WO2001046235A1 - Nouveau polypeptide, proteine ribosomale s3 17, et polynucleotide codant pour ce polypeptide - Google Patents

Nouveau polypeptide, proteine ribosomale s3 17, et polynucleotide codant pour ce polypeptide Download PDF

Info

Publication number
WO2001046235A1
WO2001046235A1 PCT/CN2000/000570 CN0000570W WO0146235A1 WO 2001046235 A1 WO2001046235 A1 WO 2001046235A1 CN 0000570 W CN0000570 W CN 0000570W WO 0146235 A1 WO0146235 A1 WO 0146235A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
protein
polynucleotide
ribosomal
sequence
Prior art date
Application number
PCT/CN2000/000570
Other languages
English (en)
Chinese (zh)
Inventor
Yumin Mao
Yi Xie
Original Assignee
Fudan University
Shanghai Bio Door Gene Technology Ltd.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Fudan University, Shanghai Bio Door Gene Technology Ltd. filed Critical Fudan University
Priority to AU19843/01A priority Critical patent/AU1984301A/en
Publication of WO2001046235A1 publication Critical patent/WO2001046235A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
    • C12N9/1205—Phosphotransferases with an alcohol group as acceptor (2.7.1), e.g. protein kinases
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • the present invention belongs to the field of biotechnology. Specifically, the present invention describes a novel polypeptide, ribosome S 3 protein 17, and a polynucleotide sequence encoding the polypeptide. The invention also relates to the preparation method and application of the polynucleotide and polypeptide.
  • the correct translation of proteins is very important for all bacteria and higher organisms.
  • the research on the regulation mechanism of protein translation is obtained from E. coli.
  • the protein translation process is mainly completed by various aminoacyl-tRNA synthetases, various tRNAs, and ribosomes.
  • the ribosome and other cofactors together provide the full enzymatic activity of the translation process. These enzyme activities are only in the ribose Only when the overall structure of the body is complete. Therefore, the ribosome and its constituent subunits work synergistically in the body and play important physiological functions.
  • Ribosomal protein S 3 is one of the proteins in the small ribosomal subunit. It binds to the starting Me t-tRNA and contains approximately 209-559 amino acid residues.
  • the S 3 family contains a conserved motif at the C-terminus.
  • the conservative motif model is: family, which contains one [GSTA]-[KR] -X (6) -GX- [LIVMT] — x (2)- [NQSCH] -x (1, 3)-[LIVFCA] -x (3)-
  • S3 family proteins are involved in functions such as protein synthesis and DNA repair. It may be involved in the initiation of peptide chain synthesis, specifically, it may be involved in the formation of the peptide amino acid Met-t RNA, which is involved in the initiation of translation, and can be combined with the initiation factors e IF-2 and e IF-3. It is also related to the formation of ribosome-mRNA-aminoacyl tRNA complex.
  • AP endonuclease I can play the role of catalytic removal of AP site 3 and end in damaged DNA. It is used to treat dry skin disease One of seven groups, the disease is caused by ultra-violet radiation.
  • the protein expressed by the new gene may play an important role in DNA repair before it is integrated into the ribosome.
  • it may have N-glycosylation activity. Most N-glycosylation enzymes act on oxidatively damaged purines and pyrimidines, and have AP lyase activity. In addition, it may be related to the infinite proliferation of cells, because it is found to have transitional expression in some cancer cells.
  • ribosomal S 3 protein 17 protein plays an important role in important body functions as described above, and it is believed that a large number of proteins are involved in these regulatory processes, there has been a need in the art to identify more ribosomal S 3 protein 17 involved in these processes. Protein, especially the amino acid sequence of this protein.
  • Neoribosomal S 3 egg Isolation of the gene encoding the protein II also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so isolating its coding DNA is very important.
  • Another object of the invention is to provide a polynucleotide encoding the polypeptide.
  • Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding a ribosome S3 protein 17.
  • Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding a ribosome S3 protein 17.
  • Another object of the present invention is to provide a method for producing ribosomal S3 protein 17.
  • Another object of the present invention is to provide an antibody against the ribosomal S3 protein 17 of the polypeptide of the present invention.
  • Another object of the present invention is to provide mimetic compounds, antagonists, agonists, and inhibitors against the polypeptide of the present invention-ribosomal S3 protein 17.
  • Another object of the present invention is to provide a method for diagnosing and treating diseases associated with abnormalities of ribosomal S3 protein 17.
  • the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
  • the polypeptide is a polypeptide having the amino acid sequence of SEQ ID D0: 2.
  • the invention also relates to an isolated polynucleotide, which comprises a nucleotide sequence or a variant thereof selected from the group-.
  • sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 354-827 in SEQ ID NO: 1; and (b) having a sequence of 1-1924 in SEQ ID NO: 1 Sequence of bits.
  • the invention further relates to a vector, in particular an expression vector, containing the polynucleotide of the invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; and a method comprising culturing said Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
  • a vector in particular an expression vector, containing the polynucleotide of the invention
  • a host cell genetically engineered with the vector including a transformed, transduced or transfected host cell
  • a method comprising culturing said Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
  • the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
  • the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of ribosomal S3 protein 17 protein, which comprises utilizing the polypeptide of the invention.
  • the invention also relates to compounds obtained by this method.
  • the invention also relates to a method for detecting a disease or disease susceptibility associated with abnormal expression of ribosomal S 3 protein 17 protein in vitro, which comprises detecting a mutation in the polypeptide or a polynucleotide sequence encoding the same in a biological sample, or detecting a biological The amount or biological activity of a polypeptide of the invention in a sample.
  • the invention also relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
  • the present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention in the preparation of a medicament for treating cancer, developmental disease or immune disease or other diseases caused by abnormal expression of ribosomal S 3 protein 17.
  • Fig. 1 is a comparison diagram of amino acid sequence homology of the characteristic sequence of ribosomal S3 protein of the ribosome S3 protein 17 at 29-114 in the present invention at 29-114.
  • the upper sequence is ribosomal S 3 protein 17, and the lower sequence is the characteristic sequence domain of ribosome S3 protein.
  • ⁇ "and”: "" and ".” Indicate that the probability of the same amino acid appearing between two sequences decreases in sequence.
  • Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of the isolated ribosomal S 3 protein 17.
  • 17KDa is the molecular weight of the protein.
  • the arrow indicates the isolated protein band.
  • Nucleic acid sequence refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
  • amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
  • amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
  • a protein or polynucleotide “variant” refers to an amino acid sequence having one or more amino acids or nucleotide changes, or a polynucleotide sequence encoding it. The changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence. Variants can have "conservative" changes, where substitutions Amino acids have similar structural or chemical properties as the original amino acids, such as replacing isoleucine with leucine. Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
  • “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
  • Insertion means that a change in the amino acid sequence or nucleotide sequence results in an increase in one or more amino acids or nucleotides compared to a molecule that exists in nature.
  • Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
  • Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
  • immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response and to bind specific antibodies in a suitable animal or cell.
  • An "agonist” refers to a molecule that, when combined with ribosomal S 3 protein II, can cause the protein to change, thereby regulating the activity of the protein.
  • An agonist may include a protein, a nucleic acid, a carbohydrate or any other molecule that can bind to ribosomal S 3 protein 17.
  • Antagonist refers to a molecule that can block or regulate the biological or immunological activity of ribosomal S 3 protein 17 when bound to ribosomal S 3 protein II.
  • Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates or any other molecule that can bind to ribosomal S3 protein 17.
  • ribosomal S 3 protein 17 refers to a change in the function of ribosomal S 3 protein 17, including an increase or decrease in protein activity, a change in binding characteristics, and any other biological, functional, or immune properties of ribosome S 3 protein 17 .
  • substantially pure ' means substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated.
  • Those skilled in the art can purify ribosomal S 3 protein 17 using standard protein purification techniques. Basically Pure ribosomal S 3 protein 17 can generate a single main band on a non-reducing polyacrylamide gel. The purity of ribosomal S 3 protein ⁇ polypeptide can be analyzed by amino acid sequence.
  • Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
  • sequence C-T-G-A
  • complementary sequence G-A-C-T
  • the complementarity between two single-stranded molecules can be partial or complete.
  • the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
  • “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
  • Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Sou thern blot or Nor the rn blot, etc.) under conditions of reduced stringency.
  • Substantially homologous sequences or hybridization probes can compete and inhibit the binding of completely homologous sequences to the target sequence under conditions of reduced stringency. This does not imply that conditions with reduced stringency allow Non-specific binding is possible because conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.
  • Percent identity refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as through the MEGALIGN program (Lasergene sof tware package, DNASTAR, