WO2001070958A1 - Nouveau polypeptide, proteine humaine de reparation 15 du mesappariement de l'adn, et polynucleotide codant pour ce polypeptide - Google Patents

Nouveau polypeptide, proteine humaine de reparation 15 du mesappariement de l'adn, et polynucleotide codant pour ce polypeptide Download PDF

Info

Publication number
WO2001070958A1
WO2001070958A1 PCT/CN2001/000356 CN0100356W WO0170958A1 WO 2001070958 A1 WO2001070958 A1 WO 2001070958A1 CN 0100356 W CN0100356 W CN 0100356W WO 0170958 A1 WO0170958 A1 WO 0170958A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
polynucleotide
mismatch repair
repair protein
human dna
Prior art date
Application number
PCT/CN2001/000356
Other languages
English (en)
Chinese (zh)
Inventor
Yumin Mao
Yi Xie
Original Assignee
Biowindow Gene Development Inc. Shanghai
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Biowindow Gene Development Inc. Shanghai filed Critical Biowindow Gene Development Inc. Shanghai
Priority to AU50255/01A priority Critical patent/AU5025501A/en
Publication of WO2001070958A1 publication Critical patent/WO2001070958A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals

Definitions

  • the present invention belongs to the field of biotechnology. Specifically, the present invention describes a new polypeptide, a human DM mismatch repair protein 15, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a method and application for preparing the polynucleotide and polypeptide. Background technique
  • DM polymerase occasionally catalyzes the incorporation of wrong bases that cannot form hydrogen bonds with the template. This replication error is usually corrected immediately by the DNA polymerase's 3'-5 'proofreading function before the next nucleotide polymerization reaction begins. However, under some special conditions, DM polymerase left very few wrong bases on the DNA strand without correction. It is estimated that the frequency of such errors is 10-8. However, it is the actual measured frequency of mutant 10_ 1Q or 10- u. Because the integrity and accuracy of DNA is fundamental to life, another repair system, called the mismatch repair system, has evolved in cells, giving a second chance to correct errors. (Modr ich P. A. Rev. Biochem.
  • the methylation of adenine is the identification mark of mismatch repair. According to the characteristics brought by methylation, the mismatch repair system is The template strand and the nascent strand can be identified, thereby correcting unpaired bases on the nascent, ensuring high accuracy and integrity.
  • DNA mismatch repair protein is an important constituent protein in the mismatch repair system.
  • DNA mismatch repair protein exists in many organisms, for example, mutL protein of E. coli; hexB protein of streptococcus; PMS1 and MLH1 proteins of yeast; Human MLH1 (MutL homo logue-1) protein and so on.
  • DNA mismatch repair proteins contain a conserved region that contains the following consistent sequence fragments: G-F-RG-EAL. This sequence fragment is contained in DM mismatch repair proteins in many different organisms. This A structural motif plays a very important role in the process of protein's normal physiological function. The results of research on yeast DNA mismatch repair protein showed that if Pro640 becomes Leu, it will cause complete loss of protein function. For the specific structure of DNA mismatch repair protein and its relationship with function, please refer to related literature. (Gene 1998 Jun 15; 213 (1-2): 159-67)
  • HNPCC heritable non-po l ypos i s co l orec tal l cancer
  • the human DNA mismatch repair protein 15 protein plays an important role in regulating important functions of the body, such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes, so the identification of more involved in these During the process of human DNA mismatch repair protein 15 protein, especially the amino acid sequence of this protein is identified. Isolation of newcomer DNA mismatch repair protein 15 protein encoding genes also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so it is important to isolate its coding DNA. Disclosure of invention
  • Another object of the invention is to provide a polynucleotide encoding the polypeptide.
  • Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding a human DNA mismatch repair protein 15.
  • Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding a human DMA mismatch repair protein 15.
  • Another object of the present invention is to provide a method for producing human DM mismatch repair protein 15.
  • Another object of the present invention is to provide antibodies against the polypeptide-to-human DNA mismatch repair protein 15 of the present invention.
  • Another object of the present invention is to provide mimic compounds, antagonists, agonists, and inhibitors directed to the polypeptide-to-human DNA mismatch repair protein 15 of the present invention.
  • Another object of the present invention is to provide diagnostic treatment related to human DNA mismatch repair protein 15 abnormalities. Methods of disease.
  • the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
  • the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
  • sequence of the polynucleotide is one selected from the group consisting of: (a) having SEQ ID NO: 1
  • the present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
  • the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
  • the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of human DNA mismatch repair protein 15 protein, which comprises utilizing the polypeptide of the invention.
  • the invention also relates to compounds obtained by this method.
  • the invention also relates to a method for detecting a disease or disease susceptibility related to abnormal expression of human DNA mismatch repair protein 15 protein in vitro, comprising detecting a mutation in the polypeptide or a polynucleotide sequence encoding the same in a biological sample, or detecting The amount or biological activity of a polypeptide of the invention in a biological sample.
  • the invention also relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
  • the present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention in the preparation of a medicament for treating cancer, developmental disease or immune disease or other diseases caused by abnormal expression of human DNA mismatch repair protein 15. '
  • Nucleic acid sequence refers to oligonucleotides, nucleotides or polynucleotides and fragments or parts thereof, and may also refer to genomes or DNA or RNA, they can be 'single-stranded or double-stranded, which represent the sense or antisense strand.
  • amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof Minute.
  • amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
  • a “variant" of a protein or polynucleotide refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it.
  • the changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence.
  • Variants can have "conservative" changes, in which the amino acid substituted has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine.
  • Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
  • “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
  • Insertion refers to an alteration in the amino acid sequence or nucleotide sequence that results in an increase in one or more amino acids or nucleotides compared to a naturally occurring molecule.
  • Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
  • Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
  • immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response in appropriate animals or cells and to bind to specific antibodies.
  • An "agonist” refers to a molecule that, when combined with human DNA mismatch repair protein 15, can cause the protein to change, thereby regulating the activity of the protein.
  • An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that can bind to human DNA mismatch repair protein 15.
  • Antagonist refers to a molecule that can block or regulate the biological or immunological activity of human DM mismatch repair protein 15 when combined with human DNA mismatch repair protein 15.
  • Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates or any other molecule that can bind to human DNA mismatch repair protein 15.
  • Regular refers to changes in the function of human DNA mismatch repair protein 15, including an increase or decrease in protein activity, changes in binding characteristics, and any other biological properties, functions, or immunity of human DNA mismatch repair protein 15. Change of nature.
  • substantially pure ' means substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated.
  • Those skilled in the art can purify human DNA mismatch repair protein 15 using standard protein purification techniques. Basic The pure human DNA mismatch repair protein 15 can generate a single main band on a non-reducing polyacrylamide gel. The purity of the human DNA mismatch repair protein 15 can be analyzed by amino acid sequence.
  • Complementary refers to polynucleotides that naturally bind through base-pairing under conditions of acceptable salt concentration and temperature.
  • sequence "CT-G-A” can be combined with the complementary sequence "G-A-C-T”.
  • the complementarity between two single-stranded molecules may be partial or complete.
  • the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
  • “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
  • Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Southern imprinting or Nor thern blotting, etc.) under conditions of reduced stringency.
  • Substantially homologous sequences or hybridization probes can compete and inhibit the binding of fully homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that conditions with reduced stringency allow non-specific binding, because conditions with reduced stringency require that the two sequences bind to each other as either specific or selective interactions.
  • Percent identity refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALIGN program (Lasergene sof tware package, DNASTAR, Inc., Madi son Wis.). The MEGALIGN program can compare two or more sequences according to different methods such as the Clus ter method (Hi gg ins, DG and PM Sharp (1988) Gene 73: 237-244). 0 The Clus ter method will check the distance between all pairs by Groups of sequences are arranged in clusters. The clusters are then assigned in pairs or groups.
  • the percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula: The number of matching residues between sequence A and sequence X 100 The number of residues in sequence A-the number of spacer residues in sequence A The number of spacer residues in a sequence B can also be determined by the Clus ter method or by a method known in the art such as Jotun He in (% in Hez J., (1990) Methods in emzumology 183: 625- 645) 0 "Similarity" refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
  • Amino acids used for conservative substitutions may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
  • Antisense refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence.
  • Antisense strand refers to a nucleic acid strand that is complementary to a “sense strand.”
  • Derivative refers to a chemical modification of HFP or a nucleic acid encoding it. This chemical modification may be a substitution of a hydrogen atom with a fluorenyl, acyl or amino group. Nucleic acid derivatives encode major organisms that retain natural molecules Peptides with chemical properties.
  • Antibody refers to a complete antibody molecule and its fragments, such as Fa,? ( ⁇ ') 2 and? ⁇ It can specifically bind to the epitope of human DNA mismatch repair protein 15.
  • a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
  • isolated refers to the removal of a substance from its original environment (for example, its natural environment if it is naturally occurring).
  • a naturally-occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
  • Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not part of its natural environment, they are still isolated.
  • isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
  • polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances in the natural state .
  • isolated human DNA mismatch repair protein 15 means that human DNA mismatch repair protein 15 is substantially free of other proteins, lipids, sugars, or other substances that are naturally associated with it. Those skilled in the art can purify human DNA mismatch repair protein 15 using standard protein purification techniques. Substantially pure peptides produce a single main band on a non-reducing polyacrylamide gel. The purity of the human DNA mismatch repair protein 15 peptide can be analyzed by amino acid sequence.
  • the present invention provides a novel polypeptide-to-human DNA mismatch repair protein 15 which is basically composed of the amino acid sequence shown in SEQ ID NO: 2.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
  • the polypeptides of the invention can be naturally purified products, or chemically synthesized products, or produced using recombinant techniques from prokaryotic or eukaryotic hosts (e.g., bacteria, yeast, higher plants, insects, and mammalian cells). Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
  • the invention also includes fragments, derivatives and analogs of human DM mismatch repair protein 15.
  • fragment refers to a polypeptide that substantially maintains the same biological function or activity of the human DNA mismatch repair protein 15 of the present invention.
  • a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution The amino acid may or may not be encoded by the genetic codon; or ( ⁇ ) such one or more amino acids A group on a carboxylic acid residue is substituted by another group to include a substituent; or (III) a type in which the mature polypeptide is fused with another compound (such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol) Or (IV) a polypeptide sequence (such as a leader sequence or a secreted sequence or a sequence used to purify this polypeptide or a protease sequence) formed by fusing additional amino acid sequences into a mature polypeptide, as described herein, such Fragments, derivatives and analogs are considered to be within the knowledge of those skilled in the art.
  • the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
  • the polynucleotide of the present invention is found from a CDM library of human fetal brain tissue. It contains a full-length polynucleotide sequence of 1631 bases, and its open reading frame 522-929 encodes 135 amino acids.
  • the polynucleotide of the present invention can It is in the form of DNA or MA.
  • DNA forms include cDNA, genomic DNA, or synthetic DNA.
  • DNA can be single-stranded or double-stranded.
  • DNA can be coding or non-coding.
  • the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
  • a “degenerate variant” refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but having a sequence different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
  • the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence. .
  • polynucleotide encoding a polypeptide refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.
  • the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
  • Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
  • an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
  • the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity between the two sequences).
  • the present invention particularly relates to the present invention under strict conditions.
  • the polynucleotide is a polynucleotide that can hybridize.
  • “strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.13 ⁇ 4SDS, 6 (TC; or (2) during hybridization Add denaturants, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% Fi co ll, 42 ° C, etc .; or (3) the same between the two sequences only Hybridization occurs when the sex is at least 95%, and more preferably 97%.
  • the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
  • nucleic acid fragments that hybridize to the sequences described above.
  • a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 cores. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques such as PCR to identify and / or isolate polynucleotides encoding human DNA mismatch repair protein 15.
  • polypeptides and polynucleotides in the present invention are preferably provided in an isolated i form, and are more preferably purified to homogeneity.
  • the specific polynucleotide sequence encoding the human DM mismatch repair protein 15 of the present invention can be obtained by various methods.
  • polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
  • the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.
  • genomic DM is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences.
  • the standard method for isolating the cDNA of interest is to isolate mRM from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or .phage cDM library.
  • mRM plasmid
  • .phage cDM library There are many proven techniques for extracting mRM, and kits are also commercially available (Qiagene).
  • the construction of cDNA libraries is also a common method (Sambrook, et al., Mol ecu lar Cl on, A Labora tory Manu l, Col d Harbor Harbor Labora tory. New York, 1989).
  • Commercially available cDNA libraries are also available, such as different cDNA libraries from Cl on tech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
  • genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DM-RM hybridization; (2) the presence or loss of marker gene function; (3) determination of the level of human DNA mismatch repair protein 15 transcripts; ( 4) Detecting gene-expressed protein products by immunological techniques or by measuring biological activity. The above methods can be used singly or in combination.
  • the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
  • the length of the probe is usually within 2000 nucleotides. It is preferably within 1000 nucleotides.
  • the probe used herein is generally a DNA sequence chemically synthesized based on the gene sequence information of the present invention. The genes or fragments of the present invention can of course be used as probes.
  • DM probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
  • immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) can be used to detect the protein product of human DNA mismatch repair protein 15 gene expression.
  • ELISA enzyme-linked immunosorbent assay
  • a method using DNA technology to amplify DNA / RNA is preferably used to obtain the gene of the present invention.
  • the RACE method RACE-cDM terminal rapid amplification method
  • the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Select and synthesize using conventional methods.
  • the amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
  • polynucleotide sequence of the gene of the present invention or various DM fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, the sequencing must be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDM sequence.
  • the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using human DM mismatch repair protein 15 coding sequence, and the recombinant technology to produce the polypeptide of the present invention. method.
  • a polynucleotide sequence encoding a human DNA mismatch repair protein 15 may be inserted into a vector to form a recombinant vector containing the polynucleotide of the present invention.
  • vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses or other vectors well known in the art.
  • Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors expressed in bacteria (Rosenberg, et al.
  • any plasmid and vector can be used to construct a recombinant expression vector.
  • An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
  • DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide the synthesis of raRNA.
  • promoters are: the l ac or trp promoter of E.
  • the expression vector also includes a ribosome binding site and a transcription terminator for translation initiation. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors expressed by DM, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Examples include 100 to 270 base pair SV40 enhancers on the late side of the origin of replication, polyoma enhancers and adenovirus enhancers on the late side of the origin of replication.
  • the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • GFP fluorescent protein
  • tetracycline or ampicillin resistance for E. coli.
  • a polynucleotide encoding human DNA mismatch repair protein 15 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a genetically engineered host cell containing the polynucleotide or a recombinant vector.
  • the term "host cell” refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E.
  • coli Streptomyces
  • bacterial cells such as Salmonella typhimurium
  • fungal cells such as yeast
  • plant cells such as fly S2 or Sf 9
  • animal cells such as CHO, COS or Bowes melanoma cells.
  • Transformation of a host cell with a DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art.
  • the host is a prokaryote such as E. coli
  • competent cells capable of absorbing DM may be harvested after exponential growth phase, treated with CaC l 2 method used in steps well known in the art. The alternative is to use MgC l 2 .
  • transformation can also be performed by electroporation.
  • the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
  • the polynucleotide sequence of the present invention can be used to express or produce recombinant human DNA mismatch repair protein 15 (Scence, 1984; 224: 1431). Generally there are the following steps:
  • the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
  • a suitable method such as temperature conversion or chemical induction
  • the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell.
  • recombinant proteins can be separated and purified by various separation methods using their physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
  • conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography
  • FIG. 1 is a comparison diagram of gene chip expression profiles of DM mismatch repair protein 15 and human DNA mismatch repair protein 11 of the present invention.
  • the upper graph is a graph of the expression profile of human DNA mismatch repair protein 15 and the lower graph is the graph of the expression profile of human DNA mismatch repair protein 11.
  • 1 indicates fetal kidney
  • 2 indicates fetal large intestine
  • 3 indicates fetal small intestine
  • 4 indicates fetal muscle
  • 5 indicates fetal brain
  • 6 indicates fetal bladder
  • 7 indicates non-starved L02
  • 8 indicates L02 +, lhr, As 3+
  • 9 indicates ECV304 PMA-
  • 10 means ECV304 PMA +
  • 11 means fetal liver
  • 12 means normal liver
  • 13 means thyroid
  • 14 means skin
  • 15 means fetal lung
  • 16 means lung
  • 17 means lung cancer
  • 18 means fetal spleen
  • 19 means spleen
  • 20 Indicates prostate
  • 21 indicates fetal heart
  • 22 indicates heart
  • 23 indicates muscle
  • 24 indicates testis
  • 25 indicates fetal thymus
  • 26 indicates thymus.
  • Figure 1 is a polyacrylamide gel electrophoresis image of the isolated human DNA mismatch repair protein 15 (SDS-1)
  • 15KDa is the molecular weight of the protein.
  • the arrow indicates the isolated protein band.
  • Human fetal brain total MA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform.
  • Poly (A) mRNA was isolated from total RNA using Quik raRNA Isolat ion Kit (product of Qiegene). 2ug poly (A) mRNA is reverse transcribed to form cDNA.
  • a Smart cDM cloning kit purchased from Clontech was used to insert the cDNA fragment into the multicloning site of the pBSK (+) vector (Clontech) to transform DH5a. The bacteria formed a cDNA library.
  • CDNA was synthesized using fetal brain cell total MA as a template and ol igo-dT as a primer for reverse transcription reaction. After purification using Qiagene's kit, the following primers were used for PCR amplification:
  • Primer 1 5
  • AAAGAACTGCTTTCAGGAAAATAT -3 5
  • SEQ ID NO: 3 3
  • Pr imer2 5'- CTTTTTTTAAAAATGTTTATCTGC -3 '(SEQ ID NO: 4)
  • Pr iraerl is a forward sequence starting at lbp at the 5 ′ end of SEQ ID NO: 1;
  • Primer2 is the 3 'end reverse sequence in SEQ ID NO: 1.
  • Amplification conditions 50 ⁇ l of KC1, 10 mmol / L Tris-Cl, (pH 8.5.5), 1.5 mmol / L MgCl 2 , 200 ⁇ mol / L in a reaction volume of 50 ⁇ 1 dNTP, l Opmol primer, 1U Taq DNA polymerase (Clontech).
  • the reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) for 25 cycles under the following conditions: 94. C 30sec; 55 ° C 30sec; 72 ° C 2min.
  • RT-PCR set ⁇ -act in as a positive control and template blank as a negative control.
  • the amplified product was purified using a QIAGEN kit and ligated to a pCR vector (Invitrogen) using a TA cloning kit.
  • the DNA sequence analysis results showed that the DM sequence of the PCR product was exactly the same as the 1-1631bp shown in SEQ ID NO: 1.
  • Example 3 Northern blot analysis of human DNA mismatch repair protein 15 gene expression:
  • the method includes acid sulfur Guanidinium cyanate phenol-chloroform extraction. That is, the tissue is homogenized with 4M guanidine isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1) are added. ) And centrifuge after mixing. The aqueous layer was aspirated, isopropanol (0.8 vol) was added and the mixture was centrifuged to obtain RM precipitate. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water.
  • RNA was synthesized by electrophoresis on a 1.2% agarose gel containing 20 mM 3- (N-morpholino) propanesulfonic acid (H7.0) -5 mM sodium acetate-ImM EDTA-2.2M formaldehyde. It was then transferred to a nitrocellulose membrane.
  • the DNA probe used was the PCR-encoded human DNA mismatch repair protein 15 coding region sequence (522bp to 929bp) shown in FIG.
  • a 32P-labeled probe (approximately 2 x 10 6 cpm / ml) was hybridized with a nitrocellulose membrane to which RNA was transferred at 42 ° C overnight in a solution containing 50% formamide-25mM H 2 P0 4 (pH7.4)-5 x SSC-5 x Denhardt's solution and 200 ⁇ g / ml salmon sperm DNA. After hybridization, the filter was washed in 1 x SSC-0.1% SDS at 55 ° C for 30 miii. Then, Phosphor Imager was used for analysis and quantification.
  • Example 4 In vitro expression, isolation and purification of recombinant human DM mismatch repair protein 15
  • Primer3 5'- CCCCATATGATGACTTCATTAGAGAAGAAAGAA -3, (Seq ID No: 5)
  • Primer4 5'- CCCGAATTCTTAGCTGCGCGATCCTCCTGCCTC -3, (Seq ID No: 6)
  • the 5 'ends of these two primers contain Ndel and EcoRI digestion sites, respectively, followed by the coding sequences of the 5' and 3 'ends of the target gene, respectively.
  • the Ndel and EcoRI restriction sites correspond to the selective endonuclease sites on the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865.3).
  • PCR was performed using the pBS-0996f08 plasmid containing the full-length target gene as a template.
  • the PCR reaction conditions are as follows: a total volume of 50 ⁇ l contains 10 pg of pBS-0996f 08 plasmid, primer Primer-3 and Primer are separated! J is lOpmol, Advantage polymerase Mix (Clontech) 1 ⁇ 1. Cycle parameters: 94. C 20s, 60 ° C 30s, 68. C 2 min, a total of 25 cycles. Ndel and EcoRI were used to double digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase. The ligation product was transformed into E. coli DH5a by the calcium chloride method.
  • the host f BUI (pET-0 996 f0 8 ) was cultured at 37 ° C to logarithmic growth phase in LB liquid medium containing kanamycin (final concentration 30 ⁇ g / ml), and IPTG was added to a final concentration of 1 Let ol / L, continue to cultivate for 5 hours. The bacteria were collected by centrifugation, and the supernatant was collected by centrifugation. The supernatant was collected by centrifugation. The affinity chromatography column His. Bind Quick Cartridge (product of Novagen) was used to obtain 6 histidine (6His-Tag). The purified human DNA mismatch repair protein 15 was purified.
  • the following peptides specific for human DNA mismatch repair protein 15 were synthesized using a peptide synthesizer (product of PE): NH2-Met-Thr-Ser-Leu-Glu-Lys-Lys-Glu-Arg-Lys-Lys-Glu- Arg-Lys-Lys- C00H (SEQ ID NO: 7).
  • the polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex, respectively.
  • Example 6 Application of the polynucleotide fragment of the present invention as a hybridization probe
  • Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
  • the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
  • the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
  • the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method.
  • Filter hybridization methods include dot blotting, Southern blotting, Northern blotting, and copying methods. They all use the same steps of hybridization after fixing the polynucleotide sample to be tested on the filter.
  • the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer, so that the non-specific binding site of the sample on the filter is saturated with the carrier and the synthetic polymer.
  • the pre-hybridization solution is then replaced with a hybridization buffer containing the labeled probe and incubated to hybridize the probe to the target nucleic acid.
  • the unhybridized probes are removed by a series of membrane washing steps.
  • This embodiment utilizes higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals.
  • the probes used in this embodiment include two types.
  • the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention.
  • Polynucleotide of the invention SEQ ID NO: 1 Identical or complementary oligonucleotide fragment.
  • the dot blot method is used to fix the sample on the filter membrane. Needle-to-sample hybridization has the strongest specificity and is retained.
  • oligonucleotide fragments for use as hybridization probes from the polynucleotide SEQ ID NO: 1 of the present invention should follow the following principles and several aspects to be considered:
  • the preferred range of probe size is 18-50 nucleotides
  • Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other unknown genomic sequences and their complements The regions are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, the primary probe should not be used;
  • Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
  • Probe 1 which belongs to the second type of probe, is equivalent to the replacement mutant sequence of the gene fragment of SEQ ID NO: 1 or its complementary fragment (41Nt):
  • PBS phosphate buffered saline
  • RNA enzyme A was added to the DNA solution to a final concentration of lOOug / ml, 37 D C for 30 minutes.
  • Add SDS and proteinase K the final concentrations are 0.5% and 100ug / ml, respectively. Incubate at 37 ° C for 30 minutes.
  • NC membrane nitrocellulose membrane
  • Two NC membranes are needed for each probe for later experiments.
  • the film is washed with high-strength conditions and strength conditions, respectively.
  • Gene chip or gene microarray is a new technology currently being developed by many national laboratories and large pharmaceutical companies.
  • the data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software to achieve the purpose of rapid, efficient, and high-throughput analysis of biological information.
  • the polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research of new gene functions; search for and screen new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases .
  • the specific method steps have been reported in the literature. For example, refer to the literature DeR isi, JL, Lyer, V. & Brown, P. 0. (1997) Sc ience 278, 680-686. And the literature Hel le, RA, Schema , M., Cha i, A., Sha lom, D., (1997) PNAS 94: 2150-2155.
  • a total of 4,000 polynucleotide sequences of various full-length cDNAs are used as target DNA, including the polynucleotide of the present invention. They were respectively amplified by PCR. After the purified amplified product was purified, the concentration was adjusted to about 500 ng / ul, and spotted on a glass medium with a Cartesian 7500 spotter (purchased from Cartesian Company, USA). The distance between the points is 280 ⁇ ⁇ . The spotted slides were hydrated, dried, and cross-linked in a purple diplomatic coupling instrument. After elution, the DNA was fixed on a glass slide to prepare a chip. The specific method steps have been reported in the literature in various ways. The post-spot processing steps of this embodiment are:
  • Total mRNA was extracted from human mixed tissues and specific tissues (or stimulated cell lines) in one step, and the mRNA was purified with Oligotex mRNA Midi Ki t (purchased from QiaGen).
  • Cy3dUTP (5-Amino-propargyl-2'-deoxyur idine 5'-tripha te coupled to Cy3 f luorescent dye, purchased from Amersham Phamacia Biotech) was used to label the mRNA of human mixed tissue, and the fluorescent reagent Cy5dUTP (5- Amino- propargy) was used.
  • the probes from the above two tissues and the chip were respectively hybridized in a UniHyb TM Hybridization Solution (purchased from TeleChem) hybridization solution for 16 hours, and washed with a washing solution (1 SSC, 0.2% SDS) at room temperature. Scanning was then performed with a ScanArray 3000 scanner (purchased from Genera Scanning, USA), and the scanned images were analyzed and processed with Imagene software (Biodiscovery, USA) to calculate the Cy3 / Cy5 ratio of each point.
  • the above specific tissues are thymus, testis, muscle, spleen, lung, skin, thyroid, liver, PMA + Ecv304 cell line, PMA-Ecv304 cell line, non-starved L02 cell line, L02 cell line stimulated by arsenic for 1 hour, L02 cell line stimulated by arsenic for 6 hours prostate, heart, lung cancer, fetal bladder, fetal small intestine, fetal large intestine, fetal thymus, fetal muscle, fetal liver, fetal kidney, fetal spleen, fetal brain, Fetal lung and fetal heart.
  • polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat malignant tumors, adrenal deficiency, skin diseases, various inflammations, HIV infections and immune diseases.
  • DNA mismatch repair protein is an important component protein in the mismatch repair system.
  • DM mismatch repair protein exists in many organisms.
  • human MLH1 (MutL homo logue-1) protein is a DM mismatch repair protein. All DM mismatch repair proteins contain a conserved sequence fragment. Mutations in this sequence fragment can cause loss of protein function. Therefore, abnormal expression of a polypeptide containing a specific sequence of a DM mismatch repair protein will affect the correct transcription of DNA and further cause certain diseases such as tumors, growth and development disorders, inflammation, and the like.
  • the abnormal expression of the human DM mismatch repair protein 15 of the present invention will produce various diseases, especially tumors, embryonic developmental disorders, growth disorders, and inflammation. These diseases include, but are not limited to:
  • Tumors of various tissues gastric cancer, liver cancer, lung cancer, esophageal cancer, breast cancer, leukemia, lymphoma, E-gonad tumor, uterine fibroids, neuroblastoma, astrocytoma, ependymoma, glial cells Tumor, moon cancer, malignant histiocytosis, melanoma, teratoma, sarcoma, adrenal cancer, bladder cancer, bone cancer, bone P tumor, myeloma, bone marrow cancer, brain cancer, uterine cancer, endometrial cancer, Gallbladder cancer, colon cancer, thymic tumor, nasal cavity and sinus tumor, nasopharyngeal cancer, laryngeal cancer, tracheal tumor, pleural mesothelioma, fibroid, fibrosarcoma, moon tumor, liposarcoma, leiomyoma
  • Embryonic disorders congenital abortion, cleft palate, limb absentness, limb differentiation disorder, hyaline membrane disease, atelectasis, polycystic kidney disease, double ureter, crypto, congenital inguinal hernia, double uterus, vaginal atresia, hypospadias , Bisexual deformity, Atrial septal defect, Ventricular septal defect, Pulmonary stenosis, Arterial duct occlusion, Neural tube defect, Congenital hydrocephalus, Iris defect, Congenital cataract, Congenital glaucoma or cataract, Congenital deafness
  • Growth and development disorders mental retardation, cerebral palsy, brain development disorders, mental retardation, familial cerebral nucleus dysplasia syndrome, strabismus, skin, fat and muscular dysplasia such as congenital skin laxity, premature aging Disease, congenital keratosis, various metabolic defects such as various amino acid metabolic defects, stunting, dwarfism, sexual retardation
  • the abnormal expression of the human DNA mismatch repair protein 15 of the present invention will also produce certain hereditary, hematological and immune system diseases.
  • the invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) human DNA mismatch repair protein 15.
  • Agonist enhances human DNA mismatch repair protein 15 to stimulate cell proliferation And other biological functions, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
  • mammalian cells or a membrane preparation expressing human DM mismatch repair protein 15 can be cultured together with labeled human DNA mismatch repair protein 15 in the presence of a drug. The ability of the drug to increase or block this interaction is then determined.
  • Antagonists of human DNA mismatch repair protein 15 include antibodies, compounds, receptor deletions, and the like that have been screened. Antagonists of human DNA mismatch repair protein 15 can bind to human DNA mismatch repair protein 15 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot exert its biology Features.
  • human DNA mismatch repair protein 15 can be added to the bioanalytical assay to determine whether the compound is an Antagonist. Receptor deletions and analogs that act as antagonists can be screened in the same way as for screening compounds described above.
  • Peptide molecules capable of binding to human DNA mismatch repair protein 15 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. During screening, 15 molecules of human DM mismatch repair protein should generally be labeled.
  • the present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies.
  • the invention also provides antibodies against the human DM mismatch repair protein 15 epitope. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments generated from Fab expression libraries. '
  • Polyclonal antibodies can be produced by injecting human DM mismatch repair protein 15 directly into immunized animals (such as rabbits, mice, rats, etc.).
  • immunized animals such as rabbits, mice, rats, etc.
  • a variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's Agent.
  • Techniques for preparing monoclonal antibodies to human DNA mismatch repair protein 15 include, but are not limited to, hybridoma technology (Kohler and Miste in. Nature, 1975, 256: 495-497), triple tumor technology, human beta-cell hybridization Tumor technology, EBV-hybridoma technology, etc.
  • Chimeric antibodies that bind human constant regions to non-human variable regions can be produced using existing techniques (Morrison et al, PNAS, 1985, 81: 6851). 0
  • Existing techniques for producing single-chain antibodies can also be used to produce single chain antibodies against human DM mismatch repair protein 15.
  • Antibodies against human DNA mismatch repair protein 15 can be used in immunohistochemical techniques to detect human DM mismatch repair protein 15 in biopsy specimens.
  • Monoclonal antibodies that bind to human DNA mismatch repair protein 15 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis. ' Antibodies can also be used to design immunotoxins that target a particular part of the body. For example, human DNA mismatch repair protein 15 high affinity monoclonal antibodies can covalently bind to bacterial or phytotoxins (such as diphtheria toxin, ricin, ormosine, etc.).
  • a common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
  • This hybrid antibody can be used to kill human DNA mismatch repair protein 15 positive cell.
  • the antibodies of the present invention can be used to treat or prevent diseases related to human DNA mismatch repair protein 15.
  • Administration of an appropriate dose of antibody can stimulate or block the production or activity of human DNA mismatch repair protein 15.
  • the invention also relates to a diagnostic test method for quantitatively and locally detecting human DM mismatch repair protein 15 levels.
  • tests are well known in the art and include FI SH assays and radioimmunoassays.
  • the level of human DNA mismatch repair protein 15 detected in the test can be used to explain the importance of human 1 A mismatch repair protein 15 in various diseases and to diagnose diseases in which human DNA mismatch repair protein 15 plays a role .
  • polypeptide of the present invention can also be used for peptide mapping analysis.
  • the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
  • Polynucleotides encoding human DM mismatch repair protein 15 can also be used for a variety of therapeutic purposes. Gene therapy technology can be used to treat abnormal cell proliferation, development or metabolism caused by the non-expression or abnormal / inactive expression of human DNA mismatch repair protein 15.
  • Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated human DNA mismatch repair protein 15 to inhibit endogenous human DM mismatch repair protein 15 activity.
  • a mutated human DNA mismatch repair protein 15 may be a shortened human DNA mismatch repair protein 15 lacking a signal transduction domain. Although it can bind to downstream substrates, it lacks signal transduction activity.
  • the recombinant gene therapy vector can be used for treating diseases caused by abnormal expression or activity of human DNA mismatch repair protein 15.
  • Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to transfer the polynucleotide encoding human DM mismatch repair protein 15 into cells.
  • Methods for constructing recombinant viral vectors carrying a polynucleotide encoding human DNA mismatch repair protein 15 can be found in existing literature (Sambrook, et al.).
  • a recombinant polynucleotide encoding human DNA mismatch repair protein 15 can be packaged into liposomes and transferred into cells.
  • Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
  • a vector such as a virus, phage, or plasmid
  • Oligonucleotides including antisense RNA and DNA
  • ribozymes that inhibit human DNA mismatch repair protein 15 mRNA are also within the scope of the present invention.
  • a ribozyme is an enzyme-like RNA molecule that can specifically decompose a specific RM. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation.
  • Antisense RNA, DM, and ribozymes can be obtained by any existing RNA or DM synthesis technology, such as the technology of solid phase phosphate amide synthesis of oligonucleotides has been widely used.
  • Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DM sequence encoding the RNA. This DNA sequence has been integrated downstream of the vector's RNA polymerase promoter. In order to increase the stability of a nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the ribonucleoside linkages should use phosphate thioester or peptide bonds instead of phosphodiester bonds.
  • the polynucleotide encoding human DNA mismatch repair protein 15 can be used for the diagnosis of diseases related to human DM mismatch repair protein 15.
  • the polynucleotide encoding human DNA mismatch repair protein 15 can be used to detect the expression of human DNA mismatch repair protein 15 or the abnormal expression of human DNA mismatch repair protein 15 in a disease state.
  • a DNA sequence encoding human DNA mismatch repair protein 15 can be used to hybridize biopsy specimens to determine the expression of human DNA mismatch repair protein 15.
  • Hybridization techniques include Sou thern blotting, Nor thern blotting, and in situ hybridization. These techniques and methods are all mature and open technologies, and related kits are commercially available.
  • Part or all of the polynucleotides of the present invention can be used as probes to be fixed on a micro array (Mi croar ray) or a DNA chip (also known as a "gene chip"), and used to analyze differential expression analysis of genes and genetic diagnosis in tissues.
  • a micro array Mo croar ray
  • a DNA chip also known as a "gene chip”
  • Human DNA mismatch repair protein 15 specific primers for RNA-polymerase chain reaction (RT-PCR) amplification in vitro can also detect human DNA mismatch repair protein 15 transcription products.
  • Detection of mutations in the human DNA mismatch repair protein 15 gene can also be used to diagnose human DM mismatch repair protein 15-related diseases.
  • the form of human DNA mismatch repair protein 15 mutations includes point mutations, translocations, deletions, recombinations, and any other abnormalities compared to normal wild-type human DNA mismatch repair protein 15 DNA sequences. Mutations can be detected using well-known techniques such as Sou thern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression. Therefore, the Nor thern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
  • the sequences of the invention are also valuable for chromosome identification.
  • the sequence specifically targets a specific position on a human chromosome and can hybridize to it.
  • specific sites for each gene on the chromosome need to be identified.
  • only a few chromosome markers based on actual sequence data are available for marking chromosome positions.
  • an important first step is to locate these DM sequences on a chromosome.
  • PCR primers (preferably 15-35bp) are prepared based on cDNA, and the sequences can be located on chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
  • PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
  • oligonucleotide primers of the present invention by a similar method, a set of fragments from a specific chromosome can be utilized Or a large number of genomic clones to achieve sublocalization.
  • Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and hybrid pre-selection to construct a chromosome-specific CDM library.
  • Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step.
  • FISH Fluorescent in situ hybridization
  • the physical location of the sequence on the chromosome can be correlated with the genetic map data. These data can be found, for example, in V. Mckusick, Mendelian Iherintance in Man (available online with Johns Hopkins University Wetch Medical Library). Linkage analysis can then be used to determine the relationship between genes and diseases that have been mapped to chromosomal regions. -Next, the cDM or genomic sequence differences between the affected and unaffected individuals need to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease.
  • cDNAs that are accurately mapped to disease-related chromosomal regions can be one of 50 to 500 potentially pathogenic genes (assuming
  • the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
  • suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
  • the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
  • the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell.
  • the polypeptides of the invention can be used in combination with other therapeutic compounds.
  • the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
  • Human DNA mismatch repair protein 15 is administered in an amount effective to treat and / or prevent a specific indication.
  • the amount and dosage range of human DNA mismatch repair protein 15 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Toxicology (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

L'invention concerne un nouveau polypeptide, une protéine humaine de réparation 15 du mésappariement de l'ADN, et un polynucléotide codant pour ce polypeptide ainsi qu'un procédé d'obtention de ce polypeptide par des techniques recombinantes d'ADN. L'invention concerne en outre les applications de ce polypeptide dans le traitement de maladies, notamment des tumeurs malignes, de l'hémopathie, de l'infection par VIH, de maladies immunitaires et de diverses inflammations. L'invention concerne aussi l'antagoniste agissant contre le polypeptide et son action thérapeutique ainsi que les applications de ce polynucléotide codant pour la protéine humaine de réparation 15 du mésappariement de l'ADN.
PCT/CN2001/000356 2000-03-22 2001-03-19 Nouveau polypeptide, proteine humaine de reparation 15 du mesappariement de l'adn, et polynucleotide codant pour ce polypeptide WO2001070958A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU50255/01A AU5025501A (en) 2000-03-22 2001-03-19 A novel polypeptide, a human dna mismatch repair protein 15 and the polynucleotide encoding the polypeptide

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN00115043.X 2000-03-22
CN 00115043 CN1314396A (zh) 2000-03-22 2000-03-22 一种新的多肽——人dna错配修复蛋白15和编码这种多肽的多核苷酸

Publications (1)

Publication Number Publication Date
WO2001070958A1 true WO2001070958A1 (fr) 2001-09-27

Family

ID=4584514

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2001/000356 WO2001070958A1 (fr) 2000-03-22 2001-03-19 Nouveau polypeptide, proteine humaine de reparation 15 du mesappariement de l'adn, et polynucleotide codant pour ce polypeptide

Country Status (3)

Country Link
CN (1) CN1314396A (fr)
AU (1) AU5025501A (fr)
WO (1) WO2001070958A1 (fr)

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
DATABASE GENBANK [online] 10 January 2000 (2000-01-10), Database accession no. U91322 *
DATABASE GENBANK [online] 15 November 1998 (1998-11-15), Database accession no. AC005829 *
DATABASE GENBANK [online] 29 August 1998 (1998-08-29), Database accession no. AC005358 *
DATABASE GENBANK [online] 7 April 1999 (1999-04-07), Database accession no. AC006064 *

Also Published As

Publication number Publication date
AU5025501A (en) 2001-10-03
CN1314396A (zh) 2001-09-26

Similar Documents

Publication Publication Date Title
WO2001072812A1 (fr) Nouveau polypeptide, bromodomaine humain 10, et polynucleotide codant pour ce polypeptide
WO2001074879A1 (fr) Nouveau polypeptide, proteine ribosomale humaine s3-12, et polynucleotide codant pour ce polypeptide
WO2001083538A1 (fr) Nouveau polypeptide, proteine humaine 36 du gene k-ras, et polynucleotide codant pour ce polypeptide
WO2001070958A1 (fr) Nouveau polypeptide, proteine humaine de reparation 15 du mesappariement de l'adn, et polynucleotide codant pour ce polypeptide
WO2001070956A1 (fr) Nouveau polypeptide, proteine humaine de reparation 8 du mesappariement de l'adn, et polynucleotide codant pour ce polypeptide
WO2001070965A1 (fr) Nouveau polypeptide, facteur humain de regulation de la transcription 15, et polynucleotide codant pour ce polypeptide
WO2001075048A2 (fr) Nouveau polypeptide, proteine ribosomale humaine s11 23, et polynucleotide codant pour ce polypeptide
WO2001047975A1 (fr) Nouveau polypeptide, proteine 10 contenant un domaine chromo, et polynucleotide codant pour ce polypeptide
WO2001079432A2 (fr) Nouveau polypeptide, facteur humain de transcription de la differentiation cellulaire 58, et polynucleotide codant pour ce polypeptide
WO2001072801A1 (fr) Nouveau polypeptide, proteine ribosomale humaine s11 12, et polynucleotide codant pour ce polypeptide
WO2001081594A1 (fr) Nouveau polypeptide, proteine pax humaine 17, et polynucleotide codant pour ce polypeptide
WO2001075101A1 (fr) Nouveau polypeptide, proteine humaine de regulation de la transcription 8, et polynucleotide codant pour ce polypeptide
WO2001079428A2 (fr) Nouveau polypeptide, proteine humaine de reparation 8.9 du mesappariement de l'adn, et polynucleotide codant pour ce polypeptide
WO2001075100A1 (fr) Nouveau polypeptide, proteine humaine de reparation 10 du mesappariement de l'adn, et polynucleotide codant pour ce polypeptide
WO2001074873A1 (fr) Nouveau polypeptide, proteine humaine de reparation 9 du mesappariement de l'adn, et polynucleotide codant pour ce polypeptide
WO2001075018A2 (fr) Nouveau polypeptide, facteur humain de regulation de la transcription 31, et polynucleotide codant pour ce polypeptide
WO2001070957A1 (fr) Nouveau polypeptide, proteine humaine de reparation 9.4 du mesappariement de l'adn, et polynucleotide codant pour ce polypeptide
WO2001074874A1 (fr) Nouveau polypeptide, facteur humain de regulation de la transcription 54, et polynucleotide codant pour ce polypeptide
WO2001087968A1 (fr) Proteine s4-36 ribosomale, polypeptide humain, et polynucleotide la codant
WO2001055419A1 (fr) Nouveau polypeptide, site de liaison 27 d'arn s1, et polynucleotide codant pour ce polypeptide
WO2001070803A1 (fr) Nouveau polypeptide, proteine humaine de regulation de la transcription 9.7, et polynucleotide codant pour ce polypeptide
WO2001079437A2 (fr) Nouveau polypeptide, facteur humain de transcription de la differentiation cellulaire 14, et polynucleotide codant pour ce polypeptide
WO2001070784A1 (fr) Nouveau polypeptide, proteine humaine 17 contenant un domaine de structure chromo, et polynucleotide codant pour ce polypeptide
WO2001088147A1 (fr) Polypeptide de tyrosine kinase 14 humaine et polynucleotide le codant
WO2001081399A1 (fr) Nouveau polypeptide, proteine pax humaine 14, et polynucleotide codant pour ce polypeptide

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP