WO2001070957A1 - Nouveau polypeptide, proteine humaine de reparation 9.4 du mesappariement de l'adn, et polynucleotide codant pour ce polypeptide - Google Patents

Nouveau polypeptide, proteine humaine de reparation 9.4 du mesappariement de l'adn, et polynucleotide codant pour ce polypeptide Download PDF

Info

Publication number
WO2001070957A1
WO2001070957A1 PCT/CN2001/000355 CN0100355W WO0170957A1 WO 2001070957 A1 WO2001070957 A1 WO 2001070957A1 CN 0100355 W CN0100355 W CN 0100355W WO 0170957 A1 WO0170957 A1 WO 0170957A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
polynucleotide
mismatch repair
repair protein
human
Prior art date
Application number
PCT/CN2001/000355
Other languages
English (en)
Chinese (zh)
Inventor
Yumin Mao
Yi Xie
Original Assignee
Biowindow Gene Development Inc. Shanghai
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Biowindow Gene Development Inc. Shanghai filed Critical Biowindow Gene Development Inc. Shanghai
Priority to AU48237/01A priority Critical patent/AU4823701A/en
Publication of WO2001070957A1 publication Critical patent/WO2001070957A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • the present invention belongs to the field of biotechnology. Specifically, the present invention describes a novel polypeptide-human DNA mismatch repair protein 9.4, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and polypeptide. ' Background technique
  • DNA polymerase can occasionally catalyze the incorporation of the wrong base that cannot form a hydrogen bond with the template.
  • This replication error is usually corrected immediately by the DNA polymerase's 3 '-5' proofreading function before the next nucleotide polymerization reaction begins.
  • DNA polymerases leave very few wrong bases on the DNA strand without correction. It is estimated that the frequency of this error is 10 ⁇ .
  • the mutation frequency that people actually measure is ⁇ or ⁇ )-". Since the integrity and accuracy of DM is the root of life, another repair has evolved in the cell The system, called the mismatch repair system, gives a second chance to correct the error. (Modrich P. Annu. Rev. Biochem.
  • Adenine methylation is a sign of mismatch repair According to the characteristics brought about by methylation, the mismatch repair system can identify the template strand and the nascent strand, thereby correcting the unpaired bases on the nascent, ensuring high accuracy and integrity.
  • DNA mismatch repair protein is an important constituent protein in the mismatch repair system.
  • DNA mismatch repair protein exists in many organisms, for example, the mutL protein of E. coli; the hexB protein of streptococcus; Human MLH1 (MutL homologue-1) protein and so on.
  • HNPCC heritable non-polyposis colorectal cancer
  • DM mismatch repair protein plays an important role in repairing the incorporation of erroneous bases that may occur in DM replication during the cell cycle, thereby ensuring the genetic loyalty of the cell mitosis process.
  • the human DM mismatch repair protein 9.4 protein plays an important role in regulating important functions of the body such as cell division and embryo development, and it is believed that a large number of proteins are involved in these regulatory processes, so more needs to be identified in the art
  • the human DM mismatch repair protein 9.4 protein involved in these processes, especially the amino acid sequence of this protein is identified.
  • Newcomer DNA mismatch repair protein 9.4 The isolation of protein-coding genes also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so it is important to isolate its coding DM. Disclosure of invention
  • Another object of the invention is to provide a polynucleotide encoding the polypeptide.
  • Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding a human DNA mismatch repair protein 9.4.
  • Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding a human DM mismatch repair protein 9.4.
  • Another object of the present invention is to provide a method for producing human DNA mismatch repair protein 9.4.
  • Another object of the present invention is to provide an antibody against the polypeptide-to-human DNA mismatch repair protein 9.4 of the present invention.
  • the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
  • the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
  • sequence of the polynucleotide is one selected from the group consisting of: (a) having SEQ ID NO: 1
  • the present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
  • the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
  • the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of human DNA mismatch repair protein 9.4 protein, which comprises utilizing the polypeptide of the invention.
  • the invention also relates to compounds obtained by this method.
  • the invention also relates to a method for in vitro detection of a disease or susceptibility to disease associated with abnormal expression of a human DM mismatch repair protein 9.4 protein, comprising detecting a mutation in the polypeptide or a sequence encoding a polynucleotide thereof in a biological sample, Alternatively, the amount or biological activity of a polypeptide of the invention in a biological sample is detected.
  • the invention also relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
  • the present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention in the preparation of a medicament for treating cancer, developmental disease or immune disease or other diseases caused by abnormal expression of human DM mismatch repair protein 9.4.
  • Nucleic acid sequence refers to oligonucleotides, nucleotides or polynucleotides and fragments or parts thereof, and can also refer to genomic or synthetic DNA or RNA, which can be single-stranded or double-stranded, representing the sense strand or Antisense strand.
  • amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
  • a “variant" of a protein or polynucleotide refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it.
  • the changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence.
  • Variants can have "conservative" changes, in which the amino acid substituted has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine.
  • Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
  • “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
  • Insertion refers to an alteration in the amino acid sequence or nucleotide sequence that results in an increase in one or more amino acids or nucleotides compared to a naturally occurring molecule.
  • Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
  • Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
  • immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response in appropriate animals or cells and to bind to specific antibodies.
  • An "agonist” refers to a molecule that, when combined with human DM mismatch repair protein 9.4, can cause the protein to change and thereby regulate the activity of the protein.
  • An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that binds human DM mismatch repair protein 9.4.
  • Antagonist refers to a molecule that can block or regulate the biological or immunological activity of human DNA mismatch repair protein 9.4 when combined with human DNA mismatch repair protein 9.4 .
  • Antagonists and inhibitors can include proteins, nucleic acids, carbohydrates or any other molecule that can bind to human DM mismatch repair protein 9.4.
  • Regular refers to a change in the function of human DNA mismatch repair protein 9.4, including an increase or decrease in protein activity, a change in binding characteristics, and any other biological properties and functions of human DM mismatch repair protein 9.4 Or changes in immune properties.
