WO2001074874A1 - Nouveau polypeptide, facteur humain de regulation de la transcription 54, et polynucleotide codant pour ce polypeptide - Google Patents

Nouveau polypeptide, facteur humain de regulation de la transcription 54, et polynucleotide codant pour ce polypeptide Download PDF

Info

Publication number
WO2001074874A1
WO2001074874A1 PCT/CN2001/000345 CN0100345W WO0174874A1 WO 2001074874 A1 WO2001074874 A1 WO 2001074874A1 CN 0100345 W CN0100345 W CN 0100345W WO 0174874 A1 WO0174874 A1 WO 0174874A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
polynucleotide
transcription factor
sequence
regulatory transcription
Prior art date
Application number
PCT/CN2001/000345
Other languages
English (en)
Chinese (zh)
Inventor
Yumin Mao
Yi Xie
Original Assignee
Biowindow Gene Development Inc. Shanghai
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Biowindow Gene Development Inc. Shanghai filed Critical Biowindow Gene Development Inc. Shanghai
Priority to AU48235/01A priority Critical patent/AU4823501A/en
Publication of WO2001074874A1 publication Critical patent/WO2001074874A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/4702—Regulators; Modulating activity
    • C07K14/4705—Regulators; Modulating activity stimulating, promoting or activating activity
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • the present invention belongs to the field of biotechnology. Specifically, the present invention describes a novel polypeptide-to-human regulatory transcription factor 54 and a polynucleotide sequence encoding the polypeptide. The invention also relates to a method and application for preparing the polynucleotide and polypeptide. Background technique
  • Pax is a family of genes.
  • the proteins encoded by Pax genes play the role of transcription factors during cell differentiation and embryonic development, and such genes are highly conserved in spinal thrusters and lower organisms.
  • the Pax gene is characterized by a paired box domain (Paired Box doma in), which encodes a protein domain to help identify specific DNA sequences.
  • the paired box domain has DM-binding activity and has an a lpha helix at its amino terminus, which is of great significance for its binding to DM. (Genes Dev 1991 Apr; 5 (4): 594-604)
  • the paired box domain is composed of 124 amino acid residues and is found in many proteins in many organisms, including the mammalian PAX protein family. Although the function of the paired box functional domain is not clear at present, it is mostly located at the N-terminus of proteins such as PAX, which has extremely important regulatory significance for the normal function of PAX proteins.
  • paired box domains contain a conserved region that contains the following consistent sequence fragments: RP- C- x (ll)-CV- S, which is contained in PAX proteins in many different organisms This structural motif plays a very important role in the process of the protein's normal physiological function.
  • PAX protein can bind to DNA, which depends on the paired box domain (Pa i red Box doma in) having DNA binding activity. Pax gene expression plays an important role in the development of organisms.
  • Pax gene is also present in human tumor tissue, and experimental results in vivo and in vitro have demonstrated that Pax gene is a possible oncogene.
  • PAX-3 and PAX-6 are related to the occurrence and treatment of Waardenburg syndrome .
  • the human regulatory transcription factor 54 protein plays an important role in regulating important functions of the body such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes, so there has been a need in the art to identify more involved in these processes.
  • Human regulatory transcription factor 54 protein particularly the amino acid sequence of this protein is identified. Isolation of the novel gene encoding the transcription factor 54 protein also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so it is important to isolate its coding DNA. Disclosure of invention
  • Another object of the invention is to provide a polynucleotide encoding the polypeptide.
  • Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding a human regulatory transcription factor 54.
  • Another object of the present invention is to provide a method for producing human regulatory transcription factor 54.
  • Another object of the present invention is to provide an antibody against the polypeptide of the present invention, which regulates transcription factor 54 in humans.
  • Another object of the present invention is to provide mimetic compounds, antagonists, agonists, and inhibitors directed to the polypeptide of the present invention, one to regulate transcription factor 54.
  • Another object of the present invention is to provide a method for diagnosing and treating diseases associated with abnormalities in human regulatory transcription factor 54.
  • the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
  • the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
  • sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 187-1659 in SEQ ID NO: 1; and (b) a sequence having 1-1753 in SEQ ID NO: 1 Sequence of bits.
  • the present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
  • the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
  • the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of human regulating transcription factor 54 protein, which comprises utilizing the polypeptide of the invention.
  • the invention also relates to compounds obtained by this method.
  • the invention also relates to a method for detecting a disease or disease susceptibility related to abnormal expression of a human regulatory transcription factor 54 protein in vitro, which comprises detecting a mutation in the polypeptide or a polynucleotide sequence encoding the same in a biological sample, or detecting a biological sample.
  • the amount or biological activity of a polypeptide of the invention comprises detecting a mutation in the polypeptide or a polynucleotide sequence encoding the same in a biological sample, or detecting a biological sample.
  • the invention also relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
  • the present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention in the preparation of a medicament for treating cancer, developmental disease or immune disease or other diseases caused by abnormal expression of human regulatory transcription factor 54.
  • Nucleic acid sequence refers to oligonucleotides, nucleotides or polynucleotides and fragments or parts thereof, and may also refer to the genome or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
  • amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
  • amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
  • a protein or polynucleotide “variant” refers to an amino acid sequence having one or more amino acids or nucleotide changes, or a polynucleotide sequence encoding it. The changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence. Variants can have "conservative" changes, in which the substituted amino acid has a structural or chemical property similar to the original amino acid, such as the replacement of Leucine. Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
  • “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
  • “Weng” or “addition” refers to an alteration in the amino acid sequence or nucleotide sequence that results in an increase in one or more amino acids or nucleotides compared to a naturally occurring molecule. “Replacement” refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
  • Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
  • immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response in appropriate animals or cells and to bind to specific antibodies.
  • An "agonist” refers to a molecule that, when combined with human regulatory transcription factor 54, can cause changes in the protein and thereby regulate the activity of the protein.
  • An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that binds human regulatory transcription factor 54.
  • Antagonist refers to a molecule that, when combined with human regulatory transcription factor 54, can block or regulate the biological or immunological activity of human regulatory transcription factor 54.
  • Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates, or any other molecule that binds human regulatory transcription factor 54.
  • Regular refers to a change in the function of human regulatory transcription factor 54, including an increase or decrease in protein activity, a change in binding characteristics, and any other biological, functional, or immune changes in human regulatory transcription factor 54.
  • Those skilled in the art can purify human regulatory transcription factor 54 using standard protein purification techniques. Essentially pure The human regulatory transcription factor 54 can generate a single main band on a non-reducing polyacrylamide gel. The purity of the human regulatory transcription factor 54 polypeptide can be analyzed by amino acid sequence.
  • Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
  • sequence C-T-G-A
  • complementary sequence G-A-C-T.
  • the complementarity between two single-stranded molecules may be partial or complete.
  • the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
  • “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
  • Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. The inhibition of such hybridization can be detected by performing hybridization (Southern blotting or Nor thern blotting, etc.) under conditions of reduced stringency.
  • Substantially homologous sequences or hybridization probes can compete and inhibit the binding of completely homologous sequences to the target sequence under conditions of reduced stringency. This does not mean strict Conditions with reduced sex allow non-specific binding because conditions with reduced stringency require that the two sequences bind to each other as a specific or selective interaction.
  • Percent identity refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALIGN program (Lasergene sof tware package, DNASTAR, Inc., Madi son Wis.). The MEGALIGN program can compare two or more sequences based on different methods such as the Clus ter method (Higgins, DG and PM Sharp (1988) Gene 73: 237-244). 0 The C lus ter method compares each pair by checking the distance between all pairs. Group sequences are arranged in clusters. The clusters are then assigned in pairs or groups.
  • the percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula: The number of matching residues between sequence A and sequence X 100 The number of residues in sequence A-the number of spacer residues in sequence A The number of spacer residues in a sequence B can also be determined by Clus ter method or using methods known in the art such as Jotun Hein. The percent identity between nucleic acid sequences (He in J., (1990) Methods in emzumo l ogy 183: 625 -645) 0
  • Similarity refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
  • Amino acids used for conservative substitutions for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
  • Antisense refers to a nucleotide sequence that is complementary to a particular MA or RM sequence.
  • Antisense strand refers to a nucleic acid strand that is complementary to a “sense strand.”
  • Derivative refers to a chemical modification of HFP or a nucleic acid encoding it. This chemical modification may be a substitution of a hydrogen atom with a fluorenyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
  • Antibody refers to a complete antibody molecule and its fragments, such as Fa,? ( ⁇ ,) 2 and? ⁇ It can specifically bind to the epitope of human regulatory transcription factor 54.
  • a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
  • isolated refers to the removal of a substance from its original environment (for example, its natural environment if it occurs naturally).
  • a naturally occurring polynucleotide or polypeptide exists in a living animal. It is not isolated, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
  • Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not a component of its natural environment, they are still isolated.
  • isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
  • polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances in the natural state .
  • isolated human regulatory transcription factor 54 means that human regulatory transcription factor 54 is substantially free of other proteins, lipids, sugars, or other substances with which it is naturally associated. Those skilled in the art can purify human regulatory transcription factor 54 using standard protein purification techniques. Substantially pure peptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of the human regulatory transcription factor 54 polypeptide can be analyzed by amino acid sequences.
  • the present invention provides a novel polypeptide-to-human transcription factor 54, which basically consists of the amino acid sequence shown in SEQ ID NO: 2.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
  • the polypeptides of the invention can be naturally purified products, or chemically synthesized products, or produced using recombinant techniques from prokaryotic or eukaryotic hosts (e.g., bacteria, yeast, higher plants, insects, and mammalian cells). Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
  • the invention also includes fragments, derivatives and analogs of human regulatory transcription factor 54.
  • fragment refers to a polypeptide that substantially maintains the same biological function or activity of the human regulatory transcription factor 54 of the present invention.
  • a fragment, derivative or analog of the polypeptide of the present invention may be: U) a type in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substituted
  • the amino acid may or may not be encoded by the genetic code; or (II) such a type in which a group on one or more amino acid residues is replaced by another group to include a substituent; or ( ⁇ ⁇ ) such A type in which a mature polypeptide is fused to another compound (such as a compound that extends the half-life of a polypeptide, such as polyethylene glycol); or (IV) a type of polypeptide sequence in which an additional amino acid sequence is fused into a mature polypeptide (such as the leader sequence or secreted sequence or the sequence used to purify this polypeptide or protease sequence)
  • an additional amino acid sequence is fused into a mature polypeptide (such as the leader sequence or secreted sequence or the sequence used to purify this
  • the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of an amino acid encoding SEQ ID NO: 2 Polynucleotide composition of a polypeptide of the amino acid sequence.
  • the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
  • the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a polynucleotide sequence of 1753 bases in length and its open reading frame 187-1659 encodes 490 amino acids. According to the comparison of gene chip expression profiles, it was found that this polypeptide has a similar expression profile to human Pax protein 12, and it can be deduced that the human regulatory transcription factor 54 has a similar function to human Pax protein 12.
  • the polynucleotide of the present invention may be in the form of DNA or MA.
  • DNA forms include cDM, genomic DM, or synthetic DM.
  • MA can be single-stranded or double-stranded.
  • DNA can be coding or non-coding.
  • the coding region sequence encoding the mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
  • a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 in the present invention, but which differs from the coding region sequence shown in SEQ ID NO: 1.
  • the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
  • polynucleotide encoding a polypeptide refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.
  • the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
  • Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
  • an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
  • the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity, between the two sequences).
  • the present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions.
  • “strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.11 ⁇ 2SDS, 60 ° C; or (2) during hybridization Add denaturants, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% F icol l, 42 ° C, etc .; or (3) the same between the two sequences Crosses occur only when the sex is at least 95%, and more preferably 97%.
  • the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
  • nucleic acid fragments that hybridize to the sequences described above.
  • a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, preferably at least 100 nucleotides.
  • Nucleic acid fragments can also be used in nucleic acid amplification techniques, such as PCR, to identify and / or isolate polynucleotides encoding human regulatory transcription factor 54.
  • polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
  • the specific polynucleotide sequence encoding the human regulatory transcription factor 54 of the present invention can be obtained by various methods.
  • polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
  • the DM fragment sequence of the present invention can also be obtained by the following methods: 1) separating the double-stranded DM sequence from the DM of the genome; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.
  • genomic DM is the least commonly used. Direct chemical synthesis of DM sequences is often the method of choice. The more commonly used method is the separation of the CDM sequences.
  • the standard method for isolating the cDNA of interest is to isolate mRM from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library. There are many mature techniques for raRNA extraction, and kits are also commercially available (Qiagene).
  • CDNA library is constructed in a conventional method (Sambrook, et a l., Mol ecular Cl oning, A Labora tory Manua l, Cold Spr ing Harbor Labora tory. New York, 1989) 0 commercially available cDNA library may also be obtained, such as Different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
  • genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DM-DNA or DNA-RNA hybrids; (2) the presence or absence of marker gene functions; (3) determining the level of transcripts of human regulatory transcription factor 54; (4) Detection of gene-expressed protein products by immunological techniques or determination of biological activity. The above methods can be used singly or in combination.
  • the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
  • the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
  • the probe used here is generally a DNA sequence chemically synthesized based on the gene sequence information of the present invention.
  • the genes or fragments of the present invention can of course be used as probes.
  • DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
  • immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (BLISA) can be used to detect protein products that regulate human transcription factor 54 gene expression.
  • BLISA enzyme-linked immunosorbent assay
  • the RACE method RACE-rapid amplification of cDNA ends
  • the primers can be appropriately selected based on the polynucleotide sequence information of the present invention disclosed herein, and can be synthesized by conventional methods.
  • the amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
  • polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, the sequencing must be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence. .
  • the present invention also relates to a vector comprising a polynucleotide of the present invention, and a host cell genetically engineered using the vector of the present invention or directly using a human regulatory transcription factor 54 coding sequence, and a method for producing a polypeptide of the present invention by recombinant technology.
  • a polynucleotide sequence encoding the human regulatory transcription factor 54 can be inserted into a vector to form a recombinant vector containing the polynucleotide of the present invention.
  • vector refers to bacterial plasmids, bacteriophages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses or other vectors well known in the art.
  • Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al.
  • any plasmid and vector can be used to construct a recombinant expression vector.
  • An important feature of expression vectors is that they usually contain origins of replication, promoters, marker genes, and translational regulatory elements.
  • DM sequences encoding human regulatory transcription factor 54 and appropriate transcription / translation regulatory elements can be used to construct expression vectors containing DM sequences encoding human regulatory transcription factor 54 and appropriate transcription / translation regulatory elements. These methods include in vitro recombinant DNA technology, DM synthesis technology, in vivo recombination technology, etc. (Sambroook, et al. Mol ecular Cloni ng, a Labora tory Manua l, cold Spin Harbor Labora tory. New York, 1989).
  • the DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide inRM synthesis. Representative examples of these promoters are: the lac or trp promoter of E.
  • the expression vector also includes a ribosome binding site and a transcription terminator for translation initiation. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Examples include 100 to 270 base pair SV40 enhancers on the late side of the origin of replication, polyoma enhancers on the late side of the origin of replication, and adenopathy Toxic enhancer and so on.
  • the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • GFP fluorescent protein
  • tetracycline or ampicillin resistance for E. coli.
  • a polynucleotide encoding a human regulatory transcription factor 54 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a genetically engineered host cell containing the polynucleotide or the recombinant vector.
  • the term "host cell” refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E.
  • coli Streptomyces
  • bacterial cells such as Salmonella typhimurium
  • fungal cells such as yeast
  • plant cells such as fly S2 or Sf 9
  • animal cells such as CH0, COS or Bowes melanoma cells.
  • Transformation of a host cell with a DNA sequence according to the present invention or a recombinant vector containing the DM sequence can be performed using conventional techniques well known to those skilled in the art.
  • the host is a prokaryote such as E. coli
  • competent cells capable of absorbing DNA can be harvested after the exponential growth phase and treated with the 01 12 method, the steps used are well known in the art.
  • MgCl 2 is used.
  • transformation can also be performed by electroporation.
  • the host is a eukaryotic organism, the following DM transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
  • polynucleotide sequence of the present invention can be used to express or produce recombinant human regulatory transcription factor 54 (Scence, 1984; 224: 1431). Generally there are the following steps:
  • the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
  • a suitable method such as temperature conversion or chemical induction
  • the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell.
  • recombinant proteins can be isolated and purified by various separation methods using their physical, chemical, and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic bacteria, Ultrasonication, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
  • conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic bacteria, Ultrasonication, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, high performance liquid chromat
  • FIG. 1 is a comparison diagram of gene chip expression profiles of the inventors' regulatory transcription factor 54 and human Pax protein 12.
  • FIG. The upper graph is a graph of the expression profile of human regulatory transcription factor 54, and the lower graph is the graph of the expression profile of human Pax protein 12.
  • 1 indicates fetal kidney
  • 2 indicates fetal large intestine
  • 3 indicates fetal small intestine
  • 4 indicates fetal muscle
  • 5 indicates fetal brain
  • 6 indicates fetal bladder
  • 7 indicates non-starved L02
  • 8 indicates L02 +, lhr, As 3+
  • 9 indicates ECV304 PMA-
  • 10 means ECV304 PMA +
  • 11 means fetal liver
  • 12 means normal liver
  • 13 means thyroid
  • 14 means skin
  • 15 means fetal lung
  • 16 means lung
  • 17 means lung cancer
  • 18 means fetal spleen
  • 19 means spleen
  • 20 Indicates the prostate
  • 21 indicates the fetal heart
  • 22 indicates the heart
  • 23 indicates muscle
  • 24 indicates testes
  • 25 indicates fetal thymus
  • 26 indicates thymus.
  • Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of the isolated human regulatory transcription factor 54.
  • 54KDa is the molecular weight of the protein.
  • the arrow indicates the isolated protein band.
  • the determined cDNA sequence was compared with an existing public DMA sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 0864ell was new DNA. Insert a CDM fragment into the clone by synthesizing a series of primers Perform a two-way measurement. The results show that the 0864ell clone contains a full-length cDNA of 1753bp (as shown in Seq ID NO: 1), and a 1473bp open reading frame (0RF) from 187bp to 1659bp, encoding a new protein (such as Seq ID NO : Shown in 2). We named this clone pBS-0864ell and the encoded protein was named human regulatory transcription factor 54.
  • Example 2 Cloning of a gene encoding human regulatory transcription factor 54 by RT-PCR
  • CDNA was synthesized using fetal brain total A as a template and ol igo-dT as a primer for reverse transcription reaction. After purification with Qiagene's kit, the following primers were used for PCR amplification:
  • Pr imerl 5, — ACGGCTGCGAGAAGACGAGCTTAG -3 '(SEQ ID NO: 3)
  • Pr imer2 5'- GGCTAGAGGGCTCATATGGAGATC -3 '(SEQ ID NO: 4)
  • Primerl is a forward sequence located at the 5th end of SEQ ID NO: 1, starting at lbp;
  • Primer2 is the 3 'end reverse sequence in SEQ ID NO: 1.
  • Amplification conditions 50 mmol / L KCl '10 ⁇ l / L Tris-CI, (pH 8.5.5), 1.5 mmol / L MgCl 2 , 200 ⁇ mol / L dNTP, l Opmol primer, 1U Taq DNA polymerase (Clontech).
  • the reaction was performed on a PE9600 DM thermal cycler (Perkin-Elmer) for 25 cycles under the following conditions: 94. C 30sec; 55 ° C 30sec; 72 ° C 2min.
  • ⁇ -act in was set as a positive control and template blank was set as a negative control.
  • the amplified product was purified using a QIAGEN kit and ligated to a pCR vector (Invitrogen) using a TA cloning kit.
  • the DNA sequence analysis results showed that the DM sequence of the PCR product was exactly the same as that of 1 to 1753bp shown in SEQ ID NO: 1.
  • Example 3 Northern blot analysis of human regulatory transcription factor 54 gene expression:
  • Electrophoresis was performed on a 1.2 agarose gel containing 2 g of RNA on 20 mM 3- (N-morphine) propanesulfonic acid (pH 7.0)-5 mM sodium acetate-1 mM EDTA-2. 2M formaldehyde. Then transfer to a nitrocellulose membrane.
  • a 32 P-dATP was used to prepare a 32 P-labeled DNA probe by a random primer method.
  • the DNA probe used encodes the PCR-regulated human regulatory transcription factor 54 shown in FIG. 1 Region sequence (187bp to 1659bp).
  • 32P-labeled probe (about 2 x 10 6 cpm / ml) was hybridized with a nitrocellulose membrane to which RNA was transferred in a solution at 42 ° C overnight, the solution contained 50% Formamide-25mM KH 2 P0 4 (pH7. 4) -5 SSC-5 ⁇ Denhardt's solution and 200 g / ml salmon sperm DNA. After hybridization, the filter was placed in 1 x SSC- 0.1% SDS in 5 5 ° C Wash for 30min. Then, Phosphor Imager was used for analysis and quantification.
  • Example 4 In vitro expression, isolation and purification of recombinant human regulatory transcription factor 54
  • Primer3 5,-CATGCTAGCATGGAGCTTGACAGCGCTCTGGAA -3, (Seq ID No: 5)
  • Primer4 5'- CCCAAGCTTTTACATAAGGATAATGAGGCCCAA -3 '(Seq ID No: 6)
  • the 5' ends of these two primers contain Nhel and Hindl ll digestion sites, respectively , followeded by the coding sequences of the 5 'and 3' ends of the gene of interest, respectively, and the Nhel and Hindl ll restriction sites correspond to the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865. 3) Selective endonuclease site.
  • the pBS-0864ell plasmid containing the full-length target gene was used as a template for the PCR reaction.
  • the PCR reaction conditions were as follows: a total volume of 50 ⁇ 1 containing 10 pg of pBS-0864ell plasmid, primers Primer-3 and Primer-4 were 1 Opmol, Advantage polymerase Mix (Clontech) 1 ⁇ 1, respectively. Cycle parameters: 94. C 20s, 60 ° C 30s, 68 ° C 2 min, a total of 25 cycles. Nhel and Hindll l were used to double digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase.
  • the ligation product was transformed into E. coli DH5a by the calcium chloride method, and cultured overnight on LB plates containing kanamycin (final concentration 30 g / ml). Positive clones were selected by colony PCR method and sequenced. A positive clone (pET-0864ell) with the correct sequence was selected, and the recombinant plasmid was transformed into E. coli BL21 (DE3) plySs (product of Novagen) using the calcium chloride method. In containing kanamycin (final concentration ⁇ ⁇ g / ml) of LB liquid medium, host strain BL21 (P ET-0864el l) at 37. C.
  • the following peptides specific for human regulatory transcription factor 54 were synthesized using a peptide synthesizer (product of PB): NH2-Met-Glu-Leu-Asp-Ser-Ala-Leu-Glu-Ala-Pro-Ser-Gln-Glu- Asp-Ser-C00H (SEQ ID NO: 7).
  • the peptide was coupled to hemocyanin and bovine serum albumin to form a complex. For the method, see: Avrameas, et al.
  • the suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in various aspects.
  • the probes can be used to hybridize to the genome or CDM library of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
  • the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
  • the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method.
  • Filter hybridization methods include dot blotting, Southern imprinting, Northern blotting, and copying methods. They all use the same steps to immobilize the polynucleotide sample to be tested on the filter.
  • the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer to saturate the non-specific binding site of the sample on the filter with the carrier and the synthesized polymer.
  • the pre-hybridization solution is then replaced with a hybridization buffer containing labeled probes and incubated to hybridize the probes to the target nucleic acid.
  • the unhybridized probes are removed by a series of membrane washing steps.
  • This embodiment uses higher-intensity washing conditions (such as lower salt concentration and higher temperature), so that the hybridization background is reduced and only strong specific signals are retained.
  • the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
  • the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
  • the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
  • oligonucleotide fragments for use as hybridization probes from the polynucleotide SEQ ID NO: 1 of the present invention should follow the following principles and several aspects to be considered:
  • the preferred range of probe size is 18-50 nucleotides
  • the GC content is 301 ⁇ 2-70%, and the non-specific hybridization increases when it exceeds;
  • the primary probe is compared with its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complementary regions. If the homology with the non-target molecular region is greater than 85% or more than 15 consecutive bases are exactly the same, the primary probe should not be used in general;
  • Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
  • Probe 2 (probe2), which belongs to the second type of probe, is equivalent to the replacement mutant sequence of the gene fragment of SEQ ID NO: 1 or its complementary fragment (41Nt):
  • PBS phosphate buffered saline
  • step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
  • NC membrane nitrocellulose membrane
  • the 32 P-Probe (the second peak is free ⁇ - 32 P-dATP) is prepared.
  • the sample membrane was placed in a plastic bag and 3-10 mg of prehybridization solution (10xDenhardt's; 6xSSC, 0.1 mg / ml
  • CT DNA (calf thymus DNA).
  • probe 1 can be used to qualitatively and quantitatively analyze the presence and differential expression of the polynucleotide of the present invention in different tissues.
  • Gene chip or DNA microarray is a new technology that many national laboratories and large pharmaceutical companies are currently developing and developing. It refers to the orderly and high-density arrangement of a large number of target gene fragments on glass, The data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software to achieve the purpose of fast, efficient, and high-throughput analysis of biological information.
  • the polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research of new gene functions; search for and screen new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases .
  • the specific method steps have been reported in the literature. For example, refer to the literature DeRi si, JL, Lyer, V. & Brown, P. 0. (1997) Science 278, 680-686. And the literature Hel le, RA, Schema, M., Chai, A., Shalom, D., (1997) PNAS 94: 2150-2155
  • a total of 4,000 polynucleotide sequences of various full-length cDNAs are used as target DNA, including the polynucleotide of the present invention. They were amplified by PCR respectively. After purification, the concentration of the amplified product was adjusted to about 500 ng / ul, and spotted on a glass medium with a Cartesian 7500 spotter (purchased from Cartesian Company, USA). The distance between them is 280 ⁇ m. The spotted slides were hydrated, dried, and cross-linked in a UV cross-linking instrument. After elution, the DNA was fixed on the glass slide to prepare a chip. The specific method steps are variously reported in the literature. The sample post-processing steps in this embodiment are:
  • Total mRNA was extracted from human mixed tissues and specific tissues (or stimulated cell lines) in one step, and tnRNA was purified by Ol igotex mRNA Midi Ki t (purchased from QiaGen).
  • Section Cy3dUTP (5-Amino-propargyl-2'-deoxyuridine 5 '-tr iphate coupled to C 3 f luorescent dye, purchased from Amershara Phamacia Biotech) was used to label m A of human mixed tissue, and the fluorescent reagent Cy5dUTP (5 — Amino- propargy bu 2'-deoxyuridine 5 '-triphate coupled to C 5 f luorescent dye, purchased from Amersham Phamacia Biotech Company, labeled the specific tissue (or stimulated cell line) mRNA of the body, and purified the probe to prepare a probe.
  • Cy3dUTP 5-Amino-propargyl-2'-deoxyuridine 5 '-tr ip
  • the probes from the two types of tissues were hybridized with the chip in a UniHyb TM Hybridization Solution (purchased from TeleChera) hybridization solution for 16 hours, and washed with a washing solution (lx SSC, 0.2% SDS) at room temperature. Scanning was then performed with a ScanArray 3000 scanner (purchased from General Scanning, USA). The scanned images were analyzed and processed with Imagene software (Biodiscovery, USA) to calculate the Cy3 / Cy5 ratio of each point.
  • the above specific tissues are thymus, testis, muscle, spleen, lung, skin, thyroid, liver, PMA + Ecv304 cell line, PMA-Ecv304 cell line, non-starved L02 cell line, L02 cell line stimulated by arsenic for 1 hour, L02 cell line stimulated by arsenic for 6 hours prostate, heart, lung cancer, fetal bladder, fetal small intestine, fetal large intestine, fetal thymus, fetal muscle, fetal liver, fetal kidney, fetal spleen, fetal brain, Fetal lung and fetal heart.
  • polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat malignant tumors, adrenal deficiency, skin diseases, various inflammations, HIV infections and immune diseases.
  • Pax is a family of genes.
  • the proteins encoded by Pax genes act as transcription factors during cell differentiation and embryonic development.
  • the specific paired box domains on Pax genes encode a protein domain that helps identify specific DNA sequences . Paired box domains are found in many proteins in many organisms, mainly in the PAX protein family in mammals.
  • Pax gene expression plays an important role in the development of organisms. Recent studies have also shown that Pax gene is also present in human tumor tissue, and experimental results in vivo and in vitro have demonstrated that Pax gene is a possible oncogene. (Adv Cl in Path 1997 Oct; 1 (4): 243-255). Some studies have also shown that the expression of Pax gene is extremely important for regulating the early formation of organisms. (Cancer Res 1999 Apr 1; 59 (7 Suppl): 1707s-1710s). In addition, studies have shown that PAX-3 and PAX-6 are related to the occurrence and treatment of Waardenburg syndrome. (Nat Genet 1993 Apr; 3 (4): 292-8)
  • abnormal expression of the polypeptide containing the paired box domain sequence will make the Pax protein family dysfunctional, and may cause embryonic development disorders, growth disorders, tumors, and Waardenburg's syndrome.
  • Waardenburg's syndrome embryonic developmental disorders, growth disorders, tumors, these diseases include but are not limited to:
  • Fetal developmental disorders congenital abortion, cleft palate, facial oblique fissure, limb absentness, limb differentiation disorder, gastrointestinal atresia or stenosis, hyaline membrane disease, pulmonary insufficiency, polycystic kidney disease, ectopic kidney, double ureter, crypto, Congenital inguinal hernia, double uterus, vaginal atresia, hypospadias, hermaphroditism, atrial septal defect, ventricular septal defect, pulmonary stenosis, arterial duct occlusion, neural tube defect, congenital hydrocephalus, iris defect, congenital cataract , Congenital glaucoma or cataract, congenital deafness
  • Tumors of various tissues gastric cancer, liver cancer, lung cancer, esophageal cancer, breast cancer, leukemia, lymphoma, thyroid tumor, uterine fibroids, neuroblastoma, astrocytoma, ependymoma, glioblastoma, Colon cancer, malignant histiocytosis, melanoma, teratoma, sarcoma, adrenal cancer, bladder cancer, bone cancer, osteosarcoma, myeloma, bone marrow cancer, brain cancer, uterine cancer, endometrial cancer, gallbladder cancer, colon Cancer, thymic tumor, nasal cavity and sinus tumor, nasopharyngeal cancer, laryngeal cancer, tracheal tumor, pleural mesothelioma, fibroid, fibrosarcoma, lipoma, liposarcoma, leiomyoma
  • Growth and development disorders mental retardation, cerebral palsy, brain development disorders, mental retardation, familial cerebral nucleus dysplasia syndrome, strabismus, skin, fat and muscular dysplasia such as congenital skin laxity, premature aging Disease, congenital keratosis, various metabolic defects such as various amino acid metabolic defects, stunting, dwarfism, sexual retardation
  • Abnormal expression of the human-regulated transcription factor 54 of the present invention will also produce certain hereditary, hematological and immune system diseases.
  • the invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) human regulatory transcription factor 54.
  • Agonists enhance human regulatory transcription factor 54 to stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
  • mammalian cells or membrane preparations expressing human regulatory transcription factor 54 can be cultured with labeled human regulatory transcription factor 54 in the presence of drugs. The ability of the drug to increase or block this interaction is then determined.
  • Antagonists of human regulatory transcription factor 54 include antibodies, compounds, receptor deletions, and the like that have been screened. Antagonists of human regulatory transcription factor 54 can bind to human regulatory transcription factor 54 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide to prevent the polypeptide from developing. Play biological functions.
  • human regulatory transcription factor 54 When screening compounds that act as antagonists, human regulatory transcription factor 54 can be added to bioanalytical assays to determine whether a compound is an antagonist by measuring the effect of the compound on the interaction between human regulatory transcription factor 54 and its receptor. Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds. Polypeptide molecules capable of binding to human regulatory transcription factor 54 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. When screening, human regulatory transcription factor 54 molecules should generally be labeled.
  • the present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies.
  • the invention also provides antibodies against human regulatory transcription factor 54 epitopes. These antibodies include (but are not limited to): Doklon antibodies, monoclonal antibodies, chimeric antibodies, single-chain antibodies, Fab fragments, and fragments from Fab expression libraries.
  • Polyclonal antibodies can be produced by injecting human regulatory transcription factor 54 directly into immunized animals (such as rabbits, mice, rats, etc.).
  • immunized animals such as rabbits, mice, rats, etc.
  • adjuvants can be used to enhance the immune response, including but not limited to Freund's adjuvant.
  • Techniques for preparing monoclonal antibodies that regulate human transcription factor 54 include, but are not limited to, hybridoma technology (Kohl er and Miste in. Nature, 1975, 256: 495-497), triple tumor technology, human B-cell hybridoma Technology, EBV-hybridoma technology, etc.
  • the chimeric antibody variable region and a human constant region of non-human origin in combination produce the available prior art (Morr i son etal, PNAS, 1985, 81: 6851) 0 Ersi some production techniques of single chain antibodies (US Pa t No. 4946778) can also be used to produce single chain antibodies against human regulatory transcription factor 54.
  • Anti-human regulatory transcription factor 54 antibodies can be used in immunohistochemical techniques to detect human regulatory transcription factor 54 in biopsy specimens.
  • Monoclonal antibodies that bind to human regulatory transcription factor 54 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
  • Antibodies can also be used to design immunotoxins that target a particular part of the body.
  • humans can regulate transcription factor 54 with high affinity monoclonal antibodies that can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
  • a common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
  • This hybrid antibody can be used to kill human regulatory transcription factor 54 positive cells.
  • the antibodies in the present invention can be used to treat or prevent diseases related to human regulatory transcription factor 54.
  • Administration of appropriate doses of antibodies can stimulate or block the production or activity of human regulatory transcription factor 54.
  • the invention also relates to a diagnostic test method for quantitatively and locally detecting the level of human regulatory transcription factor 54. These tests are well known in the art and include FISH assays and radioimmunoassays.
  • the level of human regulatory transcription factor 54 detected in the test can be used to explain the importance of human regulatory transcription factor 54 in various diseases and to diagnose diseases in which human regulatory transcription factor 54 plays a role.
  • polypeptide of the present invention can also be used for peptide mapping analysis.
  • the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
  • Polynucleotides encoding human regulatory transcription factor 54 can also be used for a variety of therapeutic purposes. Gene therapy technology can be used to treat abnormal cell proliferation, development, or metabolism caused by the absence or abnormal / inactive expression of human regulatory transcription factor 54.
  • Recombinant gene therapy vectors (such as viral vectors) can be designed to express variant human regulatory transcription factor 54 to inhibit endogenous human regulatory transcription factor 54 activity.
  • a mutated human regulatory transcription factor 54 may be a shortened human regulatory transcription factor 54 that lacks a signaling domain, and although it can bind to downstream substrates, it lacks signaling activity. Therefore, recombinant gene therapy vectors can be used to treat diseases caused by abnormal regulation of transcription factor 54 expression or activity in humans.
  • Virus-derived expression vectors such as retroviruses, adenoviruses, adenovirus-associated viruses, herpes simplex virus, and parvoviruses can be used to transfer polynucleotides encoding human regulatory transcription factor 54 into cells.
  • Methods for constructing recombinant viral vectors carrying a polynucleotide encoding a human regulatory transcription factor 54 can be found in the literature (Sambrook, et al.).
  • a recombinant polynucleotide encoding human regulatory transcription factor 54 can be packaged into liposomes and transferred into cells.
  • Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
  • a vector such as a virus, phage, or plasmid
  • Oligonucleotides including antisense RNA and DNA
  • ribozymes that inhibit human transcription factor 54 mRNA are also within the scope of the present invention.
  • a ribozyme is an enzyme-like RNA molecule that specifically decomposes specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation.
  • Antisense RNA, DNA and ribozymes can be obtained using any of the existing RNA or DNA synthesis techniques. For example, solid-phase phosphoramidite chemical synthesis for the synthesis of oligonucleotides has been widely used.
  • Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA. This DNA sequence has been integrated downstream of the RNA polymerase promoter of the vector. In order to increase the stability of the nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the linkage between ribonucleosides using phosphorothioate or peptide bonds instead of phosphodiester bonds.
  • Polynucleotides encoding human regulatory transcription factor 54 are useful in diseases related to human regulatory transcription factor 54 Diagnosis of the disease.
  • the polynucleotide encoding human regulatory transcription factor 54 can be used to detect the expression of human regulatory transcription factor 54 or the abnormal expression of human regulatory transcription factor 54 in a disease state.
  • the DNA sequence encoding human regulatory transcription factor 54 can be used to hybridize biopsy specimens to determine the expression of human regulatory transcription factor 54.
  • Hybridization techniques include Southern blotting, Northern blotting, in situ hybridization, and the like. These techniques and methods are publicly available and mature, and related kits are commercially available.
  • polynucleotides of the present invention can be used as probes to be fixed on a microarray or a DNA chip (also referred to as a "gene chip") for analyzing differential expression analysis and gene diagnosis of genes in tissues.
  • Human-regulated transcription factor 54 specific primers can be used for RNA-polymerase chain reaction (RT-PCR) in vitro amplification to detect the transcription products of human-regulated transcription factor 54.
  • Human regulatory transcription factor 54 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to normal wild-type human regulatory transcription factor 54 DM sequences. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression. Therefore, Nor thern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
  • the sequences of the invention are also valuable for chromosome identification.
  • the sequence specifically targets a specific position on a human chromosome and can hybridize to it.
  • specific sites for each gene on the chromosome need to be identified.
  • only a few chromosome markers based on actual sequence data are available for marking chromosome positions.
  • an important first step is to locate these DNA sequences on a chromosome.
  • PCR primers (15-35bp) can be prepared from cDNA, which can be used to locate sequences on chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
  • PCR localization of somatic hybrid cells is a quick way to localize DM to specific chromosomes.
  • oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
  • Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.
  • Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step.
  • FISH Fluorescent in situ hybridization
  • the physical location of the sequence on the chromosome can be To correlate with genetic map data. These data can be found in, for example, V. Mckusick, Mendel i an Inher i tance in Man (available online with Johns Hopkins University Welch Medical Library). Linkage analysis can then be used to determine the relationship between genes and diseases that have been mapped to chromosomal regions.
  • the difference in cDNA or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).
  • the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
  • suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
  • the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
  • the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • these containers there may be instructional instructions given by government regulatory agencies that manufacture, use, or sell pharmaceutical or biological products, which prompts permission for administration on the human body by government agencies that manufacture, use, or sell.
  • the polypeptides of the invention can be used in combination with other therapeutic compounds.
  • the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
  • Human regulatory transcription factor 54 is administered in an amount effective to treat and / or prevent a specific indication.
  • the amount and dose range of human regulatory transcription factor 54 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Toxicology (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

L'invention concerne un nouveau polypeptide, un facteur humain de régulation de la transcription 54, et un polynucléotide codant pour ce polypeptide ainsi qu'un procédé d'obtention de ce polypeptide par des techniques recombinantes d'ADN. L'invention concerne en outre les applications de ce polypeptide dans le traitement de maladies, notamment des tumeurs malignes, de l'hémopathie, de l'infection par VIH, de maladies immunitaires et de diverses inflammations. L'invention concerne aussi l'antagoniste agissant contre le polypeptide et son action thérapeutique ainsi que les applications de ce polynucléotide codant pour le facteur humain de régulation de la transcription 54.
PCT/CN2001/000345 2000-03-22 2001-03-19 Nouveau polypeptide, facteur humain de regulation de la transcription 54, et polynucleotide codant pour ce polypeptide WO2001074874A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU48235/01A AU4823501A (en) 2000-03-22 2001-03-19 A novel polypeptide - homo regulatory transcription factor 54 and polynucleotideencoding said polypeptide

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN 00115055 CN1314405A (zh) 2000-03-22 2000-03-22 一种新的多肽——人调控转录因子54和编码这种多肽的多核苷酸
CN00115055.3 2000-03-22

Publications (1)

Publication Number Publication Date
WO2001074874A1 true WO2001074874A1 (fr) 2001-10-11

Family

ID=4584526

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2001/000345 WO2001074874A1 (fr) 2000-03-22 2001-03-19 Nouveau polypeptide, facteur humain de regulation de la transcription 54, et polynucleotide codant pour ce polypeptide

Country Status (3)

Country Link
CN (1) CN1314405A (fr)
AU (1) AU4823501A (fr)
WO (1) WO2001074874A1 (fr)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1995003326A1 (fr) * 1993-07-20 1995-02-02 The Regents Of The University Of California Regulation du facteur de transcription nf-il6/lap
WO2000006696A2 (fr) * 1998-07-30 2000-02-10 University Of South Florida Procede de modulation du fonctionnement de facteurs de transcription

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1995003326A1 (fr) * 1993-07-20 1995-02-02 The Regents Of The University Of California Regulation du facteur de transcription nf-il6/lap
WO2000006696A2 (fr) * 1998-07-30 2000-02-10 University Of South Florida Procede de modulation du fonctionnement de facteurs de transcription

Also Published As

Publication number Publication date
CN1314405A (zh) 2001-09-26
AU4823501A (en) 2001-10-15

Similar Documents

Publication Publication Date Title
WO2001083538A1 (fr) Nouveau polypeptide, proteine humaine 36 du gene k-ras, et polynucleotide codant pour ce polypeptide
WO2001088084A2 (fr) Nouveau polypeptide, superoxyde dismutase 11, et polynucleotide codant pour ce polypeptide
WO2001074874A1 (fr) Nouveau polypeptide, facteur humain de regulation de la transcription 54, et polynucleotide codant pour ce polypeptide
WO2001087949A1 (fr) Nouveau polypeptide, proteine pax humaine 9, et polynucleotide codant pour ce polypeptide
WO2001070965A1 (fr) Nouveau polypeptide, facteur humain de regulation de la transcription 15, et polynucleotide codant pour ce polypeptide
WO2001079432A2 (fr) Nouveau polypeptide, facteur humain de transcription de la differentiation cellulaire 58, et polynucleotide codant pour ce polypeptide
WO2001072796A1 (fr) Nouveau polypeptide, facteur humain de transcription de la differentiation cellulaire 11, et polynucleotide codant pour ce polypeptide
WO2001075101A1 (fr) Nouveau polypeptide, proteine humaine de regulation de la transcription 8, et polynucleotide codant pour ce polypeptide
WO2001083687A2 (fr) Nouveau polypeptide, proteine pax humaine 23, et polynucleotide codant pour ce polypeptide
WO2001081594A1 (fr) Nouveau polypeptide, proteine pax humaine 17, et polynucleotide codant pour ce polypeptide
WO2001094401A1 (fr) Nouveau polypeptide, proteine npat humaine 15, et polynucleotide codant pour ce polypeptide
WO2001075018A2 (fr) Nouveau polypeptide, facteur humain de regulation de la transcription 31, et polynucleotide codant pour ce polypeptide
WO2001075102A1 (fr) Nouveau polypeptide, proteine humaine de regulation de la transcription 13, et polynucleotide codant pour ce polypeptide
WO2001087959A1 (fr) Nouveau polypeptide, proteine pax humaine 11.9, et polynucleotide codant pour ce polypeptide
WO2001087962A1 (fr) Nouveau polypeptide, proteine pax humaine 11, et polynucleotide codant ce polypeptide
WO2001070803A1 (fr) Nouveau polypeptide, proteine humaine de regulation de la transcription 9.7, et polynucleotide codant pour ce polypeptide
WO2001083742A1 (fr) Nouveau polypeptide, proteine pax humaine 11.7, et polynucleotide codant pour ce polypeptide
WO2001074891A1 (fr) Nouveau polypeptide, proteine humaine de regulation de la transcription 17, et polynucleotide codant pour ce polypeptide
WO2001079437A2 (fr) Nouveau polypeptide, facteur humain de transcription de la differentiation cellulaire 14, et polynucleotide codant pour ce polypeptide
WO2001070959A1 (fr) Nouveau polypeptide, facteur humain 10 de regulation de la transcription, et polynucleotide codant pour ce polypeptide
WO2001074893A1 (fr) Nouveau polypeptide, proteine humaine de regulation de la transcription 11.8, et polynucleotide codant pour ce polypeptide
WO2001083544A1 (fr) Nouveau polypeptide, proteine pax humaine 18, et polynucleotide codant pour ce polypeptide
WO2001083682A2 (fr) Nouveau polypeptide, proteine pax humaine 11.6, et polynucleotide codant pour ce polypeptide
WO2001083683A2 (fr) Nouveau polypeptide, proteine pax humaine 11.3, et polynucleotide codant pour ce polypeptide
WO2001081399A1 (fr) Nouveau polypeptide, proteine pax humaine 14, et polynucleotide codant pour ce polypeptide

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP