) * 1998-06-04 1999-12-09 Shanghai Second Medical University Gene humain de proteine a doigts de zinc (bmzf3)
WO1999062952A1 (fr) * 1998-06-04 1999-12-09 Shanghai Second Medical University Gene de proteine humaine a doigts de zinc (bmzf2)

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999021991A1 (fr) * 1997-10-29 1999-05-06 Shanghai Second Medical University Bmzf12: gene a doigt de zinc clone a partir de la moelle osseuse
WO1999062951A1 (fr) * 1998-06-04 1999-12-09 Shanghai Second Medical University Gene humain de proteine a doigts de zinc (bmzf3)
WO1999062952A1 (fr) * 1998-06-04 1999-12-09 Shanghai Second Medical University Gene de proteine humaine a doigts de zinc (bmzf2)

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
CHOWDHURY K. ET AL.: "The primary structure of the murine multifinger gene mKr2 and its specific expression in developing and adult neurons", EMBO J., vol. 7, no. 5, 1988, pages 1345 - 1353 *
DATABASE GENBANK [online] 6 April 1999 (1999-04-06), Database accession no. AAD23608 *
DENNY P. AND ASHWORTH A.: "A zinc finger protein-encoding gene expressed in the post-meiotic phase of spermatogenesis", GENE, vol. 106, no. 2, 1991, pages 221 - 227 *

Also Published As

Publication number Publication date
AU2001229980A1 (en) 2001-08-07
CN1307017A (zh) 2001-08-08

Similar Documents

Publication Publication Date Title
WO2001055376A1 (fr) Nouveau polypeptide, proteine humaine 28 a doigt de zinc contenant un motif structural hit, et polynucleotide codant pour ce polypeptide
WO2001083538A1 (fr) Nouveau polypeptide, proteine humaine 36 du gene k-ras, et polynucleotide codant pour ce polypeptide
WO2001055188A1 (fr) Nouveau polypeptide, proteine humaine a doigt de zinc 46, et polynucleotide codant pour ce polypeptide
WO2001079432A2 (fr) Nouveau polypeptide, facteur humain de transcription de la differentiation cellulaire 58, et polynucleotide codant pour ce polypeptide
WO2001081594A1 (fr) Nouveau polypeptide, proteine pax humaine 17, et polynucleotide codant pour ce polypeptide
WO2001075048A2 (fr) Nouveau polypeptide, proteine ribosomale humaine s11 23, et polynucleotide codant pour ce polypeptide
WO2001070965A1 (fr) Nouveau polypeptide, facteur humain de regulation de la transcription 15, et polynucleotide codant pour ce polypeptide
WO2001075023A2 (fr) Nouveau polypeptide, phosphatidylinositol-3 (ptdins 3) kinase humaine 9, et polynucleotide codant pour ce polypeptide
WO2001075101A1 (fr) Nouveau polypeptide, proteine humaine de regulation de la transcription 8, et polynucleotide codant pour ce polypeptide
WO2001074876A1 (fr) Nouveau polypeptide, phosphatidylinositol-3 kinase humaine 14, et polynucleotide codant pour ce polypeptide
WO2001072801A1 (fr) Nouveau polypeptide, proteine ribosomale humaine s11 12, et polynucleotide codant pour ce polypeptide
WO2001064721A1 (fr) Nouveau polypeptide, adenosine triphosphatase 30, et polynucleotide codant pour ce polypeptide
WO2001055187A1 (fr) Nouveau polypeptide, proteine humaine 49 a doigt de zinc, et polynucleotide codant pour ce polypeptide
WO2001055184A1 (fr) Nouveau polypeptide, proteine humaine a doigt de zinc 19, et polynucleotide codant pour ce polypeptide
WO2001053341A1 (fr) Nouveau polypeptide, proteine humaine 13 a doigt de zinc, et polynucleotide codant pour ce polypeptide
WO2001048198A1 (fr) Nouveau polypeptide, proteine ribosomale s4 8, et polynucleotide codant pour ce polypeptide
WO2001064732A1 (fr) Nouveau polypeptide, facteur humain associe a la retrotransposition 14, et polynucleotide codant pour ce polypeptide
WO2002020595A1 (fr) Nouveau polypeptide, proteine a doigt de zinc humaine 18.04, et polynucleotide codant ce polypeptide
WO2001079437A2 (fr) Nouveau polypeptide, facteur humain de transcription de la differentiation cellulaire 14, et polynucleotide codant pour ce polypeptide
WO2001081399A1 (fr) Nouveau polypeptide, proteine pax humaine 14, et polynucleotide codant pour ce polypeptide
WO2001053483A1 (fr) Nouveau polypeptide, proteine humaine 30 a doigt de zinc, et polynucleotide codant pour ce polypeptide
WO2001081535A2 (fr) Nouveau polypeptide, proteine pax humaine 9.9, et polynucleotide codant pour ce polypeptide
WO2001074893A1 (fr) Nouveau polypeptide, proteine humaine de regulation de la transcription 11.8, et polynucleotide codant pour ce polypeptide
WO2001087968A1 (fr) Proteine s4-36 ribosomale, polypeptide humain, et polynucleotide la codant
WO2001081592A1 (fr) Nouveau polypeptide, proteine humaine 11 contenant un fragment de sequence particulier d'une signal peptidase i, et polynucleotide codant pour ce polypeptide

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP