WO2001087971A1 - Proteine s18-14 ribosomale, polypeptide humain, et polynucleotide la codant - Google Patents
Proteine s18-14 ribosomale, polypeptide humain, et polynucleotide la codant Download PDFInfo
- Publication number
- WO2001087971A1 WO2001087971A1 PCT/CN2001/000727 CN0100727W WO0187971A1 WO 2001087971 A1 WO2001087971 A1 WO 2001087971A1 CN 0100727 W CN0100727 W CN 0100727W WO 0187971 A1 WO0187971 A1 WO 0187971A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- polypeptide
- polynucleotide
- ribosomal protein
- human ribosomal
- sequence
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
Definitions
- the present invention belongs to the field of biotechnology. Specifically, the present invention describes a new polypeptide ⁇ ⁇ ribosomal protein S18-14, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and the polypeptide.
- the correct translation of proteins is very important for all bacteria and higher organisms.
- the research on the regulation mechanism of protein translation is obtained from E. coli.
- the protein translation process is mainly completed by various aminoacyl-tRNA synthetases, various tRNAs and ribosomes.
- the ribosome and other cofactors together provide the full enzymatic activity of the translation process. These enzyme activities are only in the ribose Only when the overall structure of the body is complete. Therefore, the ribosome and its constituent subunits act synergistically in the body and play an important physiological function.
- Ribosomes are organelles that synthesize proteins. Their sole function is to synthesize polypeptide chains from amino acids in accordance with the instructions of mRNA. It is called ribosome, and is simply called ribosome or ribosome. Ribosomes are found in almost all cells, whether in prokaryotic or eukaryotic cells, there are a large number of ribosomes. The ribosome is a granular structure without a membrane. Its diameter is 25 nm. The main components are protein and RNA. The ribosome RM is called rRNA, and the protein content is about 40 ° /. RNA accounts for about 60%.
- Protein molecules are mainly distributed on the surface of the ribosome, while rRNA is located inside, and the two are bound together by non-covalent bonds (Cell Biology Zhai Zhonghe Higher Education Press PP122-129)
- the function of ribosomes has focused on There are many rRNA domains in ribosomal RNA that determine the different functions of the ribosome (Annu Rev Biochem. 1991; 60: 191-227).
- ribosomes there are two basic types of ribosomes in biological organism cells: one is a ribosome of 70S (S is the Sverdberg sedimentation coefficient unit). The ribosomes of all prokaryotic cells are 70S eukaryotic cells. Approximately 70S. The other is 80S ribosomes, the ribosomes of eukaryotic cells (except for mitochondria and chloroplast ribose) are 80S. Ribosomes, whether 70S or 80S, are composed of two subunits of different sizes.
- the ribosome size subunits are often free in the cytoplasmic matrix within the cell. Only when the small subunits are combined with mRNA do the large subunits bind to the small subunits to form a complete ribosome. After the peptide synthesis is terminated, the large and small subunits dissociate and then exist freely in the cytoplasmic matrix.
- S18 is one of the small subunits of ribosomal binding proteins, and it and homologous proteins exist in most prokaryotic and eukaryotic cells.
- the structural protein S18 a small 40S ribosomal subunit found in a mouse recombinant cDNA library, was found to have 152 amino acids in S18, and the mRNA encoding this protein has approximately 600 nucleotides.
- the structure of this protein is similar to S13 of Escherichia coli, and also similar to S13 of plant mitochondria and other bacteria (Biochem Biophys Res Commun. 1991, Aug. 15; 178 (3): 1212-8).
- All S18 proteins contain a conserved region containing the following consensus sequence fragments: [IV]-[DY] -YX (2)-[LIVMT] -x (2)-[LIVM] -x (2) - [FYT] - [LIVM] - [ST] - [DERP] a X- [GY] - - [LIVM ] -X (3) -R- [LIVMAS] 0 which contain many different biological protein S18 A sequence fragment that may play an important role in the action of ribosomes. This structural motif plays a very important role in the process of the protein's normal physiological function.
- S18 can bind to small subunits of ribosomes, and can also interact with S6 to function.
- ribosomal protein S18 The most important point of the role of ribosomal protein S18 is that it is related to the binding of aminoacyl-tRNA on the ribosome, which has extremely important regulatory significance for the role of the A site of the ribosome (McDouga ll J., Chol i T. , Kruf t V., Kapp U., Wit traann-Liebold B. FEBS Let t. 245: 253-260 (1989),).
- Ribosomal protein S18 plays an important role in the translation process of proteins. If it is deleted or chemically modified, or the gene encoding it is mutated, it will affect the function of ribosomes and reduce the activity of peptide synthesis. Although the functional studies of ribosomal protein S18 are not thorough enough, according to various research results, it can be proved that the functions of ribosomal protein S18 include: (1) It is very important for rRM to fold into a functional three-dimensional structure; (2 ) In protein synthesis, the spatial conformation of the ribosome undergoes a series of changes, and the ribosomal protein may play a "fine-tuning" role in the conformation of the ribosome; (3) the ribosome binding site may even be involved in catalysis, Ribosome proteins work with rRM.
- ribosomal protein S18 Based on the sequence similarity of ribosomal protein S18, it is considered to belong to the ribosomal protein family. Deletion of this protein will result in slower cell growth [J. Stephen Gant t, Michael D. Thompson, 1990, J. Bio l. Chem., 265: 2763-2767]. Therefore, ribosomal protein S18 plays a very important role in the cell proliferation process of DNA transcription and translation. Its abnormal expression will cause the growth rate of the tissue to slow down, which will cause various developmental disorders, such as stunting.
- the human ribosomal protein S18-14 protein plays an important role in regulating important functions of the body such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes. Therefore, there is always a need to identify more involved in these Process of the human ribosomal protein S18-14 protein, especially the amino acid sequence of this protein is identified. Isolation of the new human ribosomal protein S18-14 protein encoding gene also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so it is important to isolate its code D. Object of the invention
- Another object of the invention is to provide a polynucleotide encoding the polypeptide.
- Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding human ribosomal protein S18-14.
- Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding human ribosomal protein S18-14.
- Another object of the present invention is to provide a method for producing human ribosomal protein S 18-14.
- Another object of the present invention is to provide antibodies against the polypeptide of the present invention, human ribosomal protein S18-14.
- Another object of the present invention is to provide mimetic compounds, antagonists, agonists, and inhibitors against the polypeptide of the present invention, human ribosomal protein S18-14.
- Another object of the present invention is to provide a method for diagnosing and treating diseases associated with abnormalities of human ribosomal protein S18-14. Summary of invention
- the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
- the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
- the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of: (
- sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 450-842 in SEQ ID NO: 1; and (b) a sequence having 1-2645 in SEQ ID NO: 1 Sequence of bits.
- the present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
- the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
- the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of human ribosomal protein S18-14 protein, which comprises utilizing the polypeptide of the invention.
- the invention also relates to compounds obtained by this method.
- the present invention also relates to a method for detecting a disease or susceptibility related to abnormal expression of human ribosomal protein S18-14 protein in vitro, comprising detecting a mutation in the polypeptide or a sequence encoding a polynucleotide thereof in a biological sample, Alternatively, the amount or biological activity of a polypeptide of the invention in a biological sample is detected.
- the invention also relates to a pharmaceutical composition
- a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
- the present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention for the preparation of a medicament for treating cancer, developmental disease or immune disease or other diseases caused by abnormal expression of human ribosomal protein S18-14.
- FIG. 1 is a comparison diagram of gene chip expression profiles of human ribosomal protein S18-14 and human ribosomal protein S18-13 according to the present invention.
- the upper graph is a graph of the expression profile of human ribosomal protein S18-14, and the lower graph is the graph of the expression profile of human ribosomal protein S18-13.
- 1 indicates fetal kidney
- 2 indicates fetal large intestine
- 3 indicates fetal small intestine
- 4 indicates fetal muscle
- 5 indicates fetal brain
- 6 indicates fetal bladder
- 7 indicates non-starved L02
- 8 indicates L02 +, lhr, As 3+
- 9 ECV304 PMA- 10
- ECV304 PMA + 11 fetal liver, 12 normal liver, 13 thyroid
- 14 skin
- 18 fetal spleen
- 19 20 means prostate
- 21 means fetal heart
- 22 means heart
- 23 means muscle
- 24 means testis
- 25 means fetal thymus
- 26 means thymus.
- Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of the isolated human ribosomal protein S18-14.
- OkDa is the molecular weight of the protein.
- the arrow indicates the isolated protein band.
- Nucleic acid sequence refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
- amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
- amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
- a “variant" of a protein or polynucleotide refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it.
- the changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence.
- Variants can have "conservative" changes, in which the amino acid substituted has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine.
- Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
- “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
- Insertion means that a change in the amino acid sequence or nucleotide sequence results in an increase in one or more amino acids or nucleotides compared to a molecule that exists in nature.
- Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
- Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
- immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response and to bind specific antibodies in a suitable animal or cell.
- An "agonist” refers to a molecule that, when combined with human ribosomal protein S18-14, can cause the protein to change, thereby regulating the activity of the protein.
- An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that binds human ribosomal protein S18-14.
- Antagonist refers to a kind of sealable protein when combined with human ribosomal protein S18-14. Molecules that block or regulate the biological or immunological activity of human ribosomal protein S18-14. Antagonists and inhibitors can include proteins, nucleic acids, carbohydrates, or any other molecule that can bind human ribosomal protein S18-14.
- Regular refers to a change in the function of human ribosomal protein S18-14, including an increase or decrease in protein activity, a change in binding characteristics, and any other biological, functional, or immune properties of human ribosomal protein S18-14 change.
- substantially pure means substantially free of other proteins, lipids, carbohydrates or other substances with which it is naturally associated.
- Those skilled in the art can purify human ribosomal protein S18-14 using standard protein purification techniques.
- the essentially pure human ribosomal protein S18-14 produces a single main band on a non-reducing polyacrylamide gel.
- the purity of human ribosomal protein S18-14 polypeptide can be analyzed by amino acid sequence.
- Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
- sequence C-T-G-A
- complementary sequence G-A-C-T.
- the complementarity between two single-stranded molecules may be partial or complete.
- the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
- “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
- Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Southern imprinting or Northern blotting, etc.) under conditions of reduced stringency. Substantially homologous sequences or hybridization probes can compete and inhibit the binding of fully homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.
- Percent identity refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALIGN program (Lasergene sof tware package, DNASTAR, Inc., Madi son Wis.). The MEGALIGN program can compare two or more sequences according to different methods, such as the Clus ter method (Higgins, DG and PM Sharp (1988) Gene 73: 237-244). 0 The Clus ter method groups each group by checking the distance between all pairs. The sequences are arranged in clusters. The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula:
- the assay may be Jotun Hein percent identity between nucleic acid sequences Clus ter or a method well known in the art (Hein J., (1990) Methods in enzymology 183: 625-645) 0 "Similarity” refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
- Amino acids used for conservative substitution may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
- Antisense refers to a nucleotide sequence that is complementary to a particular DM or RM sequence.
- Antisense strand refers to a nucleic acid strand that is complementary to a “sense strand.”
- Derivative refers to HFP or a chemical modification of its nucleic acid. This chemical modification may be a substitution of a hydrogen atom with a fluorenyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
- Antibody refers to a complete antibody molecule and its fragments, such as Fa,? ( ⁇ ') 2 and? ⁇ It can specifically bind to the epitope of human ribosomal protein S18-14.
- a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
- isolated refers to the removal of a substance from its original environment (for example, its natural environment if it is naturally occurring).
- a naturally-occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
- Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not part of its natural environment, they are still isolated.
- isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
- polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances in the natural state .
- isolated human ribosomal protein S18-14 means that human ribosomal protein S18-14 is substantially free of other proteins, lipids, sugars, or other substances with which it is naturally associated. Those skilled in the art can purify human ribosomal protein S18-14 using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of the human ribosomal protein S18-14 peptide can be analyzed by amino acid sequence.
- the present invention provides a new polypeptide, human ribosomal protein S18-14, which is basically composed of the amino acid sequence shown in SEQ ID NO: 2.
- the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
- the polypeptide of the present invention may be a naturally purified product or a chemically synthesized product Or from recombinant cells using prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells). Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
- the invention also includes fragments, derivatives and analogs of the human ribosomal protein S18-14.
- fragment refers to a polypeptide that substantially retains the same biological function or activity of the human ribosomal protein S18-14 of the present invention.
- a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution
- the amino acid may or may not be encoded by a genetic codon; or ( ⁇ ) a type in which a group on one or more amino acid residues is replaced by another group to include a substituent; or ( ⁇ ⁇ )
- Such a polypeptide sequence in which the mature polypeptide is fused with another compound such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol
- a polypeptide sequence in which an additional amino acid sequence is fused into the mature polypeptide (Such as the leader or secretory sequence or the sequence used to purify the polypeptide or protease sequence).
- such fragments, derivatives and analogs are considered to be within the knowledge of those skilled in the art.
- the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
- the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
- the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a full-length polynucleotide sequence of 2645 bases, and its open reading frames 450-842 encode 130 amino acids.
- the polynucleotide of the present invention may be in the form of DM or RNA.
- DNA forms include cDNA, genomic DNA, or synthetic DM.
- DNA can be single-stranded or double-stranded.
- DM can be coded or non-coded.
- the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
- a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
- the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
- polynucleotide encoding a polypeptide means including a polynucleotide encoding the polypeptide and including additional Coding and / or non-coding polynucleotides.
- the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
- Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
- an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
- the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity, between the two sequences).
- the present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions.
- “strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60 ° C; or (2) Add denaturants during hybridization, such as 50% (v / v) formamide, 0.1 ° / »calf serum / 0.1% F i col l, 42 ° C, etc .; or (3) only in two Sequences do not hybridize until they have at least 95% identity, and more preferably 97% or more.
- the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
- nucleic acid fragments that hybridize to the sequences described above.
- a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 nuclei. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques, such as PCR, to identify and / or isolate polynucleotides encoding human ribosomal protein S18-14.
- polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
- the specific polynucleotide sequence encoding the human ribosomal protein S18-14 of the present invention can be obtained by various methods.
- polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
- the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.
- genomic DNA isolation is the least commonly used. Direct chemical synthesis of DM sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences.
- the standard method for isolating the CDM of interest is to isolate mRM from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage CDM library.
- mMA plasmid or phage CDM library.
- kits are also commercially available (Qiagene).
- the construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manua 1, Cold Spring Harbor Laboratory. New York, 1989).
- Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
- genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DNA-RNA hybridization; (2) the presence or absence of marker gene functions; (3) determination of the level of the transcript of human ribosomal protein S18-14; ( 4) Detecting gene-expressed protein products by immunological techniques or by measuring biological activity. The above methods can be used singly or in combination.
- the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
- the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
- the probe used here is generally a DNA sequence chemically synthesized based on the gene sequence information of the present invention.
- the genes or fragments of the present invention can of course be used as probes.
- DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
- immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) can be used to detect the protein products of human ribosomal protein S 18-14 gene expression.
- ELISA enzyme-linked immunosorbent assay
- a method (Sa iki, et al. Science 1985; 230: 1350-1 354) using PCR technology to amplify DNA / RNA is preferably used to obtain the gene of the present invention.
- the RACE method RACE-Rapid Amplification of cDNA Ends
- the primers for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein Select and synthesize using conventional methods.
- the amplified DM / RNA fragment can be isolated and purified by conventional methods such as by gel electrophoresis.
- polynucleotide sequence of the gene of the present invention or various DM fragments and the like obtained as described above can be measured by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, sequencing needs to be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
- the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using a human ribosomal protein S18-14 coding sequence, and a recombinant technology for producing a polypeptide of the present invention. method.
- the polynucleotide sequence encoding human ribosomal protein S18-14 can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
- vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
- Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al.
- any plasmid and vector can be used to construct a recombinant expression vector.
- An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
- Methods known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding human ribosomal protein S18-14 and appropriate transcription / translation regulatory elements. These methods include in vitro recombinant DNA technology, DNA synthesis technology, in vivo recombination technology, etc. (Sambroook, et al. Molecular Cloning, a Laboratory Manua, Cold Spring Harbor Laboratory. New York, 1989).
- the DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis. Representative examples of these promoters are: the lac or trp promoter of E.
- the expression vector also includes a ribosome binding site for translation initiation, a transcription terminator, and the like. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers and adenovirus enhancers on the late side of the origin of replication.
- the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
- selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
- GFP fluorescent protein
- tetracycline or ampicillin resistance for E. coli.
- a polynucleotide encoding human ribosomal protein S18-14 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a genetically engineered host cell containing the polynucleotide or a recombinant vector.
- the term "host cell” refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E.
- coli Streptomyces
- bacterial cells such as Salmonella typhimurium
- fungal cells such as yeast
- plant cells such as fly S2 or Sf 9
- animal cells such as CH0, COS or Bowes melanoma cells.
- Transformation of a host cell with a D sequence according to the present invention or a recombinant vector containing the DM sequence can be performed using conventional techniques well known to those skilled in the art.
- the host is a prokaryote such as E. coli
- Competent cells that absorb DM can be harvested after the exponential growth phase and treated with the CaCl 2 method.
- the steps used are well known in the art.
- MgCl 2 is used.
- transformation can also be performed by electroporation.
- the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
- polynucleotide sequence of the present invention can be used to express or produce recombinant human ribosomal protein S18-14 (Science, 1984; 224: 1431). Generally, the following steps are taken:
- the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
- a suitable method such as temperature conversion or chemical induction
- the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If necessary, the recombinant protein can be isolated and purified by various separation methods using its physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
- conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid
- polypeptides of the present invention as well as antagonists, agonists and inhibitors of the polypeptides, can be directly used in the treatment of diseases, for example, they can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection, and immune diseases.
- Ribosome protein S18 is one of the proteins in the small ribosomal subunit. The most important point of the role of ribosomal protein S18 is that it is related to the binding of aminoacyl-tRNA on the ribosome, which has extremely important regulatory significance for the role of the A site of the ribosome. It plays a very important role in the correct tRNA selection in the initial stage of protein synthesis.
- the S18 protein can select the correct tRNA to bind to small ribosomal subunits to avoid mismatches, which is directly related to the stability of the passage of the organism. And the loss of ribosomal protein will lead to slower cell growth. It can be seen that the abnormal expression of the specific S18 family protein mot if will cause the polypeptide of the present invention containing the mot if to malfunction, which will lead to mistranslation of mRNA and produce related diseases such as tumors, embryo development disorders, growth and development. Obstacles, etc.
- the abnormal expression of the human ribosomal protein S18-14 of the present invention will produce various diseases, especially embryonic developmental disorders, growth and development disorders, various tumors, and inflammation. These diseases include, but are not limited to:
- Embryonic developmental disorders congenital abortion, cleft palate, facial oblique fissure, limb absentness, limb differentiation disorder, gastrointestinal atresia or stenosis, hyaline membrane disease, atelectasis, polycystic kidney disease, ectopic kidney, double ureter, cryptorchidism , Congenital inguinal hernia, double uterus, vaginal atresia, hypospadias, hermaphroditism, atrial septal defect, ventricular septal defect, pulmonary stenosis, arterial duct occlusion, neural tube defect, congenital hydrocephalus, iris defect, congenital Cataract, congenital glaucoma or cataract, congenital deafness
- Growth disorders mental retardation, cerebral palsy, mental retardation, familial JI [neuronal dysplasia syndrome, strabismus, skin, fat, and muscular dysplasia disorders such as congenital skin laxity, Alzheimer's disease, congenital keratosis, various metabolic defects such as various amino acid metabolic defects, stunting, dwarfism, sexual retardation
- Tumors of various tissues gastric cancer, liver cancer, lung cancer, esophageal cancer, breast cancer, leukemia, lymphoma, thyroid tumor, uterine fibroids, neuroblastoma, astrocytoma, ependymoma, glioblastoma, Colon cancer, malignant histiocytosis, bladder cancer, bone cancer, osteosarcoma, myeloma, bone marrow cancer, brain cancer, uterine cancer, endometrial cancer, gallbladder cancer, thymic tumor, nasal cavity and sinus cancer, nasopharyngeal cancer, larynx Cancer, tracheal tumor, pleural mesothelioma, fibroid, fibrosarcoma, lipoma, liposarcoma, leiomyoma various inflammations: allergic reaction, adult respiratory distress syndrome, pulmonary eosinophilia, Phoenix Arthritis, rheumatoid arthritis, osteoarthriti
- the abnormal expression of the human ribosomal protein S18-14 of the present invention will also produce certain hereditary, hematological and immune system diseases.
- the invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) human ribosomal protein S18-14.
- Agonists enhance biological functions such as human ribosomal protein S18-14 to stimulate cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
- mammalian cells or membrane preparations expressing human ribosomal protein S18-14 can be cultured with labeled human ribosomal protein S18-14 in the presence of a drug. The ability of the drug to increase or block this interaction is then determined.
- Antagonists of human ribosomal protein S18-14 include antibodies, compounds and receptor deletions And the like. Antagonists of human ribosomal protein S18-14 can bind to human ribosomal protein S18-14 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot exert its biology Features.
- human ribosomal protein S18-14 can be added to bioanalytical assays to determine whether a compound is a compound by measuring the effect of the compound on the interaction between human ribosomal protein S18-14 and its receptor. Antagonist. Receptor deletions and analogs that act as antagonists can be screened in the same way as for screening compounds described above. Polypeptide molecules capable of binding to human ribosomal protein S18-14 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. When screening, the human ribosomal protein S 18-14 molecule should generally be labeled.
- the present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies.
- the invention also provides antibodies against the human ribosomal protein S18-14 epitope. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments generated from Fab expression libraries.
- Polyclonal antibodies can be produced by injecting human ribosomal protein S18-14 directly into immunized animals (such as rabbits, mice, rats, etc.).
- immunized animals such as rabbits, mice, rats, etc.
- a variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's Agent.
- Techniques for preparing monoclonal antibodies to human ribosomal protein S18-14 include, but are not limited to, hybridoma technology (Kohler and Mistein. Nature, 1975, 256: 495-497), triple tumor technology, human beta-cell hybridoma technology , EBV-hybridoma technology, etc.
- Chimeric antibodies that bind human constant regions to non-human variable regions can be produced using existing techniques (Morrison et al, PNAS, 1985, 81: 6851).
- the existing technology for producing single chain antibodies (U. S. Pat No. 4946778) can also be used to produce single chain antibodies against human ribosomal protein
- Antibodies against human ribosomal protein S18-14 can be used in immunohistochemistry to detect human ribosomal protein S18-14 in biopsy specimens.
- Monoclonal antibodies that bind to human ribosomal protein S18-14 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
- Antibodies can also be used to design immunotoxins against a specific bead site in the body.
- human ribosomal protein S18-14 high affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
- a common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
- This hybrid antibody can be used to kill human ribosomal protein S18-14 positive cell.
- the antibodies in the present invention can be used to treat or prevent diseases related to human ribosomal protein S18-14. Administration of an appropriate dose of antibody can stimulate or block the production or activity of human ribosomal protein S18-14.
- the invention also relates to a diagnostic test method for quantitatively and locally detecting the level of human ribosomal protein S18-14.
- tests are well known in the art and include FISH assays and radioimmunoassays.
- the level of human ribosomal protein S18-14 detected in the test can be used to explain the importance of human ribosomal protein S18-14 in various diseases and to diagnose diseases in which human ribosomal protein S18-14 plays a role.
- polypeptide of the present invention can also be used for peptide mapping analysis.
- the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
- the polynucleotide encoding human ribosomal protein S18-14 can also be used for a variety of therapeutic purposes.
- Gene therapy technology can be used to treat abnormal cell proliferation, development or metabolism caused by the non-expression or abnormal / inactive expression of human ribosomal protein S18-14.
- Recombinant gene therapy vectors (such as viral vectors) can be designed to express variant human ribosomal protein S18-14 to inhibit endogenous human ribosomal protein S18-14 activity.
- a variant human ribosomal protein S18-14 may be a shortened human ribosomal protein S18-14 that lacks a signaling functional domain, and although it can bind to downstream substrates, it lacks signaling activity.
- the recombinant gene therapy vector can be used to treat diseases caused by abnormal expression or activity of human ribosomal protein S18-14.
- Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to transfer the polynucleotide encoding human ribosomal protein S18-14 into cells.
- Methods for constructing a recombinant viral vector carrying a polynucleotide encoding human ribosomal protein S18-14 can be found in existing literature (Sambrook, et al.).
- the recombinant polynucleotide encoding human ribosomal protein S18-14 can be packaged into liposomes and transferred into cells.
- Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
- a vector such as a virus, phage, or plasmid
- Oligonucleotides including antisense RNA and DM
- ribozymes that inhibit human ribosomal protein S18-14 mRNA are also within the scope of the present invention.
- a ribozyme is an enzyme-like RNA molecule that specifically decomposes specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation.
- Antisense R and DNA and ribozymes can be obtained by any existing RNA or A synthesis technology. For example, the technology of solid phase phosphate amide synthesis of oligonucleotides has been widely used.
- Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DM sequence encoding the RNA. This DNA sequence has been integrated downstream of the RNA polymerase promoter of the vector. In order to increase the stability of a nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the ribonucleoside linkages should use phosphate thioester or peptide bonds instead of phosphodiester bonds.
- the polynucleotide encoding human ribosomal protein S18-14 can be used for the diagnosis of diseases related to human ribosomal protein S18-14.
- the polynucleotide encoding human ribosomal protein S18-14 can be used to detect the expression of human ribosomal protein S18-14 or the abnormal expression of human ribosomal protein S18-14 in a disease state.
- the DNA sequence encoding human ribosomal protein S18-14 can be used to hybridize biopsy specimens to determine the expression of human ribosomal protein S18-14.
- Hybridization techniques include Southern blotting, Nor thern blotting, in situ hybridization, and the like. These techniques and methods are publicly available and mature, and related kits are commercially available.
- polynucleotides of the present invention can be used as probes to be fixed on a microarray or a DNA chip (also referred to as a "gene chip") for analyzing differential expression analysis and gene diagnosis of genes in tissues.
- Human ribosomal protein S18-14 specific primers can be used for RNA-polymerase chain reaction (RT-PCR) in vitro amplification to detect human ribosomal protein S18-14 transcripts.
- Detection of mutations in the human ribosomal protein S18-14 gene can also be used to diagnose human ribosomal protein S18-14-related diseases.
- Human ribosomal protein S18-14 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type human ribosomal protein S18-14 D sequence. Mutations can be detected using existing techniques such as Southern blotting, DM sequence analysis, PCR and in situ hybridization. In addition, mutations may affect the expression of proteins. Therefore, Nor thern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
- sequences of the invention are also valuable for chromosome identification. This sequence will specifically target a specific position on a human chromosome and can hybridize to it. Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for marking chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DNA sequences on a chromosome.
- a PCR primer (preferably 15-35bp) is prepared from the cDNA, and the sequence can be located on the chromosome. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
- PCR localization of somatic hybrid cells is a quick way to localize DM to specific chromosomes.
- oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
- Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and hybrid pre-selection to construct chromosome-specific cDM libraries.
- Fluorescent in situ hybridization of cDNA clones to metaphase chromosomes allows precise chromosomal localization in one step.
- FISH Fluorescent in situ hybridization
- the difference in cDNA or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in the chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDM sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).
- the poly'peptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
- suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
- the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
- the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
- a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
- these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell.
- the polypeptides of the invention can be used in combination with other therapeutic compounds.
- the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
- Human ribosomal protein S18-14 is administered in an amount effective to treat and / or prevent a specific indication.
- the amount and range of human ribosomal protein S18-14 to be administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician. Examples,
- RNA Human fetal brain total RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform.
- Poly (A) mRNA was isolated from total RM using Quik mRNA Isolat ion Kit (product of Qiegene). 2ug poly (A) mRNA is reverse transcribed to form cDNA.
- the Smart cDNA cloning kit purchased from Clontech
- the bacterial strain was formed into a cDNA library.
- Dye terminate cycle react ion sequencing kit Perkin-Elraer
- ABI 377 automatic sequencer Perkin-Elmer
- the determined cDNA sequence was compared with the existing public D-sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 0297a01 was new DNA.
- the inserted cDNA fragments contained in this clone were determined in both directions by synthesizing a series of primers.
- CDM was synthesized using fetal brain total RNA as a template and ol igo-dT as a primer for reverse transcription reaction. After purification with Qiagene's kit, PCR was performed using the following primers:
- Pr imerl 5'- GGAAGAGGGCAGGCGTGAGCAACC -3 '(SEQ ID NO: 3)
- Primer2 5'- TGCACAAACTGTAATCTGTTTTAT -3 '(SEQ ID NO: 4)
- Primerl is a forward sequence located at the 5th end of SEQ ID NO: 1, starting at lbp;
- Primer2 is the 3, terminal reverse sequence of SEQ ID NO: 1.
- Amplification conditions 50 mmol / L KCl, 10 mmol / L Tr is-HCl pH 8.5, 1.5 mmol / L MgCl 2 , 200 ⁇ dNTP, 1 Opmol primer, 1U Taq DNA polymerase in a reaction volume of 50 ⁇ 1 (Clontech).
- the reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) for 25 cycles under the following conditions: 94 ° C 30sec; 55. C 30sec; 72 ° C 2min.
- ⁇ -act in was set as a positive control and template blank was set as a negative control.
- the amplified product was purified using a QIAGEN kit and ligated to a pCR vector (Invitrogen) using a TA cloning kit.
- the DNA sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as 1-2645bp shown in SEQ ID NO: 1.
- the method includes acid sulfur Guanidinium cyanate phenol-chloroform extraction. That is, the tissue was homogenized with 4M guanidine isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1), centrifuge after mixing. The aqueous layer was aspirated, isopropanol (0.8 vol) was added and the mixture was centrifuged to obtain an R precipitate. The obtained RM precipitate was washed with 70% ethanol, dried and dissolved in water.
- RNA was synthesized by electrophoresis on a 1.2% agarose gel containing 20 mM 3- (N-morpholino) propanesulfonic acid (pH 7.0)-5 mM sodium acetate-IraM EDTA-2. 2M formaldehyde. It was then transferred to a nitrocellulose membrane.
- 32 P dATP Preparation 32 P- DNA probe labeled by the random primer Method - with cc.
- the DNA probe used was the PCR amplified human ribosomal protein S18-14 coding region sequence (450bp to 842bp) shown in FIG. 1.
- a 32P-labeled probe (about 2 x 10 6 cpm / ffll) was hybridized with a nitrocellulose membrane to which RNA was transferred at 42 ° C overnight in a solution containing 50% formamide-25raM KH 2 P0 4 (pH7. 4)-5 x SSC-5 x Denhardt's solution and 20 ( ⁇ g / ml salmon sperm DNA. After hybridization, the filter was washed in 1 x SSC-0.1% SDS at 55 ° C for 30 minutes. Then Phosphor Imager was used for analysis and quantification.
- Example 4 In vitro expression, isolation, and purification of recombinant ribosomal protein S18-14
- Pr imer3 5'- CCCCATATGATGGATAATTTGTTAATACAAGTG -3, (Seq ID No: 5)
- Pr imer4 5'- CATGGATCCCTATATTCCTCTGGTAACTCGGCC -3 '(Seq ID No: 6)
- Ndel and BamHI digestion sites respectively Points, followed by the coding sequences of the 5 'and 3' ends of the gene of interest, respectively.
- the Ndel and BamHI restriction sites correspond to the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865. 3) Selective endonuclease site.
- the PCR reaction was performed using the pBS-0297a01 plasmid containing the full-length target gene as a template.
- the PCR reaction conditions are as follows: a total volume of 50 ⁇ 1 contains 10 pg of pBS-0297a01 plasmid, primers? 1 ⁇ 63: -3 and? 1:]: [116]:-4 are 10 11101, Advantage polymerase Mix (Clontech) 1 ⁇ 1. Cycle parameters: 94 ° C 20s, 60. C 30s, 68 ° C 2 min, a total of 25 cycles. Ndel and BamHI were used to double digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase.
- the ligation product was transformed into E. coli DH5a by the calcium chloride method, and cultured overnight on LB plates containing kanamycin (final concentration 3 ( ⁇ g / ml)), and positive clones were selected by colony PCR method and sequenced. Positive sequence correct clone (PET-0297a01) was used to transform the recombinant plasmid into E. coli BL21 (DE3) plySs (product of Novagen) by calcium chloride method.
- peptides specific to human ribosomal protein S18-14 were synthesized using a peptide synthesizer (product of PE Company): NH2-Met-Asp-Asn-Leu-Leu-I le-Gln-Va l-Thr-Gly-Lys- Lys-Arg-Va l-Va l-C00H (SEQ ID NO: 7).
- the polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex, respectively.
- Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
- the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
- the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
- the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by using a filter hybridization method.
- Filter hybridization methods include dot blotting, Southern blotting, Northern blotting, and copying methods. They all use the same steps of hybridization after fixing the polynucleotide sample to be tested on the filter.
- the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer, so that the non-specific binding site of the sample on the filter is saturated with the carrier and the synthetic polymer.
- the pre-hybridization solution is then replaced with a hybridization buffer containing the labeled probe and incubated to hybridize the probe to the target nucleic acid.
- the unhybridized probes are removed by a series of membrane washing steps. In this embodiment, higher-intensity washing conditions (such as lower salt concentration and higher temperature) are used to reduce the hybridization background and retain only strong specific signals.
- the probes used in this embodiment include two types: The first type of probe Are oligonucleotide fragments that are completely identical or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are oligonucleotides that are partially identical or complementary to the polynucleotide SEQ ID NO: 1 of the present invention Acid fragments.
- the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
- oligonucleotide fragments from the polynucleotide SEQ ID NO: 1 of the present invention for use as hybridization probes should follow the following principles and several aspects to be considered:
- the preferred range of probe size is 18-50 nucleotides
- Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements For homology comparison of the regions, if the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, the primary probe should not be used generally;
- Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
- Probe 2 which belongs to the second type of probe, is equivalent to the replacement mutant sequence of the gene fragment of SEQ ID NO: 1 or its complementary fragment (41Nt):
- PBS phosphate buffered saline
- step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
- the sample membrane was placed in a plastic bag, and 3-1 Omg pre-hybridization solution (lOxDenhardt-s; 6xSSC, 0.1 mg / ral CT DNA (calf thymus DNA)) was added. After closing the bag, 68. C water bath for 2 hours.
- 3-1 Omg pre-hybridization solution (lOxDenhardt-s; 6xSSC, 0.1 mg / ral CT DNA (calf thymus DNA)
- Gene chip or gene microarray is a new technology currently being developed by many national laboratories and large pharmaceutical companies.
- the data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software to achieve the purpose of rapid, efficient, and high-throughput analysis of biological information.
- the polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research of new gene functions; search for and screen new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases .
- the specific method steps have been reported in the literature. For example, refer to the literature DeRi si, JL, Lyer, V. & Brown, P. 0. (1997) Science 278, 680-686. And the documents Helle, RA, Schema , M., Chai, A., Shalom, D., (1997) PNAS 94: 2150-2155.
- a total of 4,000 polynucleotide sequences of various full-length cDNAs are used as target DNA, including the polynucleotide of the present invention. They were respectively amplified by PCR. After the purified amplified product was purified, the concentration was adjusted to about 500 rig / ul, and spotted on a glass medium using a Cartesian 7500 spotter (purchased from Cartesian Company, USA). The distance between them is 280 ⁇ . The spotted slide was hydrated, dried, and cross-linked in a UV cross-linker. After elution, the plate was fixed on a glass slide to prepare a chip. The specific method steps have been reported in the literature. The sample post-processing steps in this embodiment are:
- Total mRNA was extracted from human mixed tissues and specific tissues (or stimulated cell lines) in one step, and mRNA was purified using Oligotex raRNA Midi Kit (purchased from QiaGen).
- Fluorescent reagent Cy3dUTP (5-Amino-propargyl-2--deoxyuridine 5--triphate coupled to Cy3 fluorescent dye, purchased from Amersham Pharaacia Biotech) was used to label the mRNA of human mixed tissue, and the fluorescent reagent Cy5dUTP (5-Amino- Propargyl- 2'-deoxyuridine 5 '-tr iphate coupled to Cy5 fluorescent dye, purchased from Amersham Phamacia Biotech, was used to label the mRNA of specific tissues (or stimulated cell lines) of the body, and probes were prepared after purification.
- fluorescent reagent Cy5dUTP (5-Amino- Propargyl- 2'-deoxyuridine 5 '-tr iphate coupled to Cy5 fluorescent dye
- the probes from the above two tissues and the chip were respectively hybridized in a UniHyb TM Hybridizat ion Solut ion (purchased from TeleChem) hybridization solution for 16 hours, and washed with a washing solution (1 SSC, 0.2% SDS) at room temperature. Scanning was performed with a ScanArray 3000 scanner (purchased from General Scanning, USA), and the scanned images were analyzed by Imagene software (Biodiscovery, USA) to calculate the Cy3 / Cy5 ratio of each point.
- the above specific tissues are thymus, testis, muscle, spleen, lung, skin, thyroid, liver, PMA + Ecv304 cell line, PMA-Ecv304 cell line, non-starved L02 cell line, L02 cell line stimulated by arsenic for 1 hour, L02 cell line stimulated by arsenic for 6 hours prostate, heart, lung cancer, fetal bladder, fetal small intestine, fetal large intestine, fetal thymus, fetal muscle, fetal liver, fetal kidney, fetal spleen, fetal brain, Fetal lung and fetal heart.
Landscapes
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Gastroenterology & Hepatology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Medicinal Chemistry (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Toxicology (AREA)
- Peptides Or Proteins (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
AU72304/01A AU7230401A (en) | 2000-05-09 | 2001-05-08 | A novel polypeptide, human ribosomal protein s18-14 and the polynucleotide encoding thereof |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN 00115636 CN1322750A (zh) | 2000-05-09 | 2000-05-09 | 一种新的多肽——人核糖体蛋白s18-14和编码这种多肽的多核苷酸 |
CN00115636.5 | 2000-05-09 |
Publications (1)
Publication Number | Publication Date |
---|---|
WO2001087971A1 true WO2001087971A1 (fr) | 2001-11-22 |
Family
ID=4585082
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/CN2001/000727 WO2001087971A1 (fr) | 2000-05-09 | 2001-05-08 | Proteine s18-14 ribosomale, polypeptide humain, et polynucleotide la codant |
Country Status (3)
Country | Link |
---|---|
CN (1) | CN1322750A (fr) |
AU (1) | AU7230401A (fr) |
WO (1) | WO2001087971A1 (fr) |
-
2000
- 2000-05-09 CN CN 00115636 patent/CN1322750A/zh active Pending
-
2001
- 2001-05-08 WO PCT/CN2001/000727 patent/WO2001087971A1/fr active Application Filing
- 2001-05-08 AU AU72304/01A patent/AU7230401A/en not_active Abandoned
Non-Patent Citations (2)
Title |
---|
CHAN Y.L. ET AL.: "The primary structure of rat ribosomal protein S18", BIOCHEM. BIOPHYS. RES. COMMUN., vol. 178, no. 3, 15 August 1991 (1991-08-15), pages 1212 - 1218 * |
TANAKA T. ET AL.: "The cloning and sequencing of ribosomal protein S18 of parasitic protoxoa, Entamoeba histolytica", DNA SEQ., vol. 8, no. 4, March 1998 (1998-03-01), pages 267 - 270 * |
Also Published As
Publication number | Publication date |
---|---|
AU7230401A (en) | 2001-11-26 |
CN1322750A (zh) | 2001-11-21 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
WO2001088084A2 (fr) | Nouveau polypeptide, superoxyde dismutase 11, et polynucleotide codant pour ce polypeptide | |
WO2001094529A2 (fr) | Nouveau polypeptide, serine hydrolase humaine atp-dependante 21, et polynucleotide codant pour ce polypeptide | |
WO2001087971A1 (fr) | Proteine s18-14 ribosomale, polypeptide humain, et polynucleotide la codant | |
WO2001046409A1 (fr) | Nouveau polypeptide, proteine ribosomale s7 9, et polynucleotide codant pour ce polypeptide | |
WO2001075048A2 (fr) | Nouveau polypeptide, proteine ribosomale humaine s11 23, et polynucleotide codant pour ce polypeptide | |
WO2001072793A1 (fr) | Nouveau polypeptide, proteine humaine de regulation 12 de la proteine hydrolase, et polynucleotide codant pour ce polypeptide | |
WO2001083687A2 (fr) | Nouveau polypeptide, proteine pax humaine 23, et polynucleotide codant pour ce polypeptide | |
WO2001070800A1 (fr) | Nouveau polypeptide, proteine humaine 11 helicase atp-dependante, et polynucleotide codant pour ce polypeptide | |
WO2001070956A1 (fr) | Nouveau polypeptide, proteine humaine de reparation 8 du mesappariement de l'adn, et polynucleotide codant pour ce polypeptide | |
WO2001079432A2 (fr) | Nouveau polypeptide, facteur humain de transcription de la differentiation cellulaire 58, et polynucleotide codant pour ce polypeptide | |
WO2001087963A1 (fr) | Proteine s18-12 ribosomale, polypeptide humain, et polynucleotide la codant | |
WO2001087967A1 (fr) | Proteine s18-26 ribosomale, polypeptide humain, et polynucleotide la codant | |
WO2001074881A1 (fr) | Nouveau polypeptide, proteine ribosomale humaine s18-10, et polynucleotide codant pour ce polypeptide | |
WO2001075100A1 (fr) | Nouveau polypeptide, proteine humaine de reparation 10 du mesappariement de l'adn, et polynucleotide codant pour ce polypeptide | |
WO2001048194A1 (fr) | Nouveau polypeptide, proteine ribosomale s18 13, et polynucleotide codant pour ce polypeptide | |
WO2001074895A1 (fr) | Nouveau polypeptide, facteur humain de transcription de la differentiation cellulaire 12.1, et polynucleotide codant pour ce polypeptide | |
WO2001090171A1 (fr) | Nouveau polypeptide, proteine humaine ribosomale sii 12, et polynucleotide codant ce polypeptide | |
WO2001047973A1 (fr) | Nouveau polypeptide, proteine 14 associee a la vesicule a gaz, et polynucleotide codant pour ce polypeptide | |
WO2001075044A2 (fr) | Nouveau polypeptide, proteine ribosomale humaine s18-18, et polynucleotide codant pour ce polypeptide | |
WO2001087962A1 (fr) | Nouveau polypeptide, proteine pax humaine 11, et polynucleotide codant ce polypeptide | |
WO2001075126A1 (fr) | Nouveau polypeptide, proteine ribosomale humaine s18-9, et polynucleotide codant pour ce polypeptide | |
WO2001046235A1 (fr) | Nouveau polypeptide, proteine ribosomale s3 17, et polynucleotide codant pour ce polypeptide | |
WO2001081396A1 (fr) | Nouveau polypeptide, proteine ribosomale s7 humaine 14, et polynucleotide codant pour ce polypeptide | |
WO2001047964A1 (fr) | Nouveau polypeptide, helicase atp-dependante 68, et polynucleotide codant pour ce polypeptide | |
WO2001087966A1 (fr) | Nouveau polypeptide, proteine pax humaine 22, et polynucleotide codant pour ce polypeptide |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A1 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
122 | Ep: pct application non-entry in european phase | ||
NENP | Non-entry into the national phase |
Ref country code: JP |