WO2001049723A1 - Nouveau polypeptide, atp synthetase 9, et polynucleotide codant pour ce polypeptide - Google Patents

Nouveau polypeptide, atp synthetase 9, et polynucleotide codant pour ce polypeptide Download PDF

Info

Publication number
WO2001049723A1
WO2001049723A1 PCT/CN2000/000647 CN0000647W WO0149723A1 WO 2001049723 A1 WO2001049723 A1 WO 2001049723A1 CN 0000647 W CN0000647 W CN 0000647W WO 0149723 A1 WO0149723 A1 WO 0149723A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
polynucleotide
atp synthase
sequence
seq
Prior art date
Application number
PCT/CN2000/000647
Other languages
English (en)
Chinese (zh)
Inventor
Yumin Mao
Yi Xie
Original Assignee
Fudan University
Shanghai Bio Door Gene Technology Ltd.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Fudan University, Shanghai Bio Door Gene Technology Ltd. filed Critical Fudan University
Priority to AU21421/01A priority Critical patent/AU2142101A/en
Publication of WO2001049723A1 publication Critical patent/WO2001049723A1/fr

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14Hydrolases (3)
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides

Definitions

  • a new polypeptide A T P synthase 9 and a polynucleotide encoding the polypeptide
  • the present invention belongs to the field of biotechnology. Specifically, the present invention describes a novel polypeptide ATP synthase 9 and a polynucleotide sequence encoding the polypeptide. The invention also relates to a method and application for preparing such polynucleotides and polypeptides.
  • the energy of cell activity comes mainly from ATP.
  • ATP ATP
  • mitochondria a group consisting of ATP and phospholipase.
  • ATP synthase or FO-FltATPase
  • F0 constitutes a proton channel
  • F1 is a catalytic center.
  • F0 contains a variety of different peptide chains, which are composed of 5 peptides (0, ⁇ , ⁇ , ⁇ , and ⁇ ), forming an ⁇ 3 ⁇ 3 ⁇ ⁇ ⁇ structure.
  • ⁇ ⁇ may be a site that binds ATP / ADP or other nucleotides.
  • the ⁇ chain has catalytic activity
  • the ⁇ chain is a regulatory site.
  • V-ATPa se vacuolar ATP synthetase
  • V-ATPa se can acidify regions within different cells. Similar to F-ATP synthase, V-ATP synthase also includes a transmembrane region and a catalytic center. The protein sequence of the largest subunit of the catalytic center is similar to the ⁇ -chain of F-ATP.
  • ATP synthase is found in both prokaryotes and eukaryotes. In prokaryotic cells, such as bacteria, ATP synthetase exists on the plasma membrane. It contains a hydrophilic F1 and a hydrophobic FO; F1 also has an ⁇ 3 ⁇ 3 ⁇ ⁇ ⁇ structure, and the cc subunit also contains ATP. And ADP binding site. Therefore, ATP synthase is a key device for oxidative phosphorylation and a unit of biofilm energy conversion. It plays a central role in the energy coupling reactions of mitochondria, chloroplasts of plant cells and bacteria.
  • the characteristic regions of the cc and P subunits of ATP synthase are: P- [SAP]-[LIV]-[DNH] -x (3) -SxS, the first S residue is the catalytic active center, at least in the ⁇ subunit Base. Mutations at this site can cause abnormal catalysis.
  • ATP synthase 9 protein plays an important role in important functions of the body as described above, and it is believed that a large number of proteins are involved in these regulatory processes, there has been a need in the art to identify more ATP synthase 9 proteins involved in these processes, especially The amino acid sequence of this protein was identified. Isolation of the new ATP synthase 9 protein encoding gene also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for the disease, so it is important to isolate its coding DNA. Object of the invention
  • An object of the present invention is to provide an isolated novel polypeptide ⁇ ATP synthase 9 and fragments thereof, similar Things and derivatives.
  • Another object of the invention is to provide a polynucleotide encoding the polypeptide.
  • Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding ATP synthase 9. It is another object of the present invention to provide a genetically engineered host cell containing a polynucleotide encoding an ATP synthase 9.
  • Another object of the present invention is to provide a method for producing ATP synthase 9.
  • Another object of the present invention is to provide antibodies against the polypeptide of the present invention, ATP synthase 9.
  • Another object of the present invention is to provide mimetic compounds, antagonists, agonists, and inhibitors against the polypeptide of the present invention, ATP synthase 9.
  • Another object of the present invention is to provide a method for diagnosing and treating diseases associated with abnormalities in ATP synthase 9. Summary of invention
  • the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
  • the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
  • sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 1 307 to 1552 in SEQ ID NO: 1; and (b) a sequence having 1-1 in SEQ ID NO: 1 201 0-bit sequence.
  • the invention further relates to a vector, in particular an expression vector, containing the polynucleotide of the invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; and a method comprising culturing said Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
  • a vector in particular an expression vector, containing the polynucleotide of the invention
  • a host cell genetically engineered with the vector including a transformed, transduced or transfected host cell
  • a method comprising culturing said Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
  • the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
  • the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of ATP synthase 9 protein, which comprises utilizing the polypeptide of the invention.
  • the invention also relates to compounds obtained by this method.
  • the present invention also relates to a method for detecting a disease or susceptibility to disease associated with abnormal expression of the ATP synthase 9 protein in vitro, comprising detecting a mutation in the polypeptide or a polynucleotide sequence encoding the same in a biological sample, or detecting a mutation in a biological sample.
  • the amount or biological activity of a polypeptide of the invention comprising detecting a mutation in the polypeptide or a polynucleotide sequence encoding the same in a biological sample, or detecting a mutation in a biological sample.
  • the invention also relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
  • W The present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention in the manufacture of a medicament for treating cancer, developmental or immune disease, or other diseases caused by abnormal expression of ATP synthase 9.
  • Fig. 1 is a comparison diagram of amino acid sequence homology of ATP synthetase 9 of the present invention with a total of 48 amino acids and domain ATP synthase characteristic proteins at 30-77.
  • the upper sequence is ATP synthase 9 and the lower sequence is the characteristic protein domain of ATP synthase.
  • ⁇ "and”: "" and ".” Indicate that the probability of the same amino acid appearing between two sequences decreases in sequence.
  • Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of the isolated ATP synthase 9.
  • 9Kda is the molecular weight of the protein.
  • the arrow indicates the isolated protein band.
  • Nucleic acid sequence refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
  • amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
  • amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
  • a protein or polynucleotide “variant” refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it. The changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence. Variants can have "conservative" changes in which the substituted amino acid has a structural or chemical property similar to the original amino acid, such as the replacement of isoleucine with leucine. Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
  • “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
  • Insertion means that a change in the amino acid sequence or nucleotide sequence results in an increase in one or more amino acids or nucleotides compared to a molecule that exists in nature.
  • Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
  • Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
  • Class Similarly, the term “immunologically active” refers to the ability of natural, recombinant, or synthetic proteins and fragments thereof to induce a particular immune response and to bind specific antibodies in a suitable animal or cell.
  • An "agonist” refers to a molecule that, when combined with ATP synthase 9, causes a change in the protein to regulate the activity of the protein.
  • An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that can bind ATP synthase 9.
  • Antagonist refers to a molecule that, when combined with ATP synthase 9, blocks or regulates the biological or immunological activity of ATP synthase 9.
  • Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates or any other molecule that can bind ATP synthase 9.
  • Regulation refers to a change in the function of ATP synthase 9, including an increase or decrease in protein activity, a change in binding properties, and any other biological, functional, or immune properties of ATP synthase 9.
  • Substantially pure means substantially free of other proteins, lipids, carbohydrates or other substances with which it is naturally associated. Those skilled in the art can purify ATP synthase 9 using standard protein purification techniques. Substantially pure ATP synthase 9 produces a single main band on a non-reducing polyacrylamide gel. The purity of the ATP synthase 9 polypeptide can be analyzed by amino acid sequence.
  • Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
  • sequence C-T-G-A
  • complementary sequence G-A-C-T
  • the complementarity between two single-stranded molecules can be partial or complete.
  • the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
  • “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
  • Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Southern or Northern blotting, etc.) under conditions of reduced stringency. Substantially homologous sequences or hybridization probes can compete and inhibit the binding of completely homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.
  • Percent identity refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALIGN program (Lasergene software package, DNASTAR, Inc., Madison Wis.). The MEGALIGN program can compare two or more sequences according to different methods such as the Cluster method (Higgins, DG and PM Sharp (1988) Gene 73: 237-244). The Cluster method arranges groups of sequences into clusters by checking the distance between all pairs. The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula: Number of residues matching sequence ⁇
  • the percent identity between nucleic acid sequences can also be determined by the Cluster method or by methods known in the art such as Jo tun He in (He in J., (1990) Me thods in enzymo l ogy 18 3: 625-645) .
  • Similarity refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
  • Amino acids used for conservative substitution for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
  • Antisense refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence.
  • the "antisense strand” refers to a nucleic acid strand that is complementary to the “sense strand”.
  • Derivative refers to HFP or a chemical modification of its nucleic acid. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
  • Antibody refers to a complete antibody molecule and its fragments, such as Fa,? (& 1) ') 2 and 1 ⁇ , which can specifically bind to the epitope of ATP synthase 9.
  • a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
  • isolated refers to the removal of matter from its original environment (for example, its natural environment if it is naturally occurring).
  • a naturally occurring polynucleotide or polypeptide is not isolated when it is present in a living animal, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist in the natural system.
  • Such a polynucleotide may be part of a vector, or such a polynucleotide or polypeptide may be part of a composition. Since the carrier or composition is not part of its natural environment, they are still isolated.
  • isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
  • polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances existing in the natural state. .
  • isolated ATP synthase 9 means that ATP synthase 9 is substantially free of other proteins, lipids, sugars, or other substances with which it is naturally associated. Those skilled in the art can purify ATP synthase 9 using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of the ATP synthase 9 polypeptide can be analyzed by amino acid sequence.
  • the present invention provides a new polypeptide _ ⁇ ATP synthase 9, which is basically composed of the amino acid sequence shown in SEQ ID NO: 2.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
  • the polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques. Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
  • the invention also includes fragments, derivatives and analogs of ATP synthase 9.
  • fragment refers to a polypeptide that substantially maintains the same biological function or activity of the ATP synthase 9 of the present invention.
  • a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution
  • the amino acid may or may not be encoded by the genetic code; or (II) such a type in which a group on one or more amino acid residues is substituted by other groups to include a substituent; or (III) such A type in which a mature polypeptide is fused to another compound (such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol); or a UV), a polypeptide sequence in which an additional amino acid sequence is fused to a mature polypeptide (such as Leader or secreted sequence or the sequence used to purify the polypeptide or protease sequence).
  • such fragments, derivatives and analogs are considered to be within the knowledge of those skilled in the art.
  • the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the polynucleotide sequence of the present invention includes a nucleotide sequence of SEQ ID NO: 1.
  • the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a full-length nucleotide sequence of 2010 bases, and its open reading frame 1 307-1552 encodes 81 amino acids.
  • This peptide has the characteristic sequence of the characteristic protein of ATP synthase, and it can be deduced that the ATP synthase 9 has the structure and function represented by the characteristic protein of ATP synthetase.
  • the polynucleotide of the present invention may be in the form of DNA or RNA.
  • DNA forms include cDNA, genomic DNA, or synthetic DNA.
  • DNA can be single-stranded or double-stranded.
  • DNA can be coding or non-coding.
  • the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
  • a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
  • the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
  • the term "polynucleotide encoding a polypeptide" is meant to include polynucleotides that encode such polypeptides and polynucleotides that include additional coding and / or noncoding sequences.
  • the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
  • This polynucleotide variant can be a naturally occurring allelic variant or a non-naturally occurring variant.
  • These nucleotide variants include substitution variants, deletion variants, and insertion variants.
  • an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
  • the invention also relates to a polynucleotide that hybridizes to the sequence described above (with at least two sequences between
  • the present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions.
  • "strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 6 (TC; or (2) added during hybridization) Use a denaturant, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% Ficoll, 42 ° C, etc .; or (3) the identity between the two sequences is at least 95% Above, it is more preferable that the hybridization occurs at 97% or more.
  • the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
  • nucleic acid fragments that hybridize to the sequences described above.
  • a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 nuclei. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques, such as PCR, to identify and / or isolate polynucleotides encoding ATP synthase 9.
  • polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
  • the specific polynucleotide sequence encoding the ATP synthase 9 of the present invention can be obtained by various methods.
  • polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
  • the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.
  • genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences.
  • the standard method for isolating cDNA of interest is to isolate mRM from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library. There are many proven techniques for extracting mRM, and kits are also commercially available (Qiagene).
  • the construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989).
  • CDNA libraries are also available, such as different cDNA libraries from Clontech. When combined with polymerase inversion, even very small expression products can be cloned.
  • Genes of the present invention can be screened from these cl) NA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DNA-RNA hybridization; (2) the presence or absence of marker gene functions; (3) measuring the level of ATP synthase 9 transcripts; (4) passing Immunological techniques or assays for biological activity to detect gene-expressed protein products. The above methods can be used singly or in combination.
  • the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
  • the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
  • the probe used here is usually a DNA sequence chemically synthesized based on the gene sequence information of the present invention.
  • the genes or fragments of the present invention can of course be used as probes.
  • DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
  • immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) can be used to detect the protein product expressed by the ATP synthase 9 gene.
  • a method using PCR technology to amplify DNA / RNA is preferably used to obtain the gene of the present invention.
  • the RACE method RACE-Rapid Amplification of cDNA Ends
  • the primers for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein Select and synthesize using conventional methods.
  • the amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
  • polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be measured by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, sequencing needs to be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
  • the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell that is genetically engineered using the vector of the present invention or directly using the ATP synthase 9 coding sequence, and a method for producing the polypeptide of the present invention by recombinant technology.
  • the polynucleotide sequence encoding the ATP synthase 9 can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
  • vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
  • Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al.
  • any plasmid and vector can be used to construct a recombinant expression vector.
  • An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
  • the expression vector also includes a ribosome binding site for translation initiation, a transcription terminator, and the like. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers and adenovirus enhancers on the late side of the origin of replication.
  • the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • GFP fluorescent protein
  • tetracycline or ampicillin resistance for E. coli.
  • a polynucleotide encoding ATP synthase 9 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a genetically engineered host cell containing the polynucleotide or the recombinant vector.
  • host cell refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell.
  • Escherichia coli, Streptomyces bacterial cells such as Salmonella typhimurium
  • fungal cells such as yeast
  • plant cells insect cells
  • fly S2 or Sf9 animal cells
  • animal cells such as CH0, COS or Bowes melanoma cells.
  • Transformation of a host cell with a DM sequence according to the present invention or a recombinant vector containing the DNA sequence can be performed by conventional techniques well known to those skilled in the art.
  • the host is a prokaryote such as E. coli
  • competent cells capable of absorbing DNA can be harvested after exponential growth and treated with CaCl ⁇ . It is well known in the art. Alternatively, MgCl 2 is used. If necessary, transformation can also be performed by electroporation.
  • the host is a eukaryotic organism, the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
  • the polynucleotide sequence of the present invention can be used to express or produce recombinant ATP synthase 9 by conventional recombinant DNA technology (Science, 1984; 224: 1431). Generally there are the following steps:
  • the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
  • a suitable method such as temperature conversion or chemical induction
  • the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If necessary, the recombinant protein can be isolated and purified by various separation methods using its physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
  • conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid
  • polypeptides of the present invention can be directly used in the treatment of diseases, for example, they can be used to treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection, and immunological diseases.
  • the energy of cell activity comes mainly from ATP.
  • ATP is synthesized in mitochondria.
  • Mitochondria undergo oxidative phosphorylation through the respiratory chain, storing energy in ATP.
  • Various enzyme systems for oxidative phosphorylation are distributed on the inner membrane of mitochondria, one of which is ATP synthase.
  • ATP synthase, or FO-FlATPase is a multi-component complex.
  • F0 constitutes a proton channel
  • F1 is a catalytic center with an ⁇ 3 ⁇ ⁇ ⁇ ⁇ structure.
  • ⁇ and ⁇ may be sites binding to ATP / ADP or other nucleotides.
  • the beta chain has catalytic activity
  • the alpha chain is a regulatory site.
  • ATP synthase is a key device for oxidative phosphorylation and is a unit of biofilm energy conversion.
  • the abnormal expression of the specific ATP synthase motif will cause the abnormal function of the polypeptide containing this motif, resulting in the abnormal function of ATP synthase, the abnormality of energy and material metabolism, and the related diseases such as severe illness.
  • the abnormal expression of ATP synthase 9 of the present invention will produce various diseases, especially myasthenia gravis, embryonic developmental disorders, growth and development disorders, and tumors. These diseases include, but are not limited to:
  • Organic acidemia isovalerate, propionate, methylmalonic aciduria, combined carboxylase deficiency, glutaric acid type I, phenylketonuria, albinism, serotoninemia, Congenital lactose intolerance, hereditary fructose intolerance, galactosemia, defective fructose metabolism, glycogen storage disease
  • Embryonic disorders congenital abortion, cleft palate, limb loss, limb differentiation disorder, hyaline membrane disease, atelectasis, polycystic kidney, double ureter, cryptorchidism, congenital inguinal hernia, double uterus, vaginal atresia, suburethral Fissure, hermaphroditism, atrial septal defect, ventricular septal defect, pulmonary stenosis, arterial duct occlusion, neural tube defect, congenital hydrocephalus, iris defect, congenital cataract, congenital glaucoma or cataract, congenital deafness
  • Growth and development disorders mental retardation, cerebral palsy, brain development disorders, mental retardation, familial cerebral nucleus dysplasia syndrome, strabismus, skin, fat and muscular dysplasia such as congenital skin laxity, premature aging Disease, congenital keratosis, various metabolic defects such as various amino acid metabolic defects, stunting, dwarfism, sexual retardation
  • Tumors of various tissues gastric cancer, liver cancer, lung cancer, esophageal cancer, breast cancer, leukemia, lymphoma, thyroid tumor, uterine fibroids, neuroblastoma, astrocytoma, ependymoma, glioblastoma, Colon cancer, melanoma, adrenal cancer, bladder cancer, bone cancer, osteosarcoma, myeloma, bone marrow cancer, brain cancer, uterine cancer, endometrial cancer, gallbladder cancer, colon cancer, thymic tumor, nasal cavity and sinus tumor, nose Pharyngeal cancer, Laryngeal cancer, Tracheal tumor, Fibroma, Fibrosarcoma, Lipoma, Liposarcoma, Leiomyoma
  • Abnormal expression of the ATP synthase 9 of the present invention will also produce certain inflammations, certain hereditary, hematological diseases, and immune system diseases.
  • polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat various diseases, especially myasthenia gravis, embryonic development disorders, growth and development disorders, tumors, certain inflammations, Certain hereditary, hematological and immune system diseases.
  • the invention also provides methods for screening compounds to identify agents that increase (agonist) or inhibit (antagonist) ATP synthase 9.
  • Agonists enhance biological functions such as ATP synthase 9 to stimulate cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
  • mammalian cells or membrane preparations expressing ATP synthase 9 can be cultured with labeled ATP synthase 9 in the presence of a drug. The ability of the drug to increase or block this interaction is then determined.
  • Antagonists of ATP synthase 9 include antibodies, compounds, receptor deletions, and the like that have been screened. Antagonists of ATP synthase 9 can bind to ATP synthase 9 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot perform biological functions. In screening for compounds that act as antagonists, ATP synthase 9 can be added to a bioanalytical assay to determine whether a compound is an antagonist by measuring the effect of the compound on the interaction between ATP synthase 9 and its receptor. Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above. Polypeptide molecules capable of binding to ATP synthase 9 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. During screening, 9 molecules of ATP synthase should generally be labeled.
  • the present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies.
  • the invention also provides antibodies against the ATP synthase 9 epitope. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by Fab expression libraries.
  • Polyclonal antibodies can be produced by injecting ATP synthase 9 directly into immunized animals (such as rabbits, mice, rats, etc.).
  • immunized animals such as rabbits, mice, rats, etc.
  • a variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's adjuvant.
  • Techniques for preparing monoclonal antibodies against ATP synthase 9 include, but are not limited to, hybridoma technology (Kohler and Milste in. Nature, 1975, 256: 495-497), triple tumor technology, and human beta-cell hybridoma technology , EBV-hybridoma technology, etc.
  • Chimeric antibodies that bind human constant regions and non-human variable regions can be produced using existing techniques (Morris on e t a l, PNAS, 1 985, 81: 6851).
  • the existing technology for producing single chain antibodies (U.S. Pat No. 4946778) can also be used to produce single chain antibodies against ATP synthase 9.
  • Antibodies against ATP synthase 9 can be used in immunohistochemistry to detect ATP synthase 9 in biopsy specimens.
  • Monoclonal antibodies that bind to ATP synthase 9 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
  • Antibodies can also be used to design immunotoxins that target a particular part of the body.
  • ATP synthase 9 high-affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
  • a common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
  • This hybrid antibody can be used to kill ATP synthase 9 positive cells.
  • the antibodies of the present invention can be used to treat or prevent diseases related to ATP synthase 9.
  • Administration of appropriate doses of antibodies can stimulate or block the production or activity of ATP synthase 9.
  • the invention also relates to a diagnostic test method for quantitatively and locally detecting the level of ATP synthase 9.
  • tests are well known in the art and include FI SH assays and radioimmunoassays.
  • the level of ATP synthase 9 detected in the test can be used to explain the importance of ATP synthase 9 in various diseases and for diagnosis Diseases where ATP synthase 9 functions.
  • polypeptide of the present invention can also be used for peptide mapping analysis.
  • the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
  • the polynucleotide encoding ATP synthase 9 can also be used for a variety of therapeutic purposes.
  • Gene therapy technology can be used to treat abnormal cell proliferation, development or metabolism caused by the non-expression or abnormal / inactive expression of ATP synthase 9.
  • Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated ATP synthase 9 to inhibit endogenous ATP synthase 9 activity.
  • a mutated ATP synthase 9 may be a shortened ATP synthase 9 lacking a signaling domain. Although it can bind to downstream substrates, it lacks signaling activity.
  • recombinant gene therapy vectors can be used to treat diseases caused by abnormal expression or activity of ATP synthase 9.
  • Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, and parvovirus can be used to transfer a polynucleotide encoding ATP synthase 9 into a cell.
  • Methods for constructing recombinant viral vectors carrying a polynucleotide encoding ATP synthase 9 can be found in the existing literature (Sambrook, et al.).
  • a recombinant polynucleotide encoding ATP synthase 9 can be packaged into liposomes and transferred into cells.
  • Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
  • a vector such as a virus, phage, or plasmid
  • Oligonucleotides including antisense RNA and DNA
  • ribozymes that inhibit ATP synthase 9 mRNA are also within the scope of the present invention.
  • a ribozyme is an enzyme-like RNA molecule that specifically decomposes specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation.
  • Antisense RNA, DM, and ribozymes can be obtained using any existing RNA or DNA synthesis techniques, such as solid-phase phosphate amide chemical synthesis to synthesize oligonucleotides.
  • Antisense RNA molecules can be obtained by in vitro or in vivo transcription of DM sequences encoding the RNA.
  • This DM sequence has been integrated downstream of the RNA polymerase promoter of the vector.
  • it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the phosphorothioate or peptide bond instead of the phosphodiester bond is used for the ribonucleoside linkage.
  • the polynucleotide encoding ATP synthase 9 can be used for the diagnosis of diseases related to ATP synthase 9.
  • the polynucleotide encoding ATP synthase 9 can be used to detect the expression of ATP synthase 9 or the abnormal expression of ATP synthase 9 in a disease state.
  • the DNA sequence encoding ATP synthase 9 can be used to hybridize biopsy specimens to determine the expression of ATP synthase 9.
  • Hybridization techniques include Sou thern blotting, Northern blotting, and in situ hybridization. These techniques and methods are publicly available and mature, and related kits are commercially available.
  • Part or all of the polynucleotides of the invention can be used as probes It is fixed on a microarray or a DNA chip (also called a "gene chip"), and is used to analyze differential expression analysis and gene diagnosis of genes in tissues.
  • ATP synthase 9 specific primers can be used to detect RNA-polymerase chain reaction (RT-PCR) in vitro amplification to detect ATP synthase 9 transcription products.
  • Detection of mutations in the ATP synthase 9 gene can also be used to diagnose ATP synthase 9-related diseases.
  • ATP synthase 9 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type ATP synthase 9 DNA sequence. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR, and in situ hybridization. In addition, mutations may affect protein expression, so Northern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
  • sequences of the invention are also valuable for chromosome identification. This sequence will specifically target a specific position on a human chromosome and can hybridize to it. Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for marking chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DM sequences on a chromosome.
  • PCR primers (preferably 15-35bp) are prepared based on cDNA, and the sequences can be located on chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
  • PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
  • oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
  • Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.
  • Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step.
  • FISH Fluorescent in situ hybridization
  • the CDM or genomic sequence differences between the affected and unaffected individuals need to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for staining Structural changes in the body, such as deletions or translocations that are visible from the chromosomal level or detectable with cDNA sequence-based PCR. Based on the resolution capabilities of current physical mapping and gene mapping technology, the CDM that is accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).
  • the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
  • suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
  • the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
  • the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell.
  • the polypeptides of the invention can be used in combination with other therapeutic compounds.
  • the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
  • ATP synthase 9 is administered in an amount effective to treat and / or prevent a particular indication.
  • the amount and dosage range of ATP synthase 9 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician.
  • Total human fetal brain RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform.
  • Poly (A) mRNA was isolated from total RNA using Quik mRNA Isolation Kit (Qiegene). 2ug poly (A) mRNA is reverse transcribed to form cDNA.
  • the Smart cDNA cloning kit purchased from Clontech was used to insert the cDNA fragment into the multiple cloning site of the pBSK (+) vector (Clontech) to transform DH5 ⁇ . The bacteria formed a cDNA library.
  • Dye terminate cycle reaction ion sequencing kit Perkin-Elmer
  • ABI 377 automatic sequencer Perkin-Elmer
  • the determined cDNA sequence was compared with the existing public DNA sequence database (Genebank), and it was found that the cDNA sequence of one of the clones, 0922-bl2, was new DNA. Insert a cDNA fragment into the clone by synthesizing a series of primers Segments are measured in both directions.
  • the sequence of the ATP synthase 9 of the present invention and the protein sequence encoded by the ATP synthase 9 were profiled using the basic scan search tool (Basic local alignment search tool) in GCG [Al tschul, SF et al. J. Mol. Biol. 1990; 215: 403 -10], perform domain analysis in databases such as prosite.
  • the ATP synthetase 9 of the present invention is homologous with the characteristic protein of the domain ATP synthase at 30-77. The results of the homology are shown in Fig. 1. The homology rate is 0.14, the score is 6.52; the threshold is 6.52.
  • Example 3 Cloning of a gene encoding ATP synthase 9 by RT-PCR
  • CDNA was synthesized using fetal brain total RNA as a template and oligo-dT as a primer for reverse transcription reaction. After purification using Qiagene's kit, the following primers were used for PCR amplification:
  • Primerl 5'- GTATTTGCAGCCATTAGATGAATT —3 '(SEQ ID NO: 3)
  • Primer2 5'- GCTTAATTCCCCTAAGCTTGGTCT -3 '(SEQ ID NO: 4)
  • Primerl is a forward sequence located at the 5th end of SEQ ID NO: 1, starting at lbp;
  • Primer2 is the 3 'end reverse sequence in SEQ ID NO: 1.
  • Conditions for the amplification reaction 50 mmol / L KC1, 10 crypto ol / L Tris-HCl, pH 8.5, 1.5 mmol / L MgCl 2 , 200 ⁇ 1 / ⁇ dNTP, lOpmol primer, 1U Taq DNA in a 50 ⁇ 1 reaction volume Polymerase (Clontech).
  • the reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) under the following conditions for 25 cycles: 94 ° C 30sec; 55 ° C 30sec; 72 ° C 2min.
  • RT-PCR set P-act in as a positive control and template blank as a negative control.
  • the amplified product was purified using a QIAGEN kit, and ligated to a pCR vector (Invitrogen product) using a TA cloning kit.
  • DM sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as the 1-2010bp shown in SEQ ID NO: 1.
  • Example 4 Northern blot analysis of ATP synthase 9 gene expression
  • This method involves acid guanidinium thiocyanate phenol-chloroform extraction. That is, the tissue is homogenized with 4M guanidine isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1) are added. ), Mix and centrifuge. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. Will The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water.
  • a 32P-labeled probe (approximately 2 X 10 6 cpm / mU and a nitrocellulose membrane to which RNA was transferred were hybridized overnight at 42 ° C in a solution containing 50% formamide-25mM KH 2 P0 4 (pH 7 .4) -5 ⁇ SSC-5 X Denhardt's solution and 2G ( ⁇ g / ml salmon sperm DNA. After hybridization, the filter was washed in 1 ⁇ SSC-0.1 ° /. SDS at 55 ° C for 30 minutes. Then, use Phosphor Imager analysis and quantification.
  • Example 5 In vitro expression, isolation and purification of recombinant ATP synthase 9
  • Primer3 5'- CATGCTAGCATGTATTGGAGTTTTCTTTATGTT -3 '(Seq ID No: 5)
  • Primer4 5'- CATGGATCCTTAAGAGGGGATAGAGAGAGAGAT -3' (Seq ID No: 6)
  • the Nhel and BamHI restriction sites correspond to the selectivity within the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865.3). Digestion site.
  • PCR was performed using the pBS-0922-M2 plasmid containing the full-length target gene as a template.
  • the PCR reaction conditions were as follows: a total volume of 50 ⁇ 1 containing 10 pg of pBS-0922-bl2 plasmid, primers Primer-3 and Primer-4 were lpmol, Advantage polymerase Mix (Clontech) 1 ⁇ 1, respectively. Cycle parameters: 94 ° C 20s, 60 ° C 30s, 68 ° C 2 min, a total of 25 cycles. Nhe I and BaniH I were used to double digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase.
  • the ligation product was transformed into the colibacillus DH5 CX by the calcium chloride method. After being cultured on an LB plate containing kanamycin (final concentration 30 g / ml) overnight, positive clones were selected by colony PCR method and sequenced. A positive clone (PET-0922-M2) with the correct sequence was selected, and the recombinant plasmid was transformed into E. coli BL21 (DE3) plySs (product of Novagen) using the calcium chloride method.
  • kanamycin final concentration of 30 ⁇ ⁇ / ⁇ 1 in LB liquid medium
  • host strain BL21 P ET-0922-bl2
  • IPTG was added to a final concentration of lmmol / L, continue to cultivate for 5 hours.
  • the bacteria were collected by centrifugation, and the supernatant was collected by centrifugation.
  • the supernatant was collected by centrifugation, and chromatography was performed using an affinity column His. Bind Quick Cartridge (product of Novagen) capable of binding to 6 histidines (6His-Tag).
  • a purified target protein ATP synthase 9 was obtained.
  • a peptide synthesizer (product of PE) was used to synthesize the following ATP synthase 9-specific peptides:
  • NH2-Met-Tyr-Trp-Ser-Phe-Leu-Tyr-Va l-I l e-Cys-Va l-Phe-Phe-Leu-Asp-C00H (SEQ ID NO: 7).
  • the polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex.
  • Rabbits were immunized with 4 mg of the hemocyanin-polypeptide complex plus complete Freund's adjuvant, and 15 days later, the hemocyanin-polypeptide complex plus incomplete Freund's adjuvant was used to boost immunity once.
  • a titer plate coated with a 15 g / ml bovine serum albumin peptide complex was used as an ELISA to determine antibody titers in rabbit serum.
  • Protein A-Sepharose was used to isolate total IgG from antibody-positive rabbit serum.
  • the peptide was bound to a cyanogen bromide-activated Sepharose4B column, and anti-peptide antibodies were separated from the total IgG by affinity chromatography.
  • the immunoprecipitation method demonstrated that the purified antibody specifically binds to ATP synthase 9.
  • Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
  • the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
  • the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
  • the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method.
  • Filter hybridization methods include dot blotting, Sou thern blotting, Nor thern blotting, and copying methods. They are all used to fix the polynucleotide sample to be tested on the filter and then hybridize using basically the same steps.
  • the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer, so that the non-specific binding site of the sample on the filter is saturated with the carrier and the synthetic polymer.
  • the pre-hybridization solution is then replaced with a hybridization buffer containing the labeled probe and incubated to hybridize the probe to the target nucleic acid.
  • the unhybridized probes are removed by a series of membrane washing steps.
  • This embodiment utilizes higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals.
  • the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
  • the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
  • the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained. First, the selection of the probe
  • oligonucleotide fragments for use as hybridization probes from the polynucleotide SEQ ID NO: 1 of the present invention should follow the following principles and several aspects to be considered:
  • the preferred range of probe size is 18-50 nucleotides
  • Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements For homology comparison of the regions, if the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, the primary probe should not be used generally;
  • Probe 1 (probel), which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt)
  • Probe 2 which belongs to the second type of probe, is equivalent to the replacement mutant sequence of the gene fragment of SEQ ID NO: 1 or its complementary fragment (41Nt):
  • PBS phosphate buffered saline
  • step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
  • NC membranes nitrocellulose membranes
  • the film is washed with high-strength conditions and strength conditions, respectively.
  • Aspirate and control 15 microliters each, spot on the sample film, and dry at room temperature.
  • the 32 P-Probe (the second peak is free ⁇ - 32 P-dATP) is prepared.
  • the sample membrane was placed in a plastic bag, and 3-1 Omg pre-hybridization solution (1 OxDenhardfs; 6xSSC, 0.1 mg / ml CT DM (calf thymus DNA)) was added. After sealing the mouth of the bag, shake at 68 ° C for 2 hours.
  • 3-1 Omg pre-hybridization solution (1 OxDenhardfs; 6xSSC, 0.1 mg / ml CT DM (calf thymus DNA)

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

L'invention concerne un nouveau polypeptide, une ATP synthétase 9, et un polynucléotide codant pour ce polypeptide ainsi qu'un procédé d'obtention de ce polypeptide par des techniques recombinantes d'ADN. L'invention concerne en outre les applications de ce polypeptide dans le traitement de maladies, notamment des tumeurs malignes, de l'hémopathie, de l'infection par VIH, de maladies immunitaires et de diverses inflammations. L'invention concerne aussi l'antagoniste agissant contre le polypeptide et son action thérapeutique ainsi que les applications de ce polynucléotide codant pour l'ATP synthétase 9.
PCT/CN2000/000647 1999-12-29 2000-12-25 Nouveau polypeptide, atp synthetase 9, et polynucleotide codant pour ce polypeptide WO2001049723A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU21421/01A AU2142101A (en) 1999-12-29 2000-12-25 A novel polypeptide-atpase 9 and the polynucleotide encoding said polypeptide

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN 99127220 CN1301858A (zh) 1999-12-29 1999-12-29 一种新的多肽--atp合成酶9和编码这种多肽的多核苷酸
CN99127220.X 1999-12-29

Publications (1)

Publication Number Publication Date
WO2001049723A1 true WO2001049723A1 (fr) 2001-07-12

Family

ID=5284808

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2000/000647 WO2001049723A1 (fr) 1999-12-29 2000-12-25 Nouveau polypeptide, atp synthetase 9, et polynucleotide codant pour ce polypeptide

Country Status (3)

Country Link
CN (1) CN1301858A (fr)
AU (1) AU2142101A (fr)
WO (1) WO2001049723A1 (fr)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1998055063A1 (fr) * 1997-06-06 1998-12-10 Sca Hygiene Products Ab Article absorbant avec protection amelioree contre les fuites
EP0892064A2 (fr) * 1997-06-04 1999-01-20 Smithkline Beecham Corporation Polypeptides recombinants secA2 de Staphylococcus aureus et leurs utilisations

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0892064A2 (fr) * 1997-06-04 1999-01-20 Smithkline Beecham Corporation Polypeptides recombinants secA2 de Staphylococcus aureus et leurs utilisations
WO1998055063A1 (fr) * 1997-06-06 1998-12-10 Sca Hygiene Products Ab Article absorbant avec protection amelioree contre les fuites

Also Published As

Publication number Publication date
AU2142101A (en) 2001-07-16
CN1301858A (zh) 2001-07-04

Similar Documents

Publication Publication Date Title
WO2002026972A1 (fr) Nouveau polypeptide, proteine humaine 20.13 de liaison de l'acide polyadenylique, et polynucleotide codant ce polypeptide
WO2001090169A1 (fr) Nouveau polypeptide, antigene nucleaire de proliferation cellulaire (pcna) 13, et polynucleotide codant ce polypeptide
WO2001047968A1 (fr) Nouveau polypeptide, hexokinase 12, et polynucleotide codant pour ce polypeptide
WO2001049723A1 (fr) Nouveau polypeptide, atp synthetase 9, et polynucleotide codant pour ce polypeptide
WO2001047983A1 (fr) Nouveau polypeptide, facteur de liberation de la corticotrophine 13, et polynucleotide codant pour ce polypeptide
WO2001048173A1 (fr) Nouveau polypeptide, aminoacyl-arnt synthetase humaine 10, et polynucleotide codant pour ce polypeptide
WO2001049724A1 (fr) Nouveau polypeptide, proteine lissencephale humaine 43, et polynucleotide codant pour ce polypeptide
WO2001049858A1 (fr) NOUVEAU POLYPEPTIDE, η-GLUTAMYL TRANSPEPTIDASE 9, ET POLYNUCLEOTIDE CODANT POUR CE POLYPEPTIDE
WO2001070800A1 (fr) Nouveau polypeptide, proteine humaine 11 helicase atp-dependante, et polynucleotide codant pour ce polypeptide
WO2002026810A1 (fr) Nouveau polypeptide, substance proteique p125-77.22, et polynucleotide codant ce polypeptide
WO2001048195A1 (fr) Nouveau polypeptide, proteine rcc1 10, et polynucleotide codant pour ce polypeptide
WO2001075125A1 (fr) Nouveau polypeptide, serine hydrolase humaine atp-dependante 31, et polynucleotide codant pour ce polypeptide
WO2001064733A1 (fr) Nouveau polypeptide, facteur humain 22 lie a la transcription inverse, et polynucleotide codant pour ce polypeptide
WO2001049725A1 (fr) NOUVEAU POLYPEPTIDE, FACTEUR σ-54 13, ET POLYNUCLEOTIDE CODANT POUR CE POLYPEPTIDE
WO2001048159A1 (fr) Nouveau polypeptide, dihydroorotase 9, et polynucleotide codant pour ce polypeptide
WO2001047984A1 (fr) Nouveau polypeptide, proteine 10 de la famille des amidases, et polynucleotide codant pour ce polypeptide
WO2001047994A1 (fr) Nouveau polypeptide, proteine 10 utilisant pep, et polynucleotide codant pour ce polypeptide
WO2001049853A1 (fr) Phosphoribosyle glycinamide synthase 9 et polynucleotide codant ce polypeptide
WO2001046242A1 (fr) NOUVEAU POLYPEPTIDE, GENE σ-54 9, ET POLYNUCLEOTIDE CODANT POUR CE POLYPEPTIDE
WO2001049731A1 (fr) Nouveau polypeptide, proteine de regulation 9 de la protease humaine, et polynucleotide codant pour ce polypeptide
WO2001048001A1 (fr) Nouveau polypeptide, quinone-proteine reductase 7, et polynucleotide codant pour ce polypeptide
WO2001081385A1 (fr) Nouveau polypeptide, nucleotide reductase humaine 9, et polynucleotide codant pour ce polypeptide
WO2001047987A1 (fr) Nouveau polypeptide, gene $g(s)-54, et polynucleotide codant pour ce polypeptide
WO2001048174A1 (fr) Nouveau polypeptide, saccharide hydrolase humaine 11, et polynucleotide codant pour ce polypeptide
WO2001047997A1 (fr) Nouveau polypeptide, stathmine 8, et polynucleotide codant pour ce polypeptide

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP