WO2001079428A2 - Nouveau polypeptide, proteine humaine de reparation 8.9 du mesappariement de l'adn, et polynucleotide codant pour ce polypeptide - Google Patents

Nouveau polypeptide, proteine humaine de reparation 8.9 du mesappariement de l'adn, et polynucleotide codant pour ce polypeptide Download PDF

Info

Publication number
WO2001079428A2
WO2001079428A2 PCT/CN2001/000380 CN0100380W WO0179428A2 WO 2001079428 A2 WO2001079428 A2 WO 2001079428A2 CN 0100380 W CN0100380 W CN 0100380W WO 0179428 A2 WO0179428 A2 WO 0179428A2
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
polynucleotide
mismatch repair
repair protein
human dna
Prior art date
Application number
PCT/CN2001/000380
Other languages
English (en)
Chinese (zh)
Other versions
WO2001079428A3 (fr
Inventor
Yumin Mao
Yi Xie
Original Assignee
Biowindow Gene Development Inc. Shanghai
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Biowindow Gene Development Inc. Shanghai filed Critical Biowindow Gene Development Inc. Shanghai
Priority to AU56056/01A priority Critical patent/AU5605601A/en
Publication of WO2001079428A2 publication Critical patent/WO2001079428A2/fr
Publication of WO2001079428A3 publication Critical patent/WO2001079428A3/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders

Definitions

  • the present invention belongs to the field of biotechnology. Specifically, the present invention describes a novel polypeptide-human DNA mismatch repair protein 8.9, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and polypeptide. Background technique
  • DNA polymerase can occasionally catalyze the incorporation of the wrong base that cannot form a hydrogen bond with the template. This replication error is usually corrected immediately by the DNA polymerase's 3 '-5' proofreading function before the next nucleotide polymerization reaction begins. However, under certain conditions, DNA polymerases leave very few erroneous bases on the DNA strand without correction. It is estimated that the frequency of such errors is 10-8. However, the mutation frequency that people actually measure is 10 ⁇ ° or 10_ ". Since the integrity and accuracy of DNA is the root of life, another repair system has evolved in the cell, called the mismatch repair system, giving the second (Modrich P. Annu. Rev. Biochem.
  • Adenine methylation is an identification mark for mismatch repair. According to the characteristics of methylation, errors With the repair system, the template strand and the nascent strand can be identified, thereby correcting the unpaired bases on the nascent, ensuring high accuracy and integrity.
  • DNA mismatch repair protein is an important component protein in mismatch repair system.
  • DNA mismatch repair protein exists in many organisms, for example, mutL protein of E. coli; hexB protein of streptococcus; PMS1 and MLH1 proteins of yeast; Human MLH1 (MutL homologue-1) protein and so on.
  • HNPCC colorectal cancer
  • the human DNA mismatch repair protein 8.9 protein plays an important role in regulating important functions of the body such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes, so more needs to be identified in the art
  • the human DNA mismatch repair protein 8.9 protein involved in these processes, especially the amino acid sequence of this protein is identified.
  • Newcomer DNA mismatch repair protein 8.9 The isolation of protein-coding genes also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so it is important to isolate its coding DNA. Disclosure of invention
  • An object of the present invention is to provide an isolated novel polypeptide-human DNA mismatch repair protein 8.9 and fragments, analogs and derivatives thereof.
  • Another object of the invention is to provide a polynucleotide encoding the polypeptide.
  • Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding a human DNA mismatch repair protein 8.9.
  • Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding a human DNA mismatch repair protein 8.9.
  • Another object of the present invention is to provide a method for producing human DNA mismatch repair protein 8.9.
  • Another object of the present invention is to provide an antibody against the polypeptide of the present invention-human DNA mismatch repair protein 8.9.
  • Another object of the present invention is to provide mimic compounds, antagonists, agonists, and inhibitors directed to the polypeptide-to-human DNA mismatch repair protein 8.9 of the present invention.
  • Another object of the present invention is to provide a method for diagnosing and treating diseases associated with abnormalities in human DNA mismatch repair protein 8.9.
  • the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
  • the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
  • sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 1244-1492 in SEQ ID NO: 1; and (b) a sequence having 1-1583 in SEQ ID NO: 1 Sequence of bits.
  • the present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
  • the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
  • the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit human DNA mismatch repair protein 8.9 protein activity, which comprises utilizing the polypeptide of the invention.
  • the invention also relates to compounds obtained by this method.
  • the present invention also relates to a method for in vitro detection of a disease or disease susceptibility associated with abnormal expression of a human DNA mismatch repair protein 8.9 protein, comprising detecting a mutation in the polypeptide or a sequence encoding a polynucleotide thereof in a biological sample, Alternatively, the amount or biological activity of a polypeptide of the invention in a biological sample is detected.
  • the invention also relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
  • the present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention in the preparation of a medicament for treating cancer, developmental disease or immune disease or other diseases caused by abnormal expression of human DNA mismatch repair protein 8.9.
  • Nucleic acid sequence refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
  • amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
  • amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
  • a “variant" of a protein or polynucleotide refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it.
  • the changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence.
  • Variants can have "conservative" changes, in which the amino acid substituted has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine.
  • Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
  • “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
  • Insertion refers to an alteration in the amino acid sequence or nucleotide sequence that results in an increase in one or more amino acids or nucleotides compared to a naturally occurring molecule.
  • Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
  • Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
  • immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response in appropriate animals or cells and to bind to specific antibodies.
  • An "agonist” refers to a molecule that, when combined with human DNA mismatch repair protein 8.9, causes the protein to change, thereby regulating the activity of the protein.
  • An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that can bind to human DNA mismatch repair protein 8.9.
  • Antagonist refers to a molecule that can block or regulate the biological or immunological activity of human DNA mismatch repair protein 8.9 when combined with human DNA mismatch repair protein 8.9 .
  • Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates or any other molecule that can bind to human DNA mismatch repair protein 8.9.
  • Regular refers to a change in the function of human DNA mismatch repair protein 8.9, including an increase or decrease in protein activity, a change in binding characteristics, and any other biological properties and functions of human DM mismatch repair protein 8.9 Or changes in immune properties.
  • Those skilled in the art can purify human DM mismatch repair protein 8.9 using standard protein purification techniques.
  • the substantially pure human DNA mismatch repair protein 8.9 produces a single main band on a non-reducing polyacrylamide gel.
  • the purity of human DNA mismatch repair protein 8.9 can be analyzed by amino acid sequence.
  • Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
  • sequence C-T-G-A
  • complementary sequence G-A-C-T.
  • the complementarity between two single-stranded molecules may be partial or complete.
  • the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
  • “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
  • Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Southern imprinting or Northern blotting, etc.) under conditions of reduced stringency. Substantially homologous sequences or hybridization probes can compete and inhibit the binding of fully homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that conditions with reduced stringency allow non-specific binding, because conditions with reduced stringency require that the two sequences bind to each other as either specific or selective interactions.
  • Percent identity refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences.
  • the percentage identity can be determined electronically, such as by the MEGALIGN program (Lasergene software package, DNASTAR, Inc., Madison Wis.).
  • the MEGALIGN program can compare two or more sequences according to different methods such as the Cluster method (Higgins, DG and PM Sharp (1988) Gene 73: 237-244).
  • the Cluster method arranges groups of sequences into clusters by checking the distance between all pairs. The clusters are then assigned in pairs or groups.
  • the percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula: The number of matching residues between sequence A and sequence X 100
  • the number of residues in sequence A-the number of spacer residues in sequence A B is a spacer sequence of residues may be measured as Jotun Hein percent identity between nucleic acid sequences or by using Cluster method known in the art (Hein J., (1990) methods in emzumology 183: 625-645) 0 "Similarity” refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
  • Amino acids used for conservative substitutions may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; have uncharged Amino acids with similar hydrophilicity in the head group may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine Acid and tyrosine.
  • Antisense refers to a nucleotide sequence that is complementary to a particular D or RNA sequence.
  • Antisense strand refers to a nucleic acid strand that is complementary to a “sense strand.”
  • Derivative refers to a chemical modification of HFP or a nucleic acid encoding it. This chemical modification may be a substitution of a hydrogen atom with a fluorenyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
  • Antibody refers to an intact antibody molecules and fragments thereof, such as Fa, F (a b ') 2 and F V> which specifically binds to human DNA mismatch repair protein antigenic determinants 8.9.
  • a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
  • isolated refers to the removal of a substance from its original environment (for example, its natural environment if it is naturally occurring).
  • a naturally-occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
  • Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not part of its natural environment, they are still isolated.
  • isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
  • polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances in the natural state .
  • isolated human DNA mismatch repair protein 8. 9 refers to human DNA mismatch repair protein 8.9 which is substantially free of other proteins, lipids, sugars or other substances that are naturally associated with it. Those skilled in the art can use standard protein purification techniques to purify human DNA mismatch repair proteins 8.9. Substantially pure peptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of human DM mismatch repair protein 8.9 peptides can be analyzed by amino acid sequence.
  • the present invention provides a novel polypeptide-human DNA mismatch repair protein 8.9, which is basically composed of the amino acid sequence shown in SEQ ID NO: 2.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
  • the polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques.
  • polypeptide of the invention may be glycosylated , Or can be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
  • the invention also includes fragments, derivatives and analogs of the human DNA mismatch repair protein 8.9. As used in the present invention, the terms “fragment”, “derivative” and “analog” refer to a polypeptide that substantially maintains the same biological function or activity of the human D mismatch repair protein 8.9 of the present invention.
  • a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution
  • the amino acid may or may not be encoded by a genetic codon; or ( ⁇ ) such a type in which a group on one or more amino acid residues is substituted by another group to include a substituent; or (in) such A type in which a mature polypeptide is fused to another compound (such as a compound that extends the half-life of a polypeptide, such as polyethylene glycol); or (IV) a type of polypeptide sequence in which an additional amino acid sequence is fused into a mature polypeptide (such as the leader sequence or secreted sequence or the sequence used to purify this polypeptide or protease sequence)
  • such fragments, derivatives and analogs are considered to be within the knowledge of those skilled in the art.
  • the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
  • the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a full-length polynucleotide sequence of 1,583 bases, and its open reading frame of 1,244-1492 encodes 82 amino acids. According to the comparison of gene chip expression profiles, it was found that this peptide has a similar expression profile with human DNA mismatch repair protein 1 1. It can be inferred that the human DNA mismatch repair protein 8.9 has a similar function as human DNA mismatch repair protein 1. .
  • the polynucleotide of the present invention may be in the form of DNA or RNA.
  • DNA forms include cDNA, genomic DNA, or synthetic DNA.
  • DNA can be single-stranded or double-stranded.
  • DNA can be coding or non-coding.
  • the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
  • a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 in the present invention, but which differs from the coding region sequence shown in SEQ ID NO: 1.
  • the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
  • polynucleotide encoding a polypeptide is meant to include polynucleotides that encode such polypeptides and polynucleotides that include additional coding and / or noncoding sequences.
  • the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention. Variants of this polynucleotide may be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
  • an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
  • the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity, between the two sequences).
  • the present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions.
  • "strict conditions” means: ([hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60'C; or (2) added during hybridization Denaturing agents, such as 50% (v / v) formamide, 0.1% calf serum / 0.1 ° /.
  • the identity between the two sequences is at least 95 Hybridization occurs only when it is at least%, and more preferably at least 97%.
  • the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
  • nucleic acid fragments that hybridize to the sequences described above.
  • a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 cores. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques (such as PCR) to identify and / or isolate polynucleotides encoding human DNA mismatch repair protein 8.9.
  • polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
  • the specific polynucleotide sequence encoding the human DNA mismatch repair protein 8.9 of the present invention can be obtained by various methods.
  • polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
  • the DM fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.
  • genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences.
  • the standard method for isolating cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library. There are many mature techniques for extracting mRNA, and kits are also commercially available (Qiagene).
  • the construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989).
  • Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
  • the genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (DDNA-DNA or DNA-RNA hybridization; (2) the presence or absence of a marker gene function; (3) measuring the level of the human DNA mismatch repair protein 8.9 transcript; (4) The protein product of gene expression is detected by immunological techniques or by measuring biological activity. The above methods can be used alone or in combination.
  • the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
  • the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
  • the probe used here is generally a DNA sequence chemically synthesized based on the gene sequence information of the present invention.
  • the genes or fragments of the present invention can of course be used as probes.
  • DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
  • immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) can be used to detect the protein product of human DNA mismatch repair protein 8.9 gene expression.
  • the RACE method RACE-rapid amplification of cDNA ends
  • the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Select and synthesize using conventional methods.
  • the amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
  • polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, the sequencing must be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
  • the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using a human DNA mismatch repair protein 8.9 coding sequence, and a recombinant technology to produce a polypeptide of the present invention. method.
  • a polynucleotide sequence encoding a human DNA mismatch repair protein 8.9 can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
  • vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
  • Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vector (Rosenberg, et al.
  • pMSXND expression vector expressed in mammalian cells (Lee and Nathans, J Bio Chem. 263: 3521, 1988) and in insects A baculovirus-derived vector expressed in cells.
  • any plasmid and vector can be used to construct a recombinant expression vector.
  • An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
  • Methods known to those skilled in the art can be used to construct expression vectors containing a DM sequence encoding human DNA mismatch repair protein 8.9 and appropriate transcription / translation regulatory elements. These methods include in vitro recombinant DNA technology, DNA synthesis technology, and in vivo recombination technology (Sambroook, et al. Molecular Cloning, a Laboratory Manual, cold Spring Harbor Laboratory. New York, 1989).
  • the DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis. Representative examples of these promoters are: the lac or trp promoter of E.
  • the expression vector also includes a ribosome binding site for translation initiation and a transcription terminator. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers on the late side of the origin of replication, and adenovirus enhancers.
  • the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • GFP fluorescent protein
  • tetracycline or ampicillin resistance for E. coli.
  • a polynucleotide encoding human DNA mismatch repair protein 8.9 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a genetically engineered host cell containing the polynucleotide or the recombinant vector.
  • the term "host cell” refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E.
  • Transformation of a host cell with a DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art.
  • the host is a prokaryote such as E. coli
  • competent cells capable of DNA uptake can be harvested after exponential growth phase, with (: Treatment 1 2, steps well known in the art with alternative is MgC l 2 If necessary, transformation can also be performed by electroporation.
  • the host is a eukaryote, the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and lipids. Body packaging, etc.
  • the polynucleotide sequence of the present invention can be used to express or produce recombinant human DNA mismatch repair protein 8.9 (Scence, 1984; 224: 1431). Generally there are the following steps:
  • the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
  • a suitable method such as temperature conversion or chemical induction
  • the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell.
  • recombinant proteins can be separated and purified by various separation methods using their physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
  • conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography
  • FIG. 1 is a comparison diagram of gene chip expression profiles of human DNA mismatch repair protein 8.9 and human DNA mismatch repair protein 11 of the present invention.
  • the upper graph is a graph of the expression profile of human DNA mismatch repair protein 8.9, and the lower graph is the graph of the expression profile of human DNA mismatch repair protein 11.
  • 1 indicates fetal kidney
  • 2 indicates fetal large intestine
  • 3 indicates fetal small intestine
  • 4 indicates fetal muscle
  • 5 indicates fetal brain
  • 6 indicates fetal bladder
  • 7 indicates non-starved L02
  • 8 indicates L02 +, lhr
  • 9 means ECV304 PMA-
  • 10 means ECV304 PMA +
  • 11 means fetal liver
  • 12 means normal liver
  • 13 means thyroid
  • 14 means skin
  • 15 means fetal lung
  • 16 means lung
  • 17 means lung cancer
  • 18 Indicates fetal spleen
  • 19 indicates spleen
  • 20 indicates prostate
  • 21 indicates fetal heart
  • 22 indicates heart
  • 23 indicates muscle
  • 24 indicates testis
  • 25 indicates fetal thymus
  • 26 indicates thymus.
  • Figure 2 is a polyacrylamide gel electrophoresis image of the isolated human DNA mismatch repair protein 8.9 (SDS-1)
  • the determined cDNA sequence was compared with the existing public DNA sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 0872gll was new DNA.
  • the inserted cDNA fragments contained in this clone were determined in both directions by synthesizing a series of primers.
  • the results show that the 0872gll clone contains a full-length cDNA of 1583bp (as shown in Seq IDN0: l), and has a 249bp open reading frame (0RF) from 1244bp to 1492bp, which encodes a new protein (such as Seq ID NO: 2).
  • This clone pBS-0872gll and the encoded protein was named human DNA mismatch repair protein 8.9.
  • Example 2 Cloning of a gene encoding human DNA mismatch repair protein 8.9 by RT-PCR
  • CDNA was synthesized using fetal brain total RNA as a template and oligo-dT as a primer for reverse transcription reaction. After purification using Qiagene's kit, the following primers were used for PCR amplification:
  • Primerl 5'- TGCAGGCTGAGAAGAAGGGCTTTC -3 '(SEQ ID NO: 3)
  • Primer2 5'- GACCAGCCTGGGCAACCTGGTGAG -3 '(SEQ ID NO: 4)
  • Primerl is a forward sequence located at the 5th end of SEQ ID NO: 1 and beginning at lbp;
  • Priraer2 is the 3 'end reverse sequence in SEQ ID NO: 1.
  • Conditions for the amplification reaction 50 mmol / L KC1, 10 mmol / L Tris-CI, (pH 8.5), 1.5 ramol / L MgCl 2 , 200 ⁇ mol / L dNTP, lOpmol primers in a 50 ⁇ 1 reaction volume, 1U of Taq DNA polymerase (Clontech).
  • the reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) for 25 cycles under the following conditions: 94 ° C 30sec; 55 ° C 30sec; 72. C 2min.
  • ⁇ -act in was set as a positive control and template blank was set as a negative control.
  • the amplified product was purified using a QIAGEN kit and ligated to a PCR vector using a TA cloning kit (Invitrogen). DNA sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as 1-1583bp shown in SEQ ID NO: 1.
  • Example 3 Northern blot analysis of human DNA mismatch repair protein 8.9 gene expression:
  • RNA extraction in one step [Anal. Biochem 1987, 162, 156-159] 0
  • This method involves acid guanidinium thiocyanate-chloroform extraction. That is, the tissue is homogenized with 4M guanidine isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 time volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1 ) And centrifuge after mixing. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water.
  • a 32P-labeled probe (about 2 x 10 6 cpm / ml) was hybridized with a nitrocellulose membrane to which RNA was transferred at 42 ° C overnight in a solution containing 50% formamide-25mM H 2 P0 4 (pH7.4) -5 xSSC- 5 xDenhardt, s solution, and 200 ⁇ ⁇ / ⁇ 1 salmon sperm DNA. After hybridization, the filter was placed at 1 X SSC-0.1 ° /. 55 in SDS. C for 30 min. Then, Phosphor Imager was used for analysis and quantification.
  • Example 4 In vitro expression, isolation and purification of recombinant human DNA mismatch repair protein 8.9
  • Primer3 5'- CCCCATATGATGATCCATCACATGAAGTCAGGT -3 '(Seq ID No: 5)
  • Primer4 5'- CATGGATCCTCAGGAGGCTGAGGTGGGAGGATT -3' (Seq ID No: 6)
  • These two primers contain Ndel and BamHI restriction sites, respectively. 5 'end of target gene And the 3 'end coding sequence, the Ndel and BamHI restriction sites correspond to the selective endonuclease sites on the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865.3).
  • PCR was performed using the pBS-0872gll plasmid containing the full-length target gene as a template.
  • the PCR reaction conditions were as follows: a total volume of 50 ⁇ 1 containing 10 pg of pBS-0872gll plasmid, Primer-3 and Primer-4, and “J” was 10 mol, Advantage polymerase Mix (Clontech) 1 ⁇ 1. Cycle parameters: 94. C 20s, 60 ° C 30s, 68. C 2 min, a total of 25 cycles. Ndel and BamHI were used to double digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase. The ligated product was transformed into E. coli DH5cc using the calcium chloride method.
  • the host bacteria BL21 (pET-0872gll) was cultured at 37 ° C to the logarithmic growth phase, and IPTG was added to a final concentration of 1 mmol / L, and continued Incubate for 5 hours.
  • the bacteria were collected by centrifugation, and the supernatant was collected by centrifugation.
  • the supernatant was collected by centrifugation.
  • the purified human DNA mismatch repair protein 8.9 was obtained.
  • NH2-Met-Ile-His-His-Met-Lers-Ser-Gly-Val-Glu-Phe-Ser-Thr-Ser-Asn-C00H (SEQ ID NO: 7).
  • the polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex, respectively.
  • hemocyanin and bovine serum albumin For methods, see: Avrameas, et al. Immunochemistry, 1969; 6: 43. Rabbits were immunized with 4 mg of the hemocyanin polypeptide complex plus complete Freund's adjuvant, and 15 days later, the hemocyanin polypeptide complex plus incomplete Freund's adjuvant was used to boost immunity once.
  • a titer plate coated with a 15 M g / ml bovine serum albumin peptide complex was used as an ELISA to determine the antibody titer in rabbit serum.
  • Total IgG was isolated from antibody-positive rabbit serum using protein A-Sepharose.
  • the peptide was bound to a cyanogen bromide-activated Sepharose4B column, and anti-peptide antibodies were separated from the total IgG by affinity chromatography.
  • the immunoprecipitation method proved that the purified antibody could specifically bind to human DNA mismatch repair protein 8.9.
  • Example 6 Application of the polynucleotide fragment of the present invention as a hybridization probe Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
  • the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected. Further, the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
  • the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method.
  • Filter hybridization methods include dot blotting, Southern imprinting, Nor thern blotting, and copying methods. They all use the same steps to fix the polynucleotide sample to be tested on the filter and then hybridize.
  • the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer to saturate the non-specific binding site of the sample on the filter with the carrier and the synthesized polymer.
  • the pre-hybridization solution is then replaced with a hybridization buffer containing labeled probes and incubated to hybridize the probes to the target nucleic acid.
  • the unhybridized probes are removed by a series of membrane washing steps.
  • This embodiment uses higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals.
  • the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
  • the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
  • the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
  • oligonucleotide fragments for use as hybridization probes from the polynucleotide SEQ ID NO: 1 of the present invention should follow the following principles and several aspects to be considered:
  • the preferred range of probe size is 18-50 nucleotides
  • Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements The regions are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, the primary probe should not be used;
  • Probe 1 (probel), which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt) ' ⁇
  • Probe 2 (probe2), which belongs to the second type of probe, is equivalent to the replacement mutant sequence (41Nt) of the gene fragment of SEQ ID NO: 1 or its complementary fragment:
  • PBS phosphate buffered saline
  • DNA purification and ethanol precipitation Steps 1) Add 1/10 volume of 2mol / L sodium acetate and 2 volumes of cold 100% ethanol to the DNA solution and mix. Leave at -20 ° C for 1 hour or overnight. 2) Centrifuge for 10 minutes. 3) Carefully aspirate or pour out the ethanol. 4) Wash the pellet with 500ul of 70% cold ethanol and centrifuge for 5 minutes. 5) Carefully aspirate or pour out the ethanol. Wash the pellet with 500ul of cold ethanol and centrifuge for 5 minutes. 6) Carefully aspirate or pour out the ethanol, then invert on the absorbent paper to drain off the residual ethanol. Air dry for 10-15 minutes to allow the surface ethanol to evaporate.
  • step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
  • NC membranes nitrocellulose membranes
  • Two NC membranes are required for each probe for subsequent experiments.
  • the film is washed with high-strength conditions and strength conditions, respectively.
  • pre-hybridization solution 10xDenhardt's; 6xSSC, 0.1 mg / ml CT DNA (calf thymus DNA).
  • probe 1 can be used to qualitatively and quantitatively analyze the presence and differential expression of the polynucleotide of the present invention in different tissues.
  • Example 7 DNA icroarray Gene chip or DNA microarray is a new technology that many national laboratories and large pharmaceutical companies are currently developing and developing.
  • the polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research of new gene functions; search for and screen new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases .
  • the specific method steps have been reported in the literature. For example, see the literature DeRisi, JL, Lyer, V. & Brown, P.0. (1997) Science 278, 680-686. And the literature He lie, RA, Schema, M Chai, A., Shalom, D., (1997) PNAS 94: 2150-2155.
  • a total of 4,000 polynucleotide sequences of various full-length cDNAs are used as target DNA, including the polynucleotide of the present invention. They were respectively amplified by PCR. After purification, the concentration of the amplified product was adjusted to about 500 ng / ul, and spotted on a glass medium using a Cartesian 7500 spotter (purchased from Cartesian, USA). The distance is 280 ⁇ . The spotted slides were hydrated, dried, and cross-linked in a purple diplomatic coupling instrument. After elution, the DNA was fixed on a glass slide to prepare a chip. The specific method steps have been reported in the literature in various ways. The post-spot processing steps of this embodiment are:
  • Total mRNA was extracted from human mixed tissues and specific tissues (or stimulated cell lines) in one step, and mRNA was purified using Oligotex raRNA Midi Kit (purchased from QiaGen).
  • the fluorescent reagent Cy3dUTP 5— Amino— propargy 2′— deoxyuridine 5′— triphate coupled to Cy3 fluorescent dye (purchased from Amersham Phamacia Biotech) was used to label the mRNA of human mixed tissue, and the fluorescent reagent Cy5dUTP (5- Amino-propargy 2 2-deoxyuridine 5 '-tr iphate coupled to Cy5 fluorescent dye, purchased from Amersham Phamacia Biotech The company) labeled the body's specific tissue (or stimulated cell line) mRNA, and purified the probe to prepare the probe.
  • Cy3dUTP 5— Amino— propargy 2′— deoxyuridine 5′— triphate coupled to Cy3 fluorescent dye (purchased from Amersham Phamacia Biotech
  • Probes from the above two types of tissues were hybridized with the chip in a UniHyb TM Hybridization Solution (purchased from TeleChem) hybridization solution for 16 hours, washed with a washing solution (lx SSC, 0.2% SDS) at room temperature and scanned with ScanArray 3000
  • the instrument purchased from General Scanning Company, USA was used for scanning.
  • the scanned images were analyzed and processed with Imagene software (Biodiscovery Company, USA) to calculate the Cy3 / Cy5 ratio of each point.
  • the above specific tissues are thymus, testis, muscle, spleen, lung, skin, thyroid, liver, PMA + Ecv304 cell line, PMA-Ecv304 cell line, non-starved L02 cell line, L02 cell line stimulated by arsenic for 1 hour, L02 cell line stimulated by arsenic for 6 hours prostate, heart, lung cancer, fetal bladder, fetal small intestine, fetal large intestine, fetal thymus, fetal muscle, fetal liver, fetal kidney, fetal spleen, fetal brain, Fetal lung and fetal heart.
  • polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat malignant tumors, adrenal deficiency, skin diseases, various inflammations, HIV infections and immune diseases.
  • DNA mismatch repair protein is an important component protein in the mismatch repair system.
  • DNA mismatch repair protein exists in many organisms.
  • human MLH1 (MutL horaologue-l) protein is a DNA mismatch repair protein. All DNA mismatch repair proteins contain a conserved sequence fragment, and mutations in this sequence fragment can cause loss of protein function. Therefore, abnormal expression of a polypeptide containing a specific sequence of the DM mismatch repair protein will affect the correct transcription of DM, and further cause certain diseases such as tumors, growth disorders, inflammation, and the like.
  • the abnormal expression of the human DNA mismatch repair protein 8.9 of the present invention will produce various diseases, especially tumors, embryonic developmental disorders, growth disorders, and inflammation. These diseases include but are not Limited to:
  • Tumors of various tissues gastric cancer, liver cancer, lung cancer, esophageal cancer, breast cancer, leukemia, lymphoma, thyroid tumor, uterine fibroids, neuroblastoma, astrocytoma, ependymoma, glioblastoma, Colon cancer, malignant histiocytosis, melanoma, teratoma, sarcoma, adrenal cancer, bladder cancer, bone cancer, osteosarcoma, myeloma, bone marrow cancer, brain cancer, uterine cancer, endometrial cancer, gallbladder cancer, colon Cancer, thymic tumor, nasal cavity and sinus tumor, nasopharyngeal cancer, laryngeal cancer, tracheal tumor, pleural mesothelioma, fibroid, fibrosarcoma, lipoma, liposarcoma, leiomyoma
  • Embryonic disorders congenital abortion, cleft palate, limb absentness, limb differentiation disorder, hyaline membrane disease, atelectasis, polycystic kidney disease, double ureter, crypto, congenital inguinal hernia, double uterus, vaginal atresia, hypospadias , Bisexual deformity, Atrial septal defect, Ventricular septal defect, Pulmonary stenosis, Arterial duct occlusion, Neural tube defect, Congenital hydrocephalus, Iris defect, Congenital cataract, Congenital glaucoma or cataract, Congenital deafness
  • Growth and development disorders mental retardation, cerebral palsy, brain development disorders, mental retardation, familial cerebral nucleus dysplasia syndrome, strabismus, skin, fat and muscular dysplasia such as congenital skin laxity, premature aging Disease, congenital keratosis, various metabolic defects such as various amino acid metabolic defects, stunting, dwarfism, sexual retardation
  • the abnormal expression of the human DNA mismatch repair protein 8.9 of the present invention will also produce certain hereditary, hematological and immune system diseases.
  • the invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) human DNA mismatch repair proteins 8.9.
  • Agonists enhance human DNA mismatch repair proteins 8.9 to stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to cell proliferation, such as various cancers.
  • a mammalian cell or a membrane preparation expressing human DNA mismatch repair protein 8.9 can be cultured with a labeled human DNA mismatch repair protein 8.9 in the presence of a drug. The ability of the drug to increase or block this interaction is then determined.
  • Antagonists of human DNA mismatch repair protein 8.9 include screened antibodies, compounds, receptor deletions, and the like. Antagonists of human DNA mismatch repair protein 8.9 can bind to human DNA mismatch repair protein 8.9 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide This makes the polypeptide unable to perform biological functions.
  • human DNA mismatch repair protein 8.9 When screening compounds as antagonists, human DNA mismatch repair protein 8.9 can be added to the bioanalytical assay to determine whether the compound is an Antagonist. Receptor deletions and analogs that act as antagonists can be screened in the same way as for screening compounds described above. Peptide molecules capable of binding to human DNA mismatch repair protein 8.9 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. When screening, the human DNA mismatch repair protein 8.9 molecule should generally be labeled.
  • the present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies.
  • the invention also provides antibodies against the human DNA mismatch repair protein 8.9 epitope. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments generated from Fab expression libraries.
  • Polyclonal antibodies can be produced by injecting human DNA mismatch repair protein 8.9 directly into immunized animals (such as rabbits, mice, rats, etc.).
  • immunized animals such as rabbits, mice, rats, etc.
  • a variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's Agent.
  • Techniques for preparing monoclonal antibodies to human DNA mismatch repair protein 8.9 include, but are not limited to, hybridoma technology (Kohler and Milstein. Nature, 1975, 256: 495-497), triple tumor technology, human beta-cell hybridoma technology, EBV -Hybridoma technology, etc.
  • Chimeric antibodies combining human constant regions and non-human variable regions can be produced using existing techniques (Morrison et al, PNAS, 1985, 81: 6851). 0
  • Existing techniques for producing single-chain antibodies US Pat No. .4946778) can also be used to produce single chain antibodies against human DNA mismatch repair protein 8.9.
  • Antibodies against human DNA mismatch repair protein 8.9 can be used in immunohistochemistry to detect human DNA mismatch repair protein 8.9 in biopsy specimens.
  • Monoclonal antibodies that bind to human DNA mismatch repair protein 8.9 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
  • Antibodies can also be used to design immunotoxins that target a particular part of the body.
  • High affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
  • a common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the disulfide exchange. This hybrid antibody can be used to kill human DNA mismatch repair protein cell.
  • the antibodies in the present invention can be used to treat or prevent diseases related to human DNA mismatch repair protein 8.9.
  • Administration of an appropriate dose of antibody can stimulate or block the production or activity of human DNA mismatch repair protein 8.9.
  • the present invention also relates to a diagnostic test method for quantitative and localized detection of human DNA mismatch repair protein 8.9 levels. These tests are well known in the art and include FI SH assays and radioimmunoassays.
  • the level of human DNA mismatch repair protein 8.9 detected in the test can be used to explain the importance of human DNA mismatch repair protein 8.9 in various diseases and to diagnose human DM mismatch repair protein 8.9 A working disease.
  • polypeptide of the present invention can also be used for peptide mapping analysis.
  • the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
  • Polynucleotides encoding human DNA mismatch repair protein 8.9 can also be used for a variety of therapeutic purposes. Gene therapy technology can be used to treat abnormal cell proliferation, development or metabolism caused by the non-expression or abnormal / inactive expression of human DNA mismatch repair protein 8.9. Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated human DNA mismatch repair protein 8.9 to inhibit endogenous human DNA mismatch repair protein 8.9 activity.
  • a mutated human DNA mismatch repair protein 8.9 can be a shortened human DNA mismatch repair protein 8.9 that lacks a signaling domain, although it can bind to downstream substrates, but lacks signal transduction. active.
  • the recombinant gene therapy vector can be used to treat diseases caused by abnormal expression or activity of human DNA mismatch repair protein 8.9.
  • Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to transfer polynucleotides encoding human DNA mismatch repair protein 8.9 into cells.
  • a method for constructing a recombinant viral vector carrying a polynucleotide encoding a human DNA mismatch repair protein 8.9 can be found in existing literature (Sambrook, et al.).
  • a recombinant polynucleotide encoding human DNA mismatch repair protein 8.9 can be packaged into liposomes and transferred into cells.
  • Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
  • a vector such as a virus, phage, or plasmid
  • Oligonucleotides including antisense RNA and DNA
  • ribozymes that inhibit human DNA mismatch repair protein 8.9 mRNA are also within the scope of the present invention.
  • a ribozyme is an enzyme-like RM molecule that can specifically decompose specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation.
  • Antisense RNA, DNA, and ribozymes can be obtained by any existing RNA or DNA synthesis technology, such as the technology for the synthesis of oligonucleotides by solid-phase phosphoramidite chemical synthesis has been widely used.
  • Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the R'NA. This DNA sequence has been integrated downstream of the vector's RNA polymerase promoter. In order to increase the stability of the nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the linkage between ribonucleosides should use phosphorothioate or peptide bonds instead of Phosphodiester bond.
  • the polynucleotide encoding human DNA mismatch repair protein 8.9 can be used for the diagnosis of diseases related to human DNA mismatch repair protein 8.9.
  • the polynucleotide encoding human DNA mismatch repair protein 8.9 can be used to detect the expression of human DNA mismatch repair protein 8.9 or the abnormal expression of human DNA mismatch repair protein 8.9 in a disease state.
  • the DNA sequence encoding human DNA mismatch repair protein 8.9 can be used to hybridize biopsy specimens to determine the expression of human DNA mismatch repair protein 8.9.
  • Hybridization techniques include Sou thern blotting, Nor thern blotting, and in situ hybridization. These techniques and methods are publicly available and mature, and the relevant kits are commercially available.
  • polynucleotides of the present invention can be used as probes to be fixed on a micro array (Mi croar ray) or a DNA chip (also known as a "gene chip") for analyzing differential expression analysis of genes and genetic diagnosis in tissues .
  • Human DNA mismatch repair protein 8. 9 specific primers for RNA-polymerase chain reaction (RT-PCR) amplification in vitro can also detect human DNA mismatch repair protein 8.9 transcription products.
  • Human DNA mismatch repair protein 8.9 gene mutations can also be used to diagnose human DNA mismatch repair protein 8.9 related diseases.
  • Human DNA mismatch repair protein 8.9 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to normal wild-type human DNA mismatch repair protein 8.9 DNA sequences. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect the expression of proteins. Therefore, Nor thern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
  • the sequences of the invention are also valuable for chromosome identification.
  • the sequence specifically targets a specific position on a human chromosome and can hybridize to it.
  • specific sites for each gene on the chromosome need to be identified.
  • only a few chromosome markers based on actual sequence data are available for marking chromosome positions.
  • an important first step is to locate these DNA sequences on a chromosome.
  • a PCR primer (preferably 15-35bp) is prepared from the cDNA, and the sequence can be located on the chromosome. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
  • PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
  • oligonucleotide primers of the present invention by a similar method, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
  • Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and hybrid pre-selection to construct chromosome-specific cDNA libraries.
  • Fluorescent in situ hybridization (FISH) of cDNA clones to metaphase chromosomes allows precise chromosomal localization in one step.
  • FISH fluorescent in situ hybridization
  • the physical location of the sequence on the chromosome can be correlated with the genetic map data. These data can be found in, for example, V. Mckusick, Mendel ian Inheritance in Man (available online with Johns Hopkins University Welch Medical Library). Linkage analysis can then be used to determine the relationship between genes and diseases that have been mapped to chromosomal regions.
  • the difference in cDNA or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).
  • the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
  • suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
  • the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
  • the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell.
  • the polypeptides of the invention can be used in combination with other therapeutic compounds.
  • the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
  • Human DM mismatch repair protein 8.9 is administered in an amount effective to treat and / or prevent a specific indication.
  • the amount and range of human DNA mismatch repair protein 8.9 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Pharmacology & Pharmacy (AREA)
  • General Chemical & Material Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Zoology (AREA)
  • Biophysics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Toxicology (AREA)
  • Immunology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biochemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

L'invention concerne un nouveau polypeptide, une protéine humaine de réparation 8.9 du mésappariement de l'ADN, et un polynucléotide codant pour ce polypeptide ainsi qu'un procédé d'obtention de ce polypeptide par des techniques recombinantes d'ADN. L'invention concerne en outre les applications de ce polypeptide dans le traitement de maladies, notamment des tumeurs malignes, de l'hémopathie, de l'infection par VIH, de maladies immunitaires et de diverses inflammations. L'invention concerne aussi l'antagoniste agissant contre le polypeptide et son action thérapeutique ainsi que les applications de ce polynucléotide codant pour la protéine humaine de réparation 8.9 du mésappariement de l'ADN.
PCT/CN2001/000380 2000-03-22 2001-03-21 Nouveau polypeptide, proteine humaine de reparation 8.9 du mesappariement de l'adn, et polynucleotide codant pour ce polypeptide WO2001079428A2 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU56056/01A AU5605601A (en) 2000-03-22 2001-03-21 A novel polypeptide, a human dna mismatch repair gene protein 8.9 and the polynucleotide encoding the polypeptide

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN00115037.5 2000-03-22
CN00115037A CN1314392A (zh) 2000-03-22 2000-03-22 一种新的多肽——人dna错配修复蛋白8.9和编码这种多肽的多核苷酸

Publications (2)

Publication Number Publication Date
WO2001079428A2 true WO2001079428A2 (fr) 2001-10-25
WO2001079428A3 WO2001079428A3 (fr) 2002-03-14

Family

ID=4584508

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2001/000380 WO2001079428A2 (fr) 2000-03-22 2001-03-21 Nouveau polypeptide, proteine humaine de reparation 8.9 du mesappariement de l'adn, et polynucleotide codant pour ce polypeptide

Country Status (3)

Country Link
CN (1) CN1314392A (fr)
AU (1) AU5605601A (fr)
WO (1) WO2001079428A2 (fr)

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
BRONNER C.E. ET AL.: 'Mutation in the DNA mismatch repair gene homologue hMLH1 is associated with hereditary non-polyposis colon cancer' NATURE vol. 368, no. 6468, 1994, pages 258 - 261 *
DATABASE GENBANK [Online] 25 November 1999 'Homo sapiens chromosome 11 clone 442e11 from RPCI11 library map11q23, complete sequence' Database accession no. AC007707 *
LIPKIN S.M. ET AL.: 'MLH3: a DNA mismatch repair gene associated with mammalian microsatellite instability' NAT. GENET. vol. 24, no. 1, 2000, pages 27 - 35 *

Also Published As

Publication number Publication date
AU5605601A (en) 2001-10-30
WO2001079428A3 (fr) 2002-03-14
CN1314392A (zh) 2001-09-26

Similar Documents

Publication Publication Date Title
WO2001083538A1 (fr) Nouveau polypeptide, proteine humaine 36 du gene k-ras, et polynucleotide codant pour ce polypeptide
WO2001068688A1 (fr) Nouveau polypeptide, proteine kinase humaine tak1-27, et polynucleotide codant pour ce polypeptide
WO2001079428A2 (fr) Nouveau polypeptide, proteine humaine de reparation 8.9 du mesappariement de l'adn, et polynucleotide codant pour ce polypeptide
WO2001070956A1 (fr) Nouveau polypeptide, proteine humaine de reparation 8 du mesappariement de l'adn, et polynucleotide codant pour ce polypeptide
WO2001070965A1 (fr) Nouveau polypeptide, facteur humain de regulation de la transcription 15, et polynucleotide codant pour ce polypeptide
WO2001074876A1 (fr) Nouveau polypeptide, phosphatidylinositol-3 kinase humaine 14, et polynucleotide codant pour ce polypeptide
WO2001046437A1 (fr) Nouveau polypeptide, region de liaison d'arn-eucaryote rnp-1-21, et polynucleotide codant pour ce polypeptide
WO2001075048A2 (fr) Nouveau polypeptide, proteine ribosomale humaine s11 23, et polynucleotide codant pour ce polypeptide
WO2001081594A1 (fr) Nouveau polypeptide, proteine pax humaine 17, et polynucleotide codant pour ce polypeptide
WO2001072801A1 (fr) Nouveau polypeptide, proteine ribosomale humaine s11 12, et polynucleotide codant pour ce polypeptide
WO2001075100A1 (fr) Nouveau polypeptide, proteine humaine de reparation 10 du mesappariement de l'adn, et polynucleotide codant pour ce polypeptide
WO2001070958A1 (fr) Nouveau polypeptide, proteine humaine de reparation 15 du mesappariement de l'adn, et polynucleotide codant pour ce polypeptide
WO2001079437A2 (fr) Nouveau polypeptide, facteur humain de transcription de la differentiation cellulaire 14, et polynucleotide codant pour ce polypeptide
WO2001070957A1 (fr) Nouveau polypeptide, proteine humaine de reparation 9.4 du mesappariement de l'adn, et polynucleotide codant pour ce polypeptide
WO2001073061A1 (fr) Nouveau polypeptide, proteine humaine 22 du retinoblastome, et polynucleotide codant pour ce polypeptide
WO2001055419A1 (fr) Nouveau polypeptide, site de liaison 27 d'arn s1, et polynucleotide codant pour ce polypeptide
WO2001074998A2 (fr) Nouveau polypeptide, proteine humaine de regulation 10 de la serine proteinase, et polynucleotide codant pour ce polypeptide
WO2001074873A1 (fr) Nouveau polypeptide, proteine humaine de reparation 9 du mesappariement de l'adn, et polynucleotide codant pour ce polypeptide
WO2001075015A2 (fr) Nouveau polypeptide, fat24, et polynucleotide codant pour ce polypeptide
WO2001071000A1 (fr) Nouveau polypeptide, znt-1-22, et polynucleotide codant pour ce polypeptide
WO2001047975A1 (fr) Nouveau polypeptide, proteine 10 contenant un domaine chromo, et polynucleotide codant pour ce polypeptide
WO2001081399A1 (fr) Nouveau polypeptide, proteine pax humaine 14, et polynucleotide codant pour ce polypeptide
WO2001075126A1 (fr) Nouveau polypeptide, proteine ribosomale humaine s18-9, et polynucleotide codant pour ce polypeptide
WO2001072809A1 (fr) Nouveau polypeptide, facteur humain de transcription de la differentiation cellulaire 9, et polynucleotide codant pour ce polypeptide
WO2001075018A2 (fr) Nouveau polypeptide, facteur humain de regulation de la transcription 31, et polynucleotide codant pour ce polypeptide

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
AK Designated states

Kind code of ref document: A3

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A3

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase in:

Ref country code: JP