  • substantially pure is meant substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated.
  • Those skilled in the art can use standard protein purification techniques to purify human DNA mismatch repair proteins 9.4. Basically pure human DNA mismatch repair protein 9.4 produces a single main band on a non-reducing polyacrylamide gel. The purity of human DM mismatch repair protein 9.4 can be analyzed by amino acid sequence.
  • Complementary refers to base pairing by allowing base salt concentration and temperature Polynucleotides bind naturally.
  • sequence can be combined with the complementary sequence "G-A-CT”.
  • the complementarity between two single-stranded molecules may be partial or complete.
  • the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
  • “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
  • Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Southern imprinting or Northern blotting, etc.) under conditions of reduced stringency. Substantially homologous sequences or hybridization probes can compete and inhibit the binding of fully homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that conditions with reduced stringency allow non-specific binding, because conditions with reduced stringency require that the two sequences bind to each other as either specific or selective interactions.
  • Percent identity refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALIGN program (Lasergene sof tware package, DNASTAR, Inc., Madi son Wis.). The MEGALIGN program can compare two or more sequences according to different methods such as the Clus ter method (Hi ggins, DG and PM Sharp (1988) Gene 73: 237-244). 0 The Cl us ter method will check the distance between all pairs by Groups of sequences are arranged in clusters. The clusters are then assigned in pairs or groups.
  • the percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula: The number of matching residues between sequence A and sequence X 100 The number of residues in sequence A-the number of spacer residues in sequence A The number of spacer residues in a sequence B can also be determined by Clus ter method or using methods known in the art such as Jotun Hein.
  • the percent identity between nucleic acid sequences He in J., (1990) Methods in emzuraology 183: 625-645 ) 0 "Similarity" refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
  • Amino acids used for conservative substitutions may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
  • Antisense refers to a nucleotide sequence that is complementary to a particular DM or RM sequence.
  • Antisense strand refers to a nucleic acid strand that is complementary to a “sense strand.”
  • Derivative refers to a chemical modification of HFP or a nucleic acid encoding it. This chemical modification can be Replace a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
  • Antibody refers to a complete antibody molecule and its fragments, such as Fa,? ( ⁇ ') 2 and? , It can specifically bind to the epitope of human DNA mismatch repair protein 9.4.
  • a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
  • isolated refers to the removal of a substance from its original environment (for example, its natural environment if it is naturally occurring).
  • a naturally-occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
  • Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not part of its natural environment, they are still isolated.
  • isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
  • polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances in the natural state .
  • isolated human DNA mismatch repair protein 9. 4" refers to human DM mismatch repair protein 9.4, which is essentially free of other proteins, lipids, sugars, or other substances that are naturally associated with it. Those skilled in the art can use standard protein purification techniques to purify human DNA mismatch repair proteins 9.4. Substantially pure peptides can produce a single main band on a non-reducing polyacrylamide gel. Human DNA mismatch repair protein 9.4 The purity of the peptide can be analyzed by amino acid sequence.
  • the present invention provides a novel polypeptide-human DNA mismatch repair protein 9. 4 which is basically composed of the amino acid sequence shown in SEQ ID NO: 2.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
  • the polypeptides of the invention may be naturally purified products, or chemically synthesized products, or produced using recombinant techniques from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells). Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
  • the invention also includes fragments, derivatives and analogs of human DNA mismatch repair protein 9.4.
  • fragment refers to a polypeptide that substantially maintains the same biological function or activity of the human DNA mismatch repair protein 9.4 of the present invention.
  • a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution Amino acids can Therefore, it may or may not be encoded by the genetic code; or ( ⁇ ) such a type in which a group on one or more amino acid residues is substituted by another group to include a substituent; or (III) such a type Where the mature polypeptide is fused to another compound (such as a compound that extends the half-life of the polypeptide, such as polyethylene glycol); or (IV) such a polypeptide sequence in which the additional amino acid sequence is fused into the mature polypeptide (such as the leader Sequences or secreted sequences or sequences used to purify this polypeptide or protease sequences) As set forth herein, such fragments, derivatives and analogs are considered to be within the knowledge of those skilled in the art.
  • the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
  • the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a full-length polynucleotide sequence of 1446 bases and its open reading frame of 325-582 encodes 85 amino acids. According to the comparison of gene chip expression profiles, it was found that this peptide has a similar expression profile with human DM mismatch repair protein 11 and it can be inferred that the human DNA mismatch repair protein 9. 4 has similar functions to human DM mismatch repair protein 11.
  • the polynucleotide of the present invention may be in the form of DNA or RNA.
  • DNA forms include cDNA, genomic DNA, or synthetic DNA.
  • DM can be single-stranded or double-stranded.
  • DNA can be coding or non-coding.
  • the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
  • a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but having a sequence different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
  • the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
  • polynucleotide encoding a polypeptide refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.
  • the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
  • Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
  • an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
  • the present invention also relates to a polynucleotide that hybridizes to a sequence described above 50% less, preferably 70% identity).
  • the invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the invention under stringent conditions.
  • "strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60 ° C; or (2) Add denaturants during hybridization, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% Fi co ll, 42 ° C, etc .; or (3) only between two sequences Hybridization occurs only when the identity is at least 95%, and more preferably 97%.
  • the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
  • nucleic acid fragments that hybridize to the sequences described above.
  • a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, most preferably at least 100 nucleotides. Nucleotides or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques (such as PCR) to identify and / or isolate polynucleotides encoding human DNA mismatch repair protein 9.4.
  • polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
  • the specific polynucleotide sequence encoding the human DNA mismatch repair protein 9.4 of the present invention can be obtained by various methods.
  • polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cMA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
  • the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) separating a double-stranded DNA sequence from genomic DM; 2) chemically synthesizing a DNA sequence to obtain the double-stranded DM of the polypeptide.
  • genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the separation of cDM sequences.
  • the standard method for isolating the cDM of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library.
  • the construction of cDNA libraries is also a common method (Sambrook, et al., Moleculolar Cloning, A Laboratory Manua, Coll Spring Harbor Labora tory. New York, 1989).
  • Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
  • genes can be screened from these cDNA libraries by conventional methods. These methods include (but are not limited to): (1) DM-DNA or DM-RNA hybridization; (2) the appearance or loss of marker gene function; ( 3 ) measuring the level of human DNA mismatch repair protein 9.4 transcripts (4) Detecting protein products expressed by genes through immunological techniques or measuring biological activity. The above methods can be used singly or in combination.
  • the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleosides ⁇ Acid, preferably at least 100 nucleotides.
  • the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
  • the probe used herein is generally a DNA sequence chemically synthesized based on the gene sequence information of the present invention.
  • the genes or fragments of the present invention can of course be used as probes.
  • DM probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
  • immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) can be used to detect the protein product of human DNA mismatch repair protein 9.4 gene expression.
  • ELISA enzyme-linked immunosorbent assay
  • a method using PCR technology to amplify DNA / RM (Saiki, et al. Science 1985; 230: 1350-1354) is preferably used to obtain the gene of the present invention.
  • the RACE method RACE-cDM terminal rapid amplification method
  • the primers for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein.
  • the amplified DM / RM fragment can be isolated and purified by conventional methods such as by gel electrophoresis.
  • polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, the sequencing must be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDM sequence.
  • the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using human DNA mismatch repair protein 9.4 coding sequence, and the recombinant technology to produce the polypeptide of the present invention. method.
  • a polynucleotide sequence encoding human DNA mismatch repair protein 9.4 can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
  • vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses or other vectors well known in the art.
  • Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al.
  • any plasmid and vector can be used to construct a recombinant expression vector.
  • An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
  • DM sequence can be operably linked to an appropriate promoter in an expression vector to guide the synthesis of raRNA.
  • promoters are: the l ac or trp promoter of E.
  • the expression vector also includes a ribosome binding site and a transcription terminator for translation initiation. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers on the late side of the origin of replication, and adenovirus enhancers.
  • the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • GFP fluorescent protein
  • tetracycline or ampicillin resistance for E. coli.
  • a polynucleotide encoding a human DNA mismatch repair protein 9.4 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to form a genetically engineered host containing the polynucleotide or the recombinant vector.
  • the term "host cell” refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell.
  • Escherichia coli, Streptomyces bacterial cells such as Salmonella typhimurium
  • fungal cells such as yeast
  • callus cells insect cells
  • insect cells such as fly S2 or Sf 9
  • animal cells such as CH0, COS or Bowes melanoma cells, etc. .
  • Transformation of a host cell with a DM sequence according to the present invention or a recombinant vector containing the DNA sequence can be performed by conventional techniques well known to those skilled in the art.
  • the host is a prokaryote such as E. coli
  • competent cells capable of absorbing DM may be in exponential growth phase were harvested after the treatment with (Method 12, using the procedure well known in the art.
  • Alternative is MgC l 2.
  • transformation can also be performed by electroporation.
  • the host is a eukaryotic organism, the following DM transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposomes Packaging, etc.
  • the polynucleotide sequence of the present invention can be used to express or produce recombinant human DNA mismatch repair protein 9. 4 (Sc ience, 1984; 224: 1431). Generally there are the following steps:
  • the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
  • a suitable method such as temperature conversion or chemical induction
  • the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell.
  • recombinant proteins can be separated and purified by various separation methods using their physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC), and various other liquid chromatography techniques and combinations of these methods.
  • conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography
  • FIG. 1 is a comparison diagram of gene chip expression profiles of DM mismatch repair protein 9.4 and human DM mismatch repair protein 11 of the present invention.
  • the upper graph is a graph of the expression profile of human DNA mismatch repair protein 9.4, and the lower graph is the graph of the expression profile of human DNA mismatch repair protein 11.
  • 1 indicates fetal kidney
  • 2 indicates fetal large intestine
  • 3 indicates fetal small intestine
  • 4 indicates fetal muscle
  • 5 indicates fetal brain
  • 6 indicates fetal bladder
  • 7 indicates non-starved L02
  • 8 indicates L02 +, lhr, As 3+
  • 9 indicates ECV304 PMA-
  • 10 means ECV 304 PMA +
  • 11 means fetal liver
  • 12 means normal liver
  • 13 means thyroid
  • 14 means skin
  • 15 means fetal lung
  • 16 means lung
  • 17 means lung cancer
  • 18 means fetal spleen
  • 19 means The spleen
  • 20 is the prostate
  • 21 is the fetal heart
  • 22 is the heart
  • 23 is the muscle
  • 24 is the testis
  • 25 is the fetal thymus
  • 26 is the thymus.
  • Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of the isolated human DNA mismatch repair protein 9.4.
  • 9KDa is the molecular weight of the protein.
  • the arrow indicates the isolated protein band.
  • RNA Human fetal brain total RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform.
  • Poly (A) mRM was isolated from total RM using Quik mRNA Isolat ion Kit (product of Qiegene). 2ug poly (A) mRNA forms cDM by reverse transcription.
  • a Smart cDM cloning kit purchased from Clontech was used to insert the 00 fragment into the multiple cloning site of the pBSK (+) vector (Clontech) to transform DH5 ⁇ .
  • the bacteria formed a cDNA library.
  • the sequences at the 5 'and 3' ends of all clones were determined using a Dye terminate cycle react ion sequencing kit (Perkin-Elmer) and an ABI 377 automatic sequencer (Perkin-Elraer).
  • the determined cDNA sequence was compared with the public DNA sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 0951a02 was new DNA.
  • the inserted cDNA fragments contained in this clone were determined in both directions by synthesizing a series of primers.
  • CDNA was synthesized using fetal brain total RNA as a template and ol igo-dT as a primer for reverse transcription reaction.
  • PCR amplification was performed with the following primers:
  • Primer 1 5'- ACGGCTGCGAGAAGACGAAGCTTA -3 '(SEQ ID NO: 3)
  • Primer2 5'- CTGCATCATGGTTTATAGAGTAAA -3, (SEQ ID NO: 4)
  • Primerl is a forward sequence located at the 5th end of SEQ ID NO: 1, starting at lbp;
  • Pr imer2 is the 3, terminal reverse sequence of SEQ ID NO: 1.
  • Amplification conditions 50 ⁇ l of KC1, 10 mmol / L Tris-CI, (pH 8.5.5), 1.5 mmol / L MgCl 2 , 200 ⁇ raol / L in a reaction volume of 50 ⁇ 1 dNTP, l Opmol primer, 1U Taq DNA polymerase (Clontech).
  • the reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) under the following conditions for 25 cycles: 94 ° C 30sec; 55 ° C 30sec; 72 ° C 2rain 0 ⁇ -act in was set as positive at the time of RT-PCR Controls and template blanks are negative controls.
  • the amplified product was purified using a QIAGEN kit and ligated to a PCR vector using a TA cloning kit (Invitrogen).
  • the DNA sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as that of 1 to 1446bp shown in SEQ ID NO: 1.
  • Example 3 Northern blot analysis of human DM mismatch repair protein 9.4 gene expression: Total RNA extraction in one step [Anal. Biochera 1987, 162, 156-159] 0 This method involves acid guanidinium thiocyanate-chloroform extraction.
  • the tissue is homogenized with 4M guanidinium isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1 ), Mix and centrifuge.
  • the aqueous layer was aspirated, isopropanol (0.8 vol) was added and the mixture was centrifuged to obtain RM precipitate.
  • the resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water.
  • a 32P-labeled probe (about 2 x 10 6 cpm / ml) was hybridized with a nitrocellulose membrane to which RNA was transferred at 42 ° C overnight in a solution containing 50% formamide-25m KH 2 P0 4 ( P H7.4) -5 35 (:-5 1) 6111 ⁇ ( ⁇ , 3 solution and 20 ( ⁇ ⁇ / 1111 salmon sperm 0.) After hybridization, the filter was placed in 1 x SSC-0.1% SDS at 55 Wash for 30 min at ° C. Then, use Phosphor Imager for analysis and quantification.
  • Example 4 In vitro expression, isolation and purification of recombinant human DNA mismatch repair protein 9.4
  • Primer3 5'- CCCCATATGATGATCTTGGCTCACTGCAAGCTC -3, (Seq ID No: 5)
  • Primer4 5'- CATGGATCCTTAGAAATGTATGAATTCAGGCCA -3
  • the 5 'ends of these two primers contain Ndel and BamHI restriction sites, respectively.
  • the coding sequences for the 5 'and 3' ends of the gene of interest are followed, respectively.
  • the Ndel and BamHI restriction sites correspond to the selectivity within the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865.3). Digestion site.
  • PCR was performed using the pBS-0951a02 plasmid containing the full-length target gene as a template.
  • the PCR reaction conditions are as follows: a total volume of 50 ⁇ 1 containing 10 pg of pBS-0951a02 plasmid, primers? ]: 11116]: -3 and 01116: 1: -4 points and another!] Is 1 ( ⁇ [1101, Advantage polymerase Mix (Clontech)) 1 ⁇ 1.
  • Cycle parameters 94 ° C 20s, 60 ° C 30s, 68 ° C for 2 min, a total of 25 cycles.
  • the host strain BL21 (pET- 0951a02) Cultivate to logarithmic growth phase at 37 ° C, add IPTG to the final concentration of lmraol / L, and continue the cultivation for 5 hours. Centrifuge to collect the bacterial cells, sonicate the bacteria, and centrifuge to collect the supernatant. (6His-Tag) Binding Affinity Column His. Bind Quick Cartridge (Product of Novagen) Chromatography was performed to obtain purified human protein DM mismatch repair protein 9.4. After SDS-PAGE electrophoresis, a single band was obtained at 9.4 KDa ( Figure 2).
  • a peptide synthesizer (product of PE company) was used to synthesize the following human DM mismatch repair protein 9.4 specific polypeptide: NH2-Met-I le-Leu-Ala-His-Cys-Lys-Leu-Cys-Gln-Leu -Gly-Ser-Ser-Asp-COOH (SEQ ID NO: 7).
  • the polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex, respectively.
  • Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
  • the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
  • the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
  • the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method.
  • Filter hybridization methods include dot blotting, Southern blotting, Northern blotting, and copying methods. They all use the same steps of hybridization after fixing the polynucleotide sample to be tested on the filter.
  • the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer, so that the non-specific binding site of the sample on the filter is saturated with the carrier and the synthetic polymer.
  • the pre-hybridization solution is then replaced with a hybridization buffer containing the labeled probe and incubated to hybridize the probe to the target nucleic acid.
  • the unhybridized probes are removed by a series of membrane washing steps. This embodiment makes use of higher intensity membrane washing conditions (such as lower salt concentration and higher temperature) to enable hybridization
  • the background is reduced and only strong specific signals are retained.
  • the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
  • the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
  • the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
  • oligonucleotide fragments from the polynucleotide SEQ ID NO: 1 of the present invention for use as hybridization probes should follow the following principles and several aspects to be considered:
  • the preferred range of probe size is 18-50 nucleotides
  • Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements The regions are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, the primary probe should not be used;
  • Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
  • Probe 2 (P robe2), belong to the second probe, corresponding to SEQ ID NO: replacing a gene fragment or a complementary fragment of a mutated sequence (41Nt):
  • step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
  • NC membranes nitrocellulose membranes
  • Two NC membranes are required for each probe, so that they can be used in the following experimental steps.
  • the film was washed with high-strength conditions and strength conditions, respectively.
  • Low-intensity washing film 1) Take out the hybridized sample membrane.
  • Gene chip or gene microarray is a new technology currently being developed by many national laboratories and large pharmaceutical companies.
  • the data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software to achieve the purpose of rapid, efficient, and high-throughput analysis of biological information.
  • the polynucleotide of the present invention can be used as a target DM for gene chip technology for high-throughput research of new gene functions; searching for and screening new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases .
  • the specific method steps have been reported in the literature. , M., Cha i, A., Sha lom, D., (1997) PNAS 94: 2150-2155.
  • a total of 4,000 polynucleotide sequences of various full-length cDNAs are used as target DNA, including the polynucleotide of the present invention. They were respectively amplified by PCR, and the concentration of the amplified product was adjusted to about 500ng / ul after purification.
  • the spots were spotted on a glass medium using a Cartesian 7500 spotter (purchased from Cartesian Company, USA). The distance between them is 280 ⁇ m.
  • the spotted slides were hydrated, dried, and cross-linked in a purple diplomatic instrument. After elution, the DM was fixed on the glass slide to prepare chips.
  • the specific method steps have been reported in the literature in various ways.
  • the post-spot processing steps of this embodiment are:
  • Total fflRM was extracted from human mixed tissues and specific tissues (or stimulated cell lines) in one step, and mRM was purified with Oligotex mRNA Midi Ki t (purchased from QiaGen).
  • Cy3dUTP (5-Amino- propargyl- 2'-deoxyur idine 5> -triphate coupled to C 3 f luorescent dye, purchased from Araersham Phamacia Biotech) was used to label the mRNA of human mixed tissue, and the fluorescent reagent Cy5dUTP (5- Amino-propargyl- 2'-deoxyur idine 5'-triphate coupled to Cy5 fluorescent dye, purchased from Amersham Phamacia Biotech, was used to label mRM, a specific tissue (or stimulated cell line) of the body, and probes were prepared after purification.
  • Cy3dUTP (5-Amino- propargyl- 2'-deoxyur idine 5> -triphate coupled to C 3 f l
  • Solut ion (purchased from TeleChem) was used for hybridization for 16 hours, and then washed with a washing solution (lx SSC, 0.2% SDS) at room temperature, and then scanned with a ScanArray 3000 scanner (purchased from General Scanning, USA). The image was analyzed and processed with Imagene software (Biodiscovery, USA) to calculate the Cy3 / Cy5 ratio of each point.
  • the above specific tissues are thymus, testis, muscle, spleen, lung, skin, thyroid, liver, PMA + Ecv304 cell line, PMA-Ecv304 cell line, non-starved L02 cell line, L02 cell line stimulated by arsenic for 1 hour, L02 cell line stimulated by arsenic for 6 hours prostate, heart, lung cancer, fetal bladder, fetal small intestine, fetal large intestine, fetal thymus, fetal muscle, fetal liver, fetal kidney, fetal spleen, fetal brain, Fetal lung and fetal heart.
  • polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat malignant tumors, adrenal deficiency, skin diseases, various inflammations, HIV infections and immune diseases.
  • DNA mismatch repair protein is an important component protein in the mismatch repair system.
  • DM mismatch repair protein exists in many organisms.
  • human MLH1 (MutL homologue-1) protein is a DNA mismatch repair protein.
  • All DM mismatch repair proteins contain a conserved sequence fragment, and mutations in this sequence fragment can cause loss of protein function. Therefore, abnormal expression of a polypeptide containing a DNA mismatch repair protein-specific sequence will affect the correct transcription of DM, and further cause certain diseases such as tumors, growth disorders and inflammation.
  • the abnormal expression of the human DM mismatch repair protein 9.4 of the present invention will produce various diseases, especially tumors, embryonic developmental disorders, growth disorders, and inflammation. These diseases include, but are not limited to:
  • Tumors of various tissues gastric cancer, liver cancer, lung cancer, esophageal cancer, breast cancer, leukemia, lymphoma, gonadal tumor, uterine fibroids, neuroblastoma, astrocytoma, ependymoma, glioblastoma , Knot, cancer, malignant histiocytosis, melanoma, teratoma, sarcoma, adrenal cancer, bladder cancer, bone cancer, bone! Tumor, myeloma, bone marrow cancer, brain cancer, uterine cancer, endometrial cancer, gallbladder Cancer, colon cancer, thymic tumor.
  • Nasal cavity and sinus tumor Nasal cavity and sinus tumor, nasopharyngeal cancer, laryngeal cancer, tracheal tumor, pleural mesothelioma, fibroid, fibrosarcoma, fatty tumor, liposarcoma, leiomyoma
  • Embryonic disorders congenital abortion, cleft palate, limb absentness, limb differentiation disorder, hyaline membrane disease, atelectasis, polycystic kidney disease, double ureter, crypto, congenital inguinal hernia, double uterus, vaginal atresia, hypospadias , Bisexual deformity, Atrial septal defect, Ventricular septal defect, Pulmonary stenosis, Arterial duct occlusion, Neural tube defect, Congenital hydrocephalus, Iris defect, Congenital cataract, Congenital glaucoma or cataract, Congenital deafness
  • Growth and development disorders mental retardation, cerebral palsy, brain development disorders, mental retardation, familial cerebral nucleus dysplasia syndrome, strabismus, skin, fat and muscular dysplasia such as congenital skin laxity, premature aging Disease, congenital keratosis, various metabolic defects such as various amino acid metabolic defects, stunting, dwarfism, sexual retardation
  • the abnormal expression of the human DM mismatch repair protein 9.4 of the present invention will also produce certain hereditary, hematological and immune system diseases.
  • the invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) human DNA mismatch repair protein 9.4.
  • Agonists enhance human DM mismatch repair protein 9.4 to stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
  • mammalian cells or membrane preparations expressing human DNA mismatch repair protein 9.4 can be cultured with labeled human DM mismatch repair protein 9.4 in the presence of drugs. The ability of the drug to increase or block this interaction is then determined.
  • Antagonists of human DNA mismatch repair protein 9.4 include screened antibodies, compounds, receptor deletions, and the like. Antagonists of human DNA mismatch repair protein 9.4 can bind to human DNA mismatch repair protein 9.4 and eliminate its function, or inhibit the production of the 'polypeptide, or bind to the active site of the polypeptide to make the Peptides cannot perform biological functions.
  • human DNA mismatch repair protein 9.4 can be added to a bioanalytical assay by measuring the effect of the compound on the interaction between human DNA mismatch repair protein 9.4 and its receptors Determine if the compound is an antagonist.
  • Receptor deletions and analogs that act as antagonists can be screened in the same way as for screening compounds described above.
  • Peptide molecules capable of binding to human DM mismatch repair protein 9.4 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. When screening, generally, 9.4 molecules of human DM mismatch repair protein should be labeled.
  • the present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies.
  • the invention also provides antibodies against the human DNA mismatch repair protein 9.4 epitope. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments generated from Fab expression libraries.
  • Polyclonal antibodies can be produced using human DM mismatch repair protein 9.4 directly by immunizing animals (such as rabbits, mice, rats, etc.).
  • immunizing animals such as rabbits, mice, rats, etc.
  • a variety of adjuvants can be used to enhance the immune response, including but not limited to 'S adjuvant and so on.
  • Techniques for preparing monoclonal antibodies for human DNA mismatch repair protein 9.4 include, but are not limited to, hybridoma technology (Kohler and Mistein. Nature, 1975, 256: 495-497), triple tumor technology, human beta- Cell hybridoma technology, EBV-hybridoma technology, etc.
  • Chimeric antibodies that bind human constant regions to non-human variable regions can be produced using existing techniques (Morr is on et al, PNAS, 1985, 81: 6851).
  • Monoclonal antibodies that bind to human DNA mismatch repair protein 9.4 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
  • Antibodies can also be used to design immunotoxins that target a particular part of the body.
  • human DNA mismatch repair protein 9.4 High affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
  • a common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP, and bind the toxin to the antibody through disulfide exchange.
  • This hybrid antibody can be used to kill human DNA mismatch repair protein 9.4 Positive cells.
  • the antibodies of the present invention can be used to treat or prevent diseases related to human DNA mismatch repair protein 9.4. Administration of appropriate doses of antibodies can stimulate or block the production or activity of human DM mismatch repair protein 9.4.
  • the invention also relates to a diagnostic test method for quantitatively and locally detecting the level of human DM mismatch repair protein 9.4.
  • diagnostic tests are well known in the art and include FISH assays and radioimmunoassays.
  • the level of human DNA mismatch repair protein 9.4 detected in the test can be used to explain the importance of human DNA mismatch repair protein 9.4 in various diseases and to diagnose human DNA mismatch repair protein 9.4. A working disease.
  • polypeptide of the present invention can also be used for peptide mapping analysis.
  • the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
  • Polynucleotides encoding human DNA mismatch repair protein 9.4 can also be used for a variety of therapeutic purposes. Gene therapy technology can be used to treat abnormal cell proliferation, development or metabolism caused by the non-expression or abnormal / inactive expression of human DM mismatch repair protein 9.4. Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated human DM mismatch repair protein 9.4 to inhibit endogenous human DNA mismatch repair protein 9.4 activity.
  • a mutated human DNA mismatch repair protein 9.4 may be a shortened human DNA mismatch repair protein 9.4 that lacks a signaling domain, although it can bind to downstream substrates, but lacks signal transduction. active.
  • the recombinant gene therapy vector can be used for treating diseases caused by abnormal expression or activity of human DM mismatch repair protein 9.4.
  • Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to transfer polynucleotides encoding human DNA mismatch repair protein 9.4 into cells.
  • Methods for constructing recombinant viral vectors carrying polynucleotides encoding human DNA mismatch repair protein 9.4 can be found in existing literature (Sarabrook, et al.).
  • a recombinant polynucleotide encoding human DM mismatch repair protein 9.4 can be packaged into liposomes and transferred into cells.
  • Methods for introducing polynucleotides into tissues or cells include: Injecting polynucleotides directly into tissues in vivo Or in vitro through a vector (such as a virus, phage, or plasmid) to introduce the polynucleotide into the cell, and then transplant the cell into the body.
  • a vector such as a virus, phage, or plasmid
  • Oligonucleotides including antisense RNA and DNA
  • ribozymes that inhibit human DNA mismatch repair proteins 9.4 are also within the scope of the present invention.
  • a ribozyme is an enzyme-like RNA molecule that can specifically decompose a specific RM. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation.
  • Antisense RNA, DM, and ribozymes can be obtained by any existing RNA or DNA synthesis technology, such as solid-phase phosphoramidite chemical synthesis to synthesize oligonucleotides.
  • Antisense MA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA.
  • This DM sequence has been integrated downstream of the RNA polymerase promoter of the vector.
  • it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the linkage between ribonucleosides using phosphate thioester or peptide bonds instead of phosphodiester bonds.
  • the polynucleotide encoding human DM mismatch repair protein 9.4 can be used for the diagnosis of diseases related to human DNA mismatch repair protein 9.4.
  • the polynucleotide encoding human DNA mismatch repair protein 9.4 can be used to detect the expression of human DNA mismatch repair protein 9.4 or the abnormal expression of human DNA mismatch repair protein 9.4 in a disease state.
  • the DNA sequence encoding human DNA mismatch repair protein 9.4 can be used to hybridize biopsy specimens to determine the expression of human DNA mismatch repair protein 9.4.
  • Hybridization techniques include Southern blotting, Nor thern blotting, and in situ hybridization. These techniques and methods are publicly available and mature, and the relevant kits are commercially available.
  • a part or all of the polynucleotides of the present invention can be used as probes to be fixed on a microarray or a DM chip (also called a "gene chip") for analyzing differential expression analysis and gene diagnosis of genes in tissues.
  • Human DNA mismatch repair protein 9.4 specific primers for RNA-polymerase chain reaction (RT-PCR) amplification in vitro can also detect the human DNA mismatch repair protein 9.4 transcription products.
  • Human DM mismatch repair protein 9.4 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to normal wild-type human DM mismatch repair protein 9.4 DNA sequences. Mutations can be detected using existing techniques such as Southern blotting, DM sequence analysis, PCR and in situ hybridization. In addition, mutations may affect the expression of proteins. Therefore, Nor thern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
  • the sequences of the invention are also valuable for chromosome identification.
  • the sequence specifically targets a specific position on a human chromosome and can hybridize to it.
  • specific sites for each gene on the chromosome need to be identified.
  • only a few chromosome markers based on actual sequence data are available for labeling chromosome positions.
  • it The important first step is to locate these DM sequences on the chromosome.
  • PCR primers (preferably 15-35bp) are prepared based on cDNA, and the sequences can be located on chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
  • PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
  • oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
  • Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and hybrid pre-selection to construct chromosome-specific cDNA libraries.
  • Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step.
  • FISH Fluorescent in situ hybridization
  • the physical location of the sequence on the chromosome can be correlated with the genetic map data. These data can be found in, for example, V. Mckusick, Mende l an an inher tance in Man (available online with Johns Hopkins University Welch Med ica l Library). Linkage analysis can then be used to determine the relationship between genes and diseases that have been mapped to chromosomal regions.
  • the difference in cDNA or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in the chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDM sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).
  • the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
  • suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
  • the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
  • the present invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the present invention.
  • a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the present invention.
  • these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which reminders authorize them to be administered to humans by government agencies that manufacture, use, or sell them.
  • the polypeptides of the invention can be combined with other Of therapeutic compounds.
  • the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
  • Human DM mismatch repair protein 9.4 is administered in an amount effective to treat and / or prevent a specific indication.
  • the amount and range of human DNA mismatch repair protein 9.4 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Toxicology (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

L'invention concerne un nouveau polypeptide, une protéine humaine de réparation 9.4 du mésappariement de l'ADN, et un polynucléotide codant pour ce polypeptide ainsi qu'un procédé d'obtention de ce polypeptide par des techniques recombinantes d'ADN. L'invention concerne en outre les applications de ce polypeptide dans le traitement de maladies, notamment des tumeurs malignes, de l'hémopathie, de l'infection par VIH, de maladies immunitaires et de diverses inflammations. L'invention concerne aussi l'antagoniste agissant contre le polypeptide et son action thérapeutique ainsi que les applications de ce polynucléotide codant pour la protéine humaine de réparation 9.4 du mésappariement de l'ADN.
PCT/CN2001/000355 2000-03-22 2001-03-19 Nouveau polypeptide, proteine humaine de reparation 9.4 du mesappariement de l'adn, et polynucleotide codant pour ce polypeptide WO2001070957A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU48237/01A AU4823701A (en) 2000-03-22 2001-03-19 A novel polypeptide, a human dna mismatch repair protein 9.4 and the polynucleotide encoding the polypeptide

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN00115036.7 2000-03-22
CN 00115036 CN1314391A (zh) 2000-03-22 2000-03-22 一种新的多肽——人dna错配修复蛋白9.4和编码这种多肽的多核苷酸

Publications (1)

Publication Number Publication Date
WO2001070957A1 true WO2001070957A1 (fr) 2001-09-27

Family

ID=4584507

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2001/000355 WO2001070957A1 (fr) 2000-03-22 2001-03-19 Nouveau polypeptide, proteine humaine de reparation 9.4 du mesappariement de l'adn, et polynucleotide codant pour ce polypeptide

Country Status (3)

Country Link
CN (1) CN1314391A (fr)
AU (1) AU4823701A (fr)
WO (1) WO2001070957A1 (fr)

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
DATABASE EMBL [online] 12 December 1999 (1999-12-12), Database accession no. AL096755 *
DATABASE EMBL [online] 23 November 1999 (1999-11-23), Database accession no. AL009172 *
DATABASE EMBL [online] 23 November 1999 (1999-11-23), Database accession no. AL022163 *
DATABASE EMBL [online] 23 November 1999 (1999-11-23), Database accession no. AL031293 *

Also Published As

Publication number Publication date
AU4823701A (en) 2001-10-03
CN1314391A (zh) 2001-09-26

Similar Documents

Publication Publication Date Title
WO2001072812A1 (fr) Nouveau polypeptide, bromodomaine humain 10, et polynucleotide codant pour ce polypeptide
WO2001083538A1 (fr) Nouveau polypeptide, proteine humaine 36 du gene k-ras, et polynucleotide codant pour ce polypeptide
WO2001070956A1 (fr) Nouveau polypeptide, proteine humaine de reparation 8 du mesappariement de l'adn, et polynucleotide codant pour ce polypeptide
WO2001070957A1 (fr) Nouveau polypeptide, proteine humaine de reparation 9.4 du mesappariement de l'adn, et polynucleotide codant pour ce polypeptide
WO2001074876A1 (fr) Nouveau polypeptide, phosphatidylinositol-3 kinase humaine 14, et polynucleotide codant pour ce polypeptide
WO2001072801A1 (fr) Nouveau polypeptide, proteine ribosomale humaine s11 12, et polynucleotide codant pour ce polypeptide
WO2001070965A1 (fr) Nouveau polypeptide, facteur humain de regulation de la transcription 15, et polynucleotide codant pour ce polypeptide
WO2001075101A1 (fr) Nouveau polypeptide, proteine humaine de regulation de la transcription 8, et polynucleotide codant pour ce polypeptide
WO2001094371A1 (fr) Nouveau polypeptide, proteine ribosomale humaine s4-10, et polynucleotide codant ce polypeptide
WO2001075100A1 (fr) Nouveau polypeptide, proteine humaine de reparation 10 du mesappariement de l'adn, et polynucleotide codant pour ce polypeptide
WO2001079428A2 (fr) Nouveau polypeptide, proteine humaine de reparation 8.9 du mesappariement de l'adn, et polynucleotide codant pour ce polypeptide
WO2001070958A1 (fr) Nouveau polypeptide, proteine humaine de reparation 15 du mesappariement de l'adn, et polynucleotide codant pour ce polypeptide
WO2001087968A1 (fr) Proteine s4-36 ribosomale, polypeptide humain, et polynucleotide la codant
WO2001075126A1 (fr) Nouveau polypeptide, proteine ribosomale humaine s18-9, et polynucleotide codant pour ce polypeptide
WO2001064735A1 (fr) Nouveau polypeptide, chaperonine moleculaire humaine cpn 60 8, et polynucleotide codant pour ce polypeptide
WO2001075018A2 (fr) Nouveau polypeptide, facteur humain de regulation de la transcription 31, et polynucleotide codant pour ce polypeptide
WO2001074873A1 (fr) Nouveau polypeptide, proteine humaine de reparation 9 du mesappariement de l'adn, et polynucleotide codant pour ce polypeptide
WO2001075102A1 (fr) Nouveau polypeptide, proteine humaine de regulation de la transcription 13, et polynucleotide codant pour ce polypeptide
WO2001079437A2 (fr) Nouveau polypeptide, facteur humain de transcription de la differentiation cellulaire 14, et polynucleotide codant pour ce polypeptide
WO2002020577A1 (fr) Nouveau polypeptide, nucleoside reductase 10.49, et polynucleotide codant ce polypeptide
WO2001046241A1 (fr) Nouveau polypeptide, proteine 12 gvpa, et polynucleotide codant pour ce polypeptide
WO2001070803A1 (fr) Nouveau polypeptide, proteine humaine de regulation de la transcription 9.7, et polynucleotide codant pour ce polypeptide
WO2001075055A2 (fr) Nouveau polypeptide, quinine reductase humaine 9, et polynucleotide codant pour ce polypeptide
WO2001073072A1 (fr) Nouveau polypeptide, chaperonine humaine 18, et polynucleotide codant pour ce polypeptide
WO2001074998A2 (fr) Nouveau polypeptide, proteine humaine de regulation 10 de la serine proteinase, et polynucleotide codant pour ce polypeptide

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP