WO2001075126A1 - Nouveau polypeptide, proteine ribosomale humaine s18-9, et polynucleotide codant pour ce polypeptide - Google Patents

Nouveau polypeptide, proteine ribosomale humaine s18-9, et polynucleotide codant pour ce polypeptide Download PDF

Info

Publication number
WO2001075126A1
WO2001075126A1 PCT/CN2001/000407 CN0100407W WO0175126A1 WO 2001075126 A1 WO2001075126 A1 WO 2001075126A1 CN 0100407 W CN0100407 W CN 0100407W WO 0175126 A1 WO0175126 A1 WO 0175126A1
Authority
WO
WIPO (PCT)
Prior art keywords
ribosomal protein
human ribosomal
polypeptide
polynucleotide
sequence
Prior art date
Application number
PCT/CN2001/000407
Other languages
English (en)
Chinese (zh)
Inventor
Yumin Mao
Yi Xie
Original Assignee
Shanghai Biowindow Gene Development Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shanghai Biowindow Gene Development Inc. filed Critical Shanghai Biowindow Gene Development Inc.
Priority to AU50266/01A priority Critical patent/AU5026601A/en
Publication of WO2001075126A1 publication Critical patent/WO2001075126A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • the present invention belongs to the field of biotechnology. Specifically, the present invention describes a novel polypeptide, human ribosomal protein S 18-9, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and polypeptide.
  • the correct translation of proteins is very important for all bacteria and higher organisms.
  • the research on the regulation mechanism of protein translation is obtained from E. coli.
  • the protein translation process is mainly completed by various aminoacyl-tRNA synthetases, various tRNAs and ribosomes.
  • the ribosome and other cofactors together provide the entire enzymatic activity of the translation process. These enzyme activities are only in the Only when the overall structure of the body is complete. Therefore, the ribosome and its constituent subunits act synergistically in the body and play an important physiological function.
  • Ribosomes are organelles that synthesize proteins. Their only function is to synthesize polypeptide chains from amino acids in accordance with the instructions of mRNA. It is called ribosome, and is simply called ribosome or ribosome. Ribosomes are found in almost all cells, and both prokaryotic and eukaryotic cells have a large number of ribosomes. The ribosome is a granular structure without a membrane. Its diameter is 25nm. The main components are protein and RNA. Ribosome RNA is called rRNA. The protein content is about 40% and RNA is about 60%.
  • Protein molecules are mainly distributed on the surface of the ribosome, while rRNA is located internally, and the two are bound together by non-covalent bonds (Cell Biology Zhai Zhonghe Higher Education Press PPl 22-129). Functional research of ribosomes has focused on ribosomal RNA. There are many rRNA functional domains that determine the different functions of ribosomes (Annu Rev Bi ochem 1991; 60 191-227) ⁇
  • ribosomes there are two basic types of ribosomes in biological organism cells: one is a ribosome of 70S (S is the Sverdberg sedimentation coefficient unit). The ribosomes of all prokaryotic cells are 70S eukaryotic cells. Approximately 70S. The other is 80S ribosomes, the ribosomes of eukaryotic cells (except for mitochondria and chloroplast ribose) are 80S. Ribosomes, whether 70S or 80S, are composed of two subunits of different sizes.
  • the ribosome size subunits are often free in the cytoplasmic matrix within the cell. Only when the small subunits are combined with mRNA do the large subunits bind to the small subunits to form a complete ribosome. After the peptide synthesis is terminated, the large and small subunits dissociate and then exist freely in the cytoplasmic matrix.
  • S18 is one of the small subunits of ribosomal binding proteins, and it and homologous proteins exist in most prokaryotic and eukaryotic cells.
  • the structural protein S18 a small 40S ribosomal subunit found in a mouse recombinant cDNA library, was found to have 152 amino acids in S18, and the mRNA encoding this protein has approximately 600 nucleotides.
  • the structure of this protein is similar to that of E. coli S13, and also similar to plant mitochondria and S13 of other bacteria (Biochem Biophys Res Commun 1991 Aug 15; 178 (3): 1212-8).
  • the role of ribosomal protein S18 has not been studied yet. It is clear, but according to the existing research results, it is speculated that S18 can bind to the small subunit of the ribosome, and can also interact with S6 to function.
  • ribosomal protein S18 The most important point of the role of ribosomal protein S18 is that it is related to the binding of aminoacyl-tRNA on the ribosome, which has extremely important regulatory significance for the role of the A site of the ribosome (McDougall J., Choli T., Kruf t V., Kapp U., Wittmann-Liebold B. FEBS Lett. 245: 253-260 (1989)).
  • Ribosomal protein S18 plays an important role in the translation process of proteins. If it is deleted or chemically modified, or the gene encoding it is mutated, it will affect the function of ribosomes and reduce the activity of peptide synthesis. Although the research on the function of ribosomal protein S18 is not thorough enough, according to various research results, it can be proved that the functions of ribosomal protein S18 include: (1) It is very important for rRNA to fold into a functional three-dimensional structure; (2 ) In protein synthesis, the spatial conformation of the ribosome undergoes a series of changes, and the ribosomal protein may play a "fine-tuning" role in the conformation of the ribosome; (3) it may even play a catalytic role at the binding site of the ribosome, Ribosome proteins work together with rRNA.
  • ribosomal protein S18 is present in cells transcribed and translated by DM It plays an extremely important role in the proliferation process. Its abnormal expression will cause the growth rate of the tissue to slow down, which will cause various developmental disorders, such as stunting.
  • human ribosomal protein S18-9 protein regulates cell division and embryonic development. It plays an important role in important functions, and it is believed that a large number of proteins are involved in these regulatory processes. Therefore, there is a need in the art to identify more human ribosomal protein S18-9 proteins involved in these processes, especially the amino acid sequence of this protein. Isolation of the new human ribosomal protein S18-9 protein encoding gene also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so it is important to isolate its coding DNA. Object of the invention
  • Another object of the invention is to provide a polynucleotide encoding the polypeptide.
  • Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding human ribosomal protein S18-9.
  • Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding human ribosomal protein S18-9.
  • Another object of the present invention is to provide a method for producing human ribosomal protein S18-9.
  • Another object of the present invention is to provide an antibody against the polypeptide of the present invention, human ribosomal protein S18-9.
  • Another object of the present invention is to provide mimetic compounds, antagonists, agonists, and inhibitors directed to the polypeptide of the present invention, human ribosomal protein S 18-9.
  • Another object of the present invention is to provide a method for diagnosing and treating a disease associated with abnormality of human ribosomal protein S18-9. Summary of invention
  • the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
  • the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
  • sequence of the polynucleotide is one selected from the group consisting of: (a) having SEQ ID NO: 1 A sequence of positions 678-935; and (b) a sequence of positions 1-2459 in SEQ ID NO: 1.
  • the present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
  • the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
  • the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of human ribosomal protein S18-9 protein, which comprises utilizing the polypeptide of the invention.
  • the invention also relates to compounds obtained by this method.
  • the invention also relates to a method for detecting a disease or susceptibility to disease associated with abnormal expression of human ribosomal protein S18-9 protein in vitro, which comprises detecting a mutation in the polypeptide or a sequence encoding a polynucleotide thereof in a biological sample, or detecting The amount or biological activity of a polypeptide of the invention in a biological sample.
  • the invention also relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
  • the present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention in the preparation of a medicament for treating cancer, developmental disease or immune disease or other diseases caused by abnormal expression of human ribosomal protein S18-9.
  • FIG. 1 is a comparison diagram of gene chip expression profiles of human ribosomal protein S 18-9 and human ribosomal protein S 18 1 3 according to the present invention.
  • the upper graph is a graph of the expression profile of human ribosomal protein S18-9
  • the lower graph is the graph of the expression profile of human ribosomal protein S18 13.
  • 1 indicates fetal kidney
  • 2 indicates fetal large intestine
  • 3 indicates fetal small intestine
  • 4 indicates fetal muscle
  • 5 indicates fetal brain
  • 6 indicates fetal bladder
  • 7 indicates non-starved L02
  • 8 indicates L02 +, l hr, As 3+
  • 9 Indicates ECV304 PMA-
  • 10 indicates ECV304 PMA +
  • 1 indicates fetal liver
  • 12 indicates normal liver
  • 13 indicates thyroid
  • 14 indicates skin
  • 15 indicates fetal lung
  • 16 indicates lung
  • 17 indicates lung cancer
  • 18 indicates fetal spleen
  • 19 indicates The spleen
  • 20 is the prostate
  • 21 is the fetal heart
  • 22 is the heart
  • 23 is the muscle
  • 24 is the testis
  • 25 is the fetal thymus
  • 26 is the thymus.
  • FIG. 2 is a polyacrylamide gel electrophoresis diagram (SDS-PAGE) of an isolated human ribosomal protein S 18-9.
  • OkDa is the molecular weight of the protein.
  • the arrow indicates the isolated protein band.
  • Nucleic acid sequence refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
  • amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
  • amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
  • a “variant" of a protein or polynucleotide refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it.
  • the changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence.
  • Variants can have "conservative" changes, in which the amino acid substituted has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine.
  • Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
  • “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
  • Insertion means that a change in the amino acid sequence or nucleotide sequence results in an increase in one or more amino acids or nucleotides compared to a molecule that exists in nature.
  • Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
  • Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
  • immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response and to bind specific antibodies in a suitable animal or cell.
  • An "agonist” refers to a molecule that, when combined with human ribosomal protein S18-9, causes a change in the protein to regulate the activity of the protein.
  • An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that binds human ribosomal protein S 18-9.
  • Antagonist refers to a molecule that can block or regulate the biological or immunological activity of human ribosomal protein S18-9 when bound to human ribosomal protein S18-9.
  • Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates or any other molecule that can bind to human ribosomal protein S18-9.
  • Regular refers to a change in the function of human ribosomal protein S18-9, including an increase or decrease in protein activity, a change in binding characteristics, and any other biological, functional, or immune properties of human ribosomal protein S18-9 Change.
  • substantially pure means substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated. Quality. Those skilled in the art can purify human ribosomal protein S18-9 using standard protein purification techniques. The substantially pure human ribosomal protein S18-9 produces a single main band on a non-reducing polyacrylamide gel. The purity of the human ribosomal protein S18-9 polypeptide can be analyzed by amino acid sequence.
  • Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
  • sequence C-T-G-A
  • complementary sequence G-A-C-T.
  • the complementarity between two single-stranded molecules may be partial or complete.
  • the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
  • “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
  • Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Southern imprinting or Nor thern blotting, etc.) under conditions of reduced stringency.
  • Substantially homologous sequences or hybridization probes can compete and inhibit the binding of fully homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.
  • Percent identity refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALIGN program (Lasergene sof tware package, DNASTAR, Inc., Madi son Wis.). The MEGALIGN program can compare two C lus ter different methods Method according to one or more sequences (H i gg ins, DG and PM Sharp (1988) Gene 73: 237-244) 0 C l us ter method by checking all pairs The distance between them arranges the groups of sequences into clusters. The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences, such as sequence A and sequence B, is calculated by the following formula: Number of residues matching between sequence ⁇
  • the percent identity between nucleic acid sequences can also be determined by the Clus ter method or by methods known in the art, such as Jotun He in (He in J., (1990) Methods in enzymology 183: 625-645).
  • Similarity refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
  • Amino acids used for conservative substitution for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
  • Antisense refers to a nucleotide sequence that is complementary to a particular DM or RNA sequence.
  • Antisense strand refers to a nucleic acid strand that is complementary to the “sense strand”.
  • Derivative refers to HFP or a chemical modification of its nucleic acid. This chemical modification may be a substitution of a hydrogen atom with a fluorenyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
  • Antibody refers to a complete antibody molecule and its fragments, such as Fa,? (&1>') 2 and? It can specifically bind to the epitope of human ribosomal protein S18-9.
  • a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
  • isolated refers to the removal of a substance from its original environment (for example, its natural environment if it is naturally occurring).
  • a naturally-occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
  • Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not part of its natural environment, they are still isolated.
  • isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
  • polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances in the natural state .
  • isolated human ribosomal protein S 18-9 refers to human ribosomal protein S 18-9 which is essentially free of other proteins, lipids, sugars or other substances with which it is naturally associated.
  • Those skilled in the art can purify human ribosomal protein S 1 8-9 using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of the human ribosomal protein S 1 8-9 peptide can be analyzed by amino acid sequence.
  • the present invention provides a new polypeptide, human ribosomal protein S 18-9, which basically consists of the amino acid sequence shown in SEQ ID NO: 2.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
  • the polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques. Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
  • the invention also includes fragments, derivatives and analogs of the human ribosomal protein S 1 8-9.
  • fragment refers to a polypeptide that substantially maintains the same biological function or activity of the human ribosomal protein S 18-9 of the present invention.
  • a fragment, derivative or analog of the polypeptide of the present invention may be: U) a kind in which one or more amino acid residues are conserved or non-conserved Substitution of amino acid residues (preferably conservative amino acid residues), and the substituted amino acid may or may not be encoded by a genetic codon; or ( ⁇ ) such a type in which one or more of the amino acid residues A group is substituted by another group to include a substituent; or (III) such a type in which the mature polypeptide is fused with another compound (such as a compound that extends the half-life of the polypeptide, such as polyethylene glycol); or (IV) such a type A polypeptide sequence (such as a leader sequence or a secreted sequence or a sequence used to purify this polypeptide or a protein sequence) formed by merging additional amino acid sequences into a mature polypeptide.
  • such fragments, derivatives and analogs are considered to be within the knowledge of those skilled in the art.
  • the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
  • the polynucleotide of the present invention is found from a CDM library of human fetal brain tissue. It contains a full-length polynucleotide sequence of 2459 bases and its open reading frame of 678-935 encodes 85 amino acids.
  • the polynucleotide of the present invention may be in the form of DM or RNA.
  • DNA forms include cDNA, genomic DNA, or synthetic DNA.
  • DNA can be single-stranded or double-stranded.
  • DNA can be coding or non-coding.
  • the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
  • a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
  • the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
  • polynucleotide encoding a polypeptide refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.
  • the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
  • Variants of this polynucleotide may be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
  • an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
  • the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity between the two sequences).
  • the invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the invention under stringent conditions.
  • "strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60 ° C; or (2) added during hybridization Use a denaturant, such as 50 ° /.
  • the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
  • nucleic acid fragments that hybridize to the sequences described above.
  • a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 cores. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques, such as PCR, to identify and / or isolate polynucleotides encoding human ribosomal protein S18-9.
  • polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
  • the specific polynucleotide sequence encoding the human ribosomal protein S18-9 of the present invention can be obtained by various methods.
  • polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
  • the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.
  • genomic DM is the least commonly used. Direct chemical synthesis of DM sequences is often the method of choice.
  • the more commonly used method is the isolation of cDNA sequences.
  • the standard method for isolating the cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library.
  • Various methods have been used to extract mRNA, and kits are also commercially available (Qiagene).
  • the construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989).
  • Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
  • genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DNA-RNA hybridization; (2) the appearance or loss of marker gene function; (3) determination of the level of the human ribosomal protein S18-9 transcript; ( 4) Detecting gene-expressed protein products by immunological techniques or by measuring biological activity. The above methods can be used singly or in combination.
  • the probe used for hybridization is any part of the polynucleotide of the present invention Homologous, at least 10 nucleotides in length, preferably at least 30 nucleotides, more preferably at least 50 nucleotides, most preferably at least 100 nucleotides.
  • the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
  • the probe used here is usually a DM sequence chemically synthesized based on the gene sequence information of the present invention.
  • the genes or fragments of the present invention can of course be used as probes.
  • DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
  • immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) can be used to detect the protein product of human ribosomal protein S18-9 gene expression.
  • ELISA enzyme-linked immunosorbent assay
  • a method using PCR technology to amplify DNA / RNA is preferably used to obtain the gene of the present invention.
  • the RACE method RACE-rapid cDNA end rapid amplification method
  • the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Select and synthesize using conventional methods.
  • the amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
  • polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, sequencing needs to be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
  • the present invention also relates to a vector comprising a polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using a human ribosomal protein S18-9 coding sequence, and a recombinant technology for producing a polypeptide of the present invention. method.
  • the polynucleotide sequence encoding human ribosomal protein S18-9 can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
  • vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
  • Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors expressed in bacteria (Rosenberg, et al.
  • any plasmid and vector can be used to construct a recombinant expression vector.
  • An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
  • Methods known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding human ribosomal protein S18-9 and appropriate transcriptional / translational regulatory elements. These methods include in vitro recombinant DNA Technology, DNA synthesis technology, in vivo recombination technology, etc. (Sambroook, et al. Molecular Cloning, a Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989).
  • the DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis. Representative examples of these promoters are: the lac or trp promoter of E.
  • the expression vector also includes a ribosome binding site and a transcription terminator for translation initiation. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers from 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers on the late side of the origin of replication, and adenovirus enhancers.
  • the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • GFP fluorescent protein
  • tetracycline or ampicillin resistance for E. coli.
  • a polynucleotide encoding human ribosomal protein S18-9 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a genetically engineered host cell containing the polynucleotide or the recombinant vector.
  • the term "host cell” refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E.
  • coli Streptomyces
  • bacterial cells such as Salmonella typhimurium
  • fungal cells such as yeast
  • plant cells such as insect cells such as Fly S2 or Sf9
  • animal cells such as CH0, COS or Bowes melanoma cells.
  • Transformation of a host cell with a DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art.
  • the host is a prokaryote such as E. coli
  • competent cells capable of absorbing DM can be harvested after the exponential growth phase and treated with the CaCl 2 method. The steps used are well known in the art. Alternatively, MgCl 2 is used. If necessary, transformation can also be performed by electroporation.
  • the host is a eukaryotic organism, the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
  • the polynucleotide sequence of the present invention can be used to express or produce recombinant human ribosomal protein S18-9 (Science, 1984; 224: 1431). Generally there are the following steps: (1) using the polynucleotide (or variant) encoding human human ribosomal protein S 18-9 of the present invention, or transforming or transducing a suitable host cell with a recombinant expression vector containing the polynucleotide;
  • the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
  • a suitable method such as temperature conversion or chemical induction
  • the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If necessary, the recombinant protein can be isolated and purified by various separation methods using its physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
  • conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid
  • polypeptides of the present invention as well as antagonists, agonists and inhibitors of the polypeptides, can be directly used in the treatment of diseases, for example, they can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection, and immune diseases.
  • Ribosome protein S 18 is one of the proteins in the small ribosomal subunit. The most important point of the role of ribosomal protein S 18 is that it is related to the binding of aminoacyl-tRNA on the ribosome, which has extremely important regulatory significance for the role of the A site of the ribosome. It plays a very important role in the correct tRNA selection in the initial stage of protein synthesis. The S 18 protein can select the correct tRNA to bind to small ribosomal subunits to avoid mismatches, which is directly related to the stability of the passage of the organism. And the loss of ribosomal protein will cause the cell to slow down.
  • the abnormal expression of the specific S 1 8 family protein mo tif will cause the polypeptide containing the mot if of the present invention to malfunction, resulting in mistranslation of mRNA, and related diseases such as tumors, embryonic development disorders, Growth and development disorders.
  • the abnormal expression of the human ribosomal protein S 18-9 of the present invention will produce various diseases, especially embryonic developmental disorders, growth and development disorders, various tumors, and inflammations.
  • diseases include, but are not limited to: Embryonic developmental disorders: congenital abortion, cleft palate, facial oblique fissure, limb absentness, limb differentiation disorder, gastrointestinal atresia or stenosis, hyaline membrane disease, atelectasis, polycystic kidney disease, ectopic kidney, double ureter, cryptorchidism , Congenital inguinal hernia, double uterus, vaginal atresia, hypospadias, hermaphroditism, atrial septal defect, ventricular septal defect, pulmonary stenosis, arterial duct occlusion, neural tube defect, congenital hydrocephalus, iris defect, congenital Cataract, congenital glaucoma or cataract, congenital
  • Growth and development disorders mental retardation, cerebral palsy, brain development disorders, mental retardation, familial cerebral nucleus dysplasia syndrome, strabismus, skin, fat and muscular dysplasia such as congenital skin laxity, premature aging Disease, congenital keratosis, various metabolic defects such as various amino acid metabolic defects, stunting, dwarfism, sexual retardation
  • Tumors of various tissues gastric cancer, liver cancer, lung cancer, esophageal cancer, breast cancer, leukemia, lymphoma, thyroid tumor, uterine fibroids, neuroblastoma, astrocytoma, ependymoma, glioblastoma, Colon cancer, malignant histiocytosis, bladder cancer, bone cancer, osteosarcoma, myeloma, bone marrow cancer, brain cancer, uterine cancer, endometrial cancer, gallbladder cancer, thymic tumor, nasal cavity and sinus cancer, nasopharyngeal cancer, larynx Cancer, tracheal tumor, pleural mesothelioma, fibroid, fibrosarcoma, lipoma, liposarcoma, leiomyoma various inflammations: allergic reaction, adult respiratory distress syndrome, pulmonary eosinophilia, rheumatoid Arthritis, rheumato
  • the abnormal expression of the human ribosomal protein S 1-8-9 of the present invention will also produce certain hereditary, hematological and immune system diseases.
  • the invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) human ribosomal protein S 18-9.
  • Agonists enhance human ribosomal protein S 18-9 to stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
  • mammalian cells or membrane preparations expressing human ribosomal protein S 18-9 can be cultured with labeled human ribosomal protein S 18-9 in the presence of drugs. The ability of the drug to increase or block this interaction is then measured.
  • Antagonists of human ribosomal protein S 18-9 include screened antibodies, compounds, receptor deletions and the like. Antagonists of human ribosomal protein S 18-9 can bind to human ribosomal protein S18-9 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot function biologically. Learn function.
  • human ribosomal protein S 18-9 can be added to a bioanalytical assay and determined by measuring the effect of the compound on the interaction between human ribosomal protein S 1 8-9 and its receptor Whether the compound is an antagonist.
  • Receptor deletions and analogs that act as an anti-agent Polypeptide molecules capable of binding to human ribosomal protein S 18-9 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase.
  • the human ribosomal protein S18-9 molecule should generally be labeled.
  • the present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies.
  • the invention also provides antibodies directed against the human ribosomal protein S 18-9 epitope. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments generated from Fab expression libraries.
  • Polyclonal antibodies can be produced by injecting human ribosomal protein S 18-9 directly into immunized animals (such as rabbits, mice, rats, etc.).
  • immunized animals such as rabbits, mice, rats, etc.
  • adjuvants can be used to enhance the immune response, including but not limited to Freund's Adjuvant, etc.
  • Techniques for preparing monoclonal antibodies to human ribosomal protein S 18-9 include, but are not limited to, hybridoma technology (Kohler and Miste in. Nature, 1975, 256: 495-497), triple tumor technology, human beta- Cell hybridoma technology, EBV-hybridoma technology, etc.
  • Embedding antibodies that bind human constant regions and non-human-derived variable regions can be produced using existing techniques (Morrison et al, PNAS, 1985, 81: 6851).
  • the existing technology for producing single chain antibodies U.S. Pat No. 4946778, can also be used to produce single chain antibodies against human ribosomal protein S18-9.
  • Antibodies against human ribosomal protein S18-9 can be used in immunohistochemistry to detect human ribosomal protein S18-9 in biopsy specimens.
  • Monoclonal antibodies that bind to human ribosomal protein S18-9 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
  • Antibodies can also be used to design immunotoxins that target a particular part of the body.
  • human ribosomal protein S 18-9 high affinity monoclonal antibodies can covalently bind to bacterial or phytotoxins (such as diphtheria toxin, ricin, ormosine, etc.).
  • a common method is to attack the amino group of an antibody with a sulfhydryl crosslinker such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
  • This hybrid antibody can be used to kill human ribosomal protein S 18-9 positive Cell.
  • the antibodies in the present invention can be used to treat or prevent diseases related to human ribosomal protein S1 8-9.
  • Administration of an appropriate dose of antibody can stimulate or block the production or activity of human ribosomal protein S18-9.
  • the invention also relates to a diagnostic test method for quantitatively and locally detecting the level of human ribosomal protein S18-9.
  • tests are well known in the art and include FISH assays and radioimmunoassays.
  • the level of human ribosomal protein S18-9 detected in the test can be used to explain the importance of human ribosomal protein S18-9 in various diseases and to diagnose diseases in which human ribosomal protein S18-9 plays a role.
  • the polypeptide of the present invention can also be used for peptide mapping analysis.
  • the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
  • the polynucleotide encoding human ribosomal protein S18-9 can also be used for a variety of therapeutic purposes.
  • Gene therapy technology can be used to treat abnormal cell proliferation, development or metabolism caused by the non-expression or abnormal / inactive expression of human ribosomal protein S18-9.
  • Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated human ribosomal protein S18-9 to inhibit endogenous human ribosomal protein S18-9 activity.
  • a mutated human ribosomal protein S18-9 may be a shortened human ribosomal protein S18-9 that lacks a signaling domain, and although it can bind to downstream substrates, it lacks signaling activity.
  • the recombinant gene therapy vector can be used for treating diseases caused by abnormal expression or activity of human ribosomal protein S18-9.
  • Expression vectors derived from viruses such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to transfer the polynucleotide encoding human ribosomal protein S18-9 into cells.
  • Methods for constructing recombinant viral vectors carrying a polynucleotide encoding human ribosomal protein S18-9 can be found in the literature (Sambrook, et al.).
  • the recombinant polynucleotide encoding human ribosomal protein S18-9 can be packaged into liposomes and transferred into cells.
  • Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
  • a vector such as a virus, phage, or plasmid
  • Oligonucleotides including antisense RNA and DM
  • ribozymes that inhibit human ribosomal protein S18-9 mRNA are also within the scope of the present invention.
  • a ribozyme is an enzyme-like RNA molecule that specifically decomposes specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation.
  • Antisense RM, DNA, and ribozymes can be obtained using any existing RNA or DNA synthesis technology, such as solid-phase phosphoramidite chemical synthesis to synthesize oligonucleotides.
  • Antisense RNA molecules can be obtained by in vitro or in vivo transcription of DM sequences encoding the RNA. This DNA sequence has been integrated downstream of the RNA polymerase promoter of the vector. In order to increase the stability of the nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the linkage between ribonucleosides using phosphorothioate or peptide bonds instead of phosphodiester bonds.
  • the polynucleotide encoding human ribosomal protein S18-9 can be used for the diagnosis of diseases related to human ribosomal protein S18-9.
  • the polynucleotide encoding human ribosomal protein S18-9 can be used to detect the expression of human ribosomal protein S18-9 or the abnormal expression of human ribosomal protein S18-9 in a disease state.
  • the DNA sequence encoding human ribosomal protein S18-9 can be used to hybridize biopsy specimens to determine the expression of human ribosomal protein S18-9.
  • Hybridization techniques include Southern blotting, Northern blotting, in situ Hybridization etc. These techniques and methods are publicly available and mature, and related kits are commercially available.
  • a part or all of the polynucleotide of the present invention can be used as a probe to be fixed on a microarray (Microarray) or a DNA chip (also referred to as a "gene chip") for analyzing differential expression analysis and gene diagnosis of genes in tissues.
  • a microarray or a DNA chip (also referred to as a "gene chip") for analyzing differential expression analysis and gene diagnosis of genes in tissues.
  • Human ribosomal protein S18-9 specific primers for RNA-polymerase chain reaction (RT-PCR) amplification in vitro can also detect the human ribosomal protein S 18-9 transcription products.
  • Detection of mutations in the human ribosomal protein S18-9 gene can also be used to diagnose human ribosomal protein S18-9-related diseases.
  • Human ribosomal protein S18-9 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type human ribosomal protein S18-9 DNA sequence. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression. Therefore, Nor thern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
  • sequences of the invention are also valuable for chromosome identification. This sequence will specifically target a specific position on a human chromosome and can hybridize to it. Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for marking chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DNA sequences on a chromosome.
  • PCR primers (preferably 15-35bp) are prepared from the cDNA, and the sequences can be located on the chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
  • PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
  • oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
  • Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.
  • Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step.
  • FISH Fluorescent in situ hybridization
  • the physical location of the sequence on the chromosome can be correlated with the genetic map data. These data can be found in V. Mckusick, Mende l ian Inheritance in Man (available online with Johns Hopk ins University Welch Med ica l Library). Linkage analysis can then be used to determine the relationship between genes and diseases that have been mapped to chromosomal regions. Next, the differences in cDNA or genomic sequences between the affected and unaffected individuals need to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease.
  • Comparing affected and unaffected individuals usually involves first looking for structural changes in the chromosome, such as deletions or translocations that are visible at the chromosomal level or detectable using cDNA sequence-based PCR.
  • the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).
  • the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
  • suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
  • the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
  • the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell.
  • the polypeptides of the invention can be used in combination with other therapeutic compounds.
  • the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
  • Human ribosomal protein S 18-9 is administered in an amount effective to treat and / or prevent a specific indication.
  • the amount and range of human ribosomal protein S18-9 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician. Examples
  • Total human fetal brain RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform.
  • Poly (A) mRNA was isolated from total RNA using Quik mRNA I solat ion Kit (product of Qiegene). 2ug poly (A) mRNA is reverse transcribed to form cDNA.
  • a Smart cDNA cloning kit (purchased from Clontech) was used to insert the cDNA fragment into the multiple cloning site of the pBSK (+) vector (Clontech) to transform DH5a. The bacteria formed a CDM library.
  • the terminate cycle react ion sequencing kit (Perkin-Elmer) and the ABI 377 automatic sequencer (Perkin-Elmer) determined the sequences at the 5 'and 3' ends of all clones.
  • the determined cDNA sequence was compared with the existing public DNA sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 0502a08 was new DNA.
  • a series of primers were synthesized to determine the inserted cDNA fragments of the clone in both directions.
  • CDNA was synthesized using fetal brain total RNA as a template and oligo-dT as a primer for reverse transcription reaction. After purification using Qiagene's kit, the following primers were used for PCR amplification:
  • Primer2 5'- AGAGATCATGGTAGACCACAAATC -3 '(SEQ ID NO: 4)
  • Primerl is a forward sequence located at the 5th end of SEQ ID NO: 1, starting at lbp;
  • Primer2 is the 3 'end reverse sequence in SEQ ID NO: 1.
  • Amplification reaction conditions reaction volume containing 50 ⁇ 1 of 50mmol / L KC1, 10mmol / L Tris-HCl, pH8.5, 1.5mmol / L MgCl 2, 20 ( ⁇ mol / L dNTP, lOpmol primer, 1U Taq DNA polymerase (Clontech).
  • the reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) for 25 cycles under the following conditions: 94 ° C 30sec; 55. C 30sec; 72 ° C 2min.
  • RT -PCR set ⁇ -actin as a positive control and template blank as a negative control at the same time.
  • the amplified product was purified using QIAGEN's kit, and TA clone kit was connected to the P CR vector (Invitrogen). DNA sequence analysis results It is shown that the D sequence of the PCR product is identical to that of 1 to 2459 bp shown in SEQ ID NO: 1.
  • Example 3 Northern blot analysis of human ribosomal protein S18-9 gene expression
  • This method involves acid guanidinium thiocyanate phenol-chloroform extraction. That is, the tissue is homogenized with 4M guanidinium isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1 ), Mix and centrifuge. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water.
  • Electrophoresis was performed on a 1.2% agarose gel containing 2 g of RNA on 20 mM 3- (N-morpholino) propanesulfonic acid (pH 7.0)-5 mM sodium acetate-1 mM EDTA-2.2M formaldehyde. Then transferred to nitrocellulose. Preparation of a- 32 P dATP with 32 ⁇ - labeled by random priming SYSTEM DM probe. The DM probe used was the PCR amplified human ribosomal protein S18-9 coding region sequence (678bp to 935bp) shown in FIG. 1.
  • a 32P-labeled probe (about 2 x 10 6 cpm / ml) was hybridized with a nitrocellulose membrane to which RNA was transferred at 42 ° C overnight in a solution containing 50% formamide-25mM KH 2 P0 4 (pH7.4) -5 ⁇ SSC-5 ⁇ Denhardt's solution and 20 ⁇ g / ml salmon sperm DNA. After hybridization, wash the filter in 1> ⁇ SSC- 0.1% SDS at 55 ° C for 30min. Then, Analysis and quantification using Phosphor Imager.
  • Example 4 In vitro expression, isolation and purification of recombinant human ribosomal protein S18-9
  • Primer3 5'- CCCCATATGATGGCCACCCTGTGCCTCTGTCAG —3, (Seq ID No: 5)
  • Primer4 5'- CATGGATCCTCACTCCCTGGGCTCTCTGTGCCT -V (Seq ID No: 6)
  • the 5 'ends of these two primers contain Ndel and BamHI restriction sites, respectively, which The coding sequences of the 5 'and 3' ends of the gene of interest are respectively followed by Ndel and BamHI restriction sites corresponding to the selective endonucleases on the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865.3). Enzyme site.
  • PCR reaction was performed using the pBS-0502a08 plasmid containing the full-length target gene as a template.
  • PCR reaction conditions were: 1 in a total volume of 50 ⁇ plasmid pBS-0502a08 containing 10pg, primers Pr imer-3 and Primer-4, respectively lOpmol, Advantage polymerase Mix (Clontech Products) 1 ⁇ 1.
  • Cycle parameters 94. C 20s, 60. C 30s, 68 ° C 2 min, a total of 25 cycles.
  • Ndel and BamHI were used to double-digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase.
  • Ligation products were transformed by the calcium chloride method Escherichia bacteria DH5cx, after (final concentration of 30 ⁇ 8 / ⁇ 1) grown overnight in LB plates containing kanamycin, positive clones were screened by colony PCR method, and sequenced. A positive clone (pET-0502a08) with the correct sequence was selected, and the recombinant plasmid was transformed into E. coli BL21 (DE3) plySs (product of Novagen) using the calcium chloride method.
  • peptides specific to human ribosomal protein S18-9 were synthesized using a peptide synthesizer (product of PE company): NH2-Met-Al-Thr-Leu-Cys-Leu-Cys-Gln-Lys-Trp-Pro-Pro-Cys-His-Arg-C00H (SEQ ID NO: 7).
  • the polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex, respectively.
  • Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
  • the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
  • the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
  • the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method.
  • Filter hybridization methods include dot blotting, Southern imprinting, Northern blotting, and copying methods. They all use the same steps to immobilize the polynucleotide sample to be tested on the filter.
  • the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer to saturate the non-specific binding site of the sample on the filter with the carrier and the synthesized polymer.
  • the pre-hybridization solution is then replaced with a hybridization buffer containing labeled probes and incubated to hybridize the probes to the target nucleic acid.
  • the unhybridized probes are removed by a series of membrane washing steps.
  • This embodiment uses higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals.
  • the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
  • the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
  • the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
  • oligonucleotide fragment selected from the polynucleotide SEQ ID NO: 1 of the present invention for use as a hybridization probe shall be Following the following principles and several aspects to consider:
  • the preferred range of probe size is 18-50 nucleotides
  • Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements For homology comparison of the regions, if the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, the primary probe should not be used generally;
  • Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
  • Probe 2 which belongs to the second type of probe, is equivalent to the replacement mutation sequence (41Nt) of the gene fragment or its complementary fragment of SEQ ID NO: 1:
  • PBS phosphate buffered saline
  • step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
  • NC membranes nitrocellulose membranes
  • Two NC membranes are required for each probe for subsequent experiments.
  • the film is washed with high-strength conditions and strength conditions, respectively.
  • the sample film was placed in a plastic bag, was added 3- 10m g prehybridization solution (10xDenhardt's; 6xSSC, 0. lmg / ml CT DNA (the DNA calf thymus)) after e sealed bag, 68 ° C shaking water bath for 2 hours .
  • Gene chip or gene micro-matrix (DM Mi croarray) is a new technology currently being developed by many national laboratories and large pharmaceutical companies. It refers to the orderly and high-density arrangement of a large number of target gene fragments on glass. , Silicon and other carriers, and then use fluorescence detection and computer software to compare and analyze the data, in order to achieve the purpose of rapid, efficient, high-throughput analysis of biological information.
  • the polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research of new gene functions; search for and screen new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases . The specific method steps have been reported in the literature.
  • a total of 4,000 polynucleotide sequences of various full-length cDNAs are used as the target DM, including the polynucleotide of the present invention. They were amplified by PCR respectively. After purification, the concentration of the amplified product was adjusted to about 500 ng / ul, and a Cartesian 7500 spotter (purchased from Cartesian Company, USA) was used to spot the glass medium. The distance between the points is 280 ⁇ . The spotted slides were hydrated and dried, cross-linked in a UV cross-linker, and dried after elution to fix the DM on the glass slide to prepare chips. The specific method steps have been reported in the literature. The sample post-processing steps in this embodiment are:
  • Total mRNA was extracted from human mixed tissues and specific tissues (or stimulated cell lines) in one step, and mRNA was purified using Oligotex raRNA Midi Kit (purchased from QiaGen).
  • the fluorescent reagent Cy3dUTP 5-Araino-propargyl-2'-deoxyuridine 5 '-triphate coupled to Cy3 fluorescent dye purchased from Amersham Phamacia Biotech
  • Cy5dUTP 5- Amino-propargy 2'-deoxyuridine 5 '-triphate coupled to Cy5 fluorescent dye, purchased from Amersham Phamacia Biotech Company, labeled the body's specific tissue (or stimulated cell line) mRNA, and purified the probe to prepare a probe.
  • the probes from the two types of tissues and the chip were hybridized in a UniHyb TM Hybridization Solution (purchased from TeleChem) hybridization solution for 16 hours, washed with a washing solution (1 x SSC, 0.2 SDS) at room temperature and scanned with ScanArray 3000.
  • the instrument purchased from General Scanning Company, USA
  • the scanned images were analyzed and processed with Imagene software (Biodiscovery Company, USA) to calculate the Cy3 / Cy5 ratio of each point.
  • the above specific tissues are thymus, testis, muscle, spleen, lung, skin, thyroid, liver, PMA + Ecv304 cell line, PMA-Ecv304 cell line, non-starved L02 cell line, L02 cell line stimulated by arsenic for 1 hour, L02 cell line stimulated by arsenic for 6 hours prostate, heart, lung cancer, fetal bladder, fetal small intestine, fetal large intestine, fetal thymus, fetal muscle, fetal liver, fetal kidney, fetal spleen, fetal brain, Fetal lung and fetal heart.
  • An isolated polypeptide-human ribosomal protein S18-9 characterized in that it comprises: a polypeptide having the amino acid sequence shown in SEQ ID NO: 2, or an active fragment, analog, or derivative thereof.
  • polypeptide according to claim 1 characterized in that the amino acid sequence of the polypeptide, analog or derivative has at least 95% identity with the amino acid sequence shown in SEQ ID NO: 2.
  • polypeptide according to claim 2 further comprising a polypeptide having an amino acid sequence represented by SEQ ID D NO: 2.
  • polynucleotide characterized in that said polynucleotide comprises one selected from the group consisting of:
  • polynucleotide according to claim 4 wherein the polynucleotide comprises a polynucleotide encoding an amino acid sequence represented by SEQ ID NO: 2.
  • polynucleotide according to claim 4 characterized in that the sequence of the polynucleotide comprises the sequence of positions 678-935 in SEQ ID NO: 1 or the sequence of positions 1-2459 in SEQ ID NO: 1 .
  • a recombination vector containing an exogenous polynucleotide characterized in that it is a recombination constructed by the polynucleotide according to any one of claims 4-6 and a plasmid, virus or a carrier expression vector Carrier.
  • a genetically engineered host cell containing an exogenous polynucleotide characterized in that it is selected from one of the following host cells:
  • a method for preparing a polypeptide having human ribosomal protein S18-9 activity characterized in that the method includes:
  • An antibody capable of binding to a polypeptide characterized in that the antibody is capable of binding to a human ribosomal protein S18-9 specific binding antibody.
  • a class of compounds that mimic or regulate the activity or expression of a polypeptide characterized in that they are compounds that mimic, promote, antagonize or inhibit the activity of human ribosomal protein S18-9.
  • the compound according to claim 11 characterized in that it is an antisense sequence of a polynucleotide sequence or a fragment thereof shown in SEQ ID NO: 1.
  • a method for detecting a disease or susceptibility to a disease associated with a polypeptide characterized in that it comprises detecting the expression level of the polypeptide, or detecting the activity of the polypeptide Or detecting a nucleotide variation in a polynucleotide that causes abnormal expression or activity of the polypeptide.
  • nucleic acid molecule according to any one of claims 4 to 6, characterized in that it is used as a primer for a nucleic acid amplification reaction, or as a probe for a hybridization reaction, or for manufacturing a gene chip Or microarray.
  • polypeptide, polynucleotide or compound according to any one of claims 1 to 6 and 1 1, characterized in that the polypeptide, polynucleotide or compound is used for preparing a treatment such as a malignant tumor, Hematological diseases, HIV infection and immune diseases and drugs of various inflammations.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Toxicology (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

L'invention concerne un nouveau polypeptide, une protéine ribosomale humaine S18-9, et un polynucléotide codant pour ce polypeptide ainsi qu'un procédé d'obtention de ce polypeptide par des techniques recombinantes d'ADN. L'invention concerne en outre les applications de ce polypeptide dans le traitement de maladies, notamment des tumeurs malignes, de l'hémopathie, de l'infection par VIH, de maladies immunitaires et de diverses inflammations. L'invention concerne aussi l'antagoniste agissant contre le polypeptide et son action thérapeutique ainsi que les applications de ce polynucléotide codant pour la protéine ribosomale humaine S18-9.
PCT/CN2001/000407 2000-03-24 2001-03-23 Nouveau polypeptide, proteine ribosomale humaine s18-9, et polynucleotide codant pour ce polypeptide WO2001075126A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU50266/01A AU5026601A (en) 2000-03-24 2001-03-23 Novel polypeptide--- a human ribosomal protein s18-9 and polynucleotide encodingit

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN 00115114 CN1315356A (zh) 2000-03-24 2000-03-24 一种新的多肽——人核糖体蛋白s18－9和编码这种多肽的多核苷酸
CN00115114.2 2000-03-24

Publications (1)

Publication Number Publication Date
WO2001075126A1 true WO2001075126A1 (fr) 2001-10-11

Family

ID=4584583

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2001/000407 WO2001075126A1 (fr) 2000-03-24 2001-03-23 Nouveau polypeptide, proteine ribosomale humaine s18-9, et polynucleotide codant pour ce polypeptide

Country Status (3)

Country Link
CN (1) CN1315356A (fr)
AU (1) AU5026601A (fr)
WO (1) WO2001075126A1 (fr)

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2000008173A1 (fr) * 1998-08-04 2000-02-17 Ludwig Institute For Cancer Research Identification et caracterisation fonctionnelle d'une nouvelle proteine kinase s6 ribosomique

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2000008173A1 (fr) * 1998-08-04 2000-02-17 Ludwig Institute For Cancer Research Identification et caracterisation fonctionnelle d'une nouvelle proteine kinase s6 ribosomique

Also Published As

Publication number Publication date
CN1315356A (zh) 2001-10-03
AU5026601A (en) 2001-10-15

Similar Documents

Publication Publication Date Title
WO2001055376A1 (fr) Nouveau polypeptide, proteine humaine 28 a doigt de zinc contenant un motif structural hit, et polynucleotide codant pour ce polypeptide
WO2001075126A1 (fr) Nouveau polypeptide, proteine ribosomale humaine s18-9, et polynucleotide codant pour ce polypeptide
WO2001070965A1 (fr) Nouveau polypeptide, facteur humain de regulation de la transcription 15, et polynucleotide codant pour ce polypeptide
WO2001075048A2 (fr) Nouveau polypeptide, proteine ribosomale humaine s11 23, et polynucleotide codant pour ce polypeptide
WO2001075101A1 (fr) Nouveau polypeptide, proteine humaine de regulation de la transcription 8, et polynucleotide codant pour ce polypeptide
WO2001072801A1 (fr) Nouveau polypeptide, proteine ribosomale humaine s11 12, et polynucleotide codant pour ce polypeptide
WO2001094371A1 (fr) Nouveau polypeptide, proteine ribosomale humaine s4-10, et polynucleotide codant ce polypeptide
WO2001087963A1 (fr) Proteine s18-12 ribosomale, polypeptide humain, et polynucleotide la codant
WO2001074881A1 (fr) Nouveau polypeptide, proteine ribosomale humaine s18-10, et polynucleotide codant pour ce polypeptide
WO2001075100A1 (fr) Nouveau polypeptide, proteine humaine de reparation 10 du mesappariement de l'adn, et polynucleotide codant pour ce polypeptide
WO2001087968A1 (fr) Proteine s4-36 ribosomale, polypeptide humain, et polynucleotide la codant
WO2001075102A1 (fr) Nouveau polypeptide, proteine humaine de regulation de la transcription 13, et polynucleotide codant pour ce polypeptide
WO2001070957A1 (fr) Nouveau polypeptide, proteine humaine de reparation 9.4 du mesappariement de l'adn, et polynucleotide codant pour ce polypeptide
WO2001075028A2 (fr) Nouveau polypeptide, proteine ribosomale humaine s4-12, et polynucleotide codant pour ce polypeptide
WO2001081396A1 (fr) Nouveau polypeptide, proteine ribosomale s7 humaine 14, et polynucleotide codant pour ce polypeptide
WO2001087971A1 (fr) Proteine s18-14 ribosomale, polypeptide humain, et polynucleotide la codant
WO2001090171A1 (fr) Nouveau polypeptide, proteine humaine ribosomale sii 12, et polynucleotide codant ce polypeptide
WO2001079428A2 (fr) Nouveau polypeptide, proteine humaine de reparation 8.9 du mesappariement de l'adn, et polynucleotide codant pour ce polypeptide
WO2001047964A1 (fr) Nouveau polypeptide, helicase atp-dependante 68, et polynucleotide codant pour ce polypeptide
WO2001055185A1 (fr) Nouveau polypeptide, proteine ribosomale l20, 16, et polynucleotide codant pour ce polypeptide
WO2001081386A1 (fr) Nouveau polypeptide, proteine pax humaine 12.5, et polynucleotide codant pour ce polypeptide
WO2001079436A2 (fr) Nouveau polypeptide, facteur humain de transcription de la differentiation cellulaire 10, et polynucleotide codant pour ce polypeptide
WO2001046235A1 (fr) Nouveau polypeptide, proteine ribosomale s3 17, et polynucleotide codant pour ce polypeptide
WO2001087967A1 (fr) Proteine s18-26 ribosomale, polypeptide humain, et polynucleotide la codant
WO2001055184A1 (fr) Nouveau polypeptide, proteine humaine a doigt de zinc 19, et polynucleotide codant pour ce polypeptide

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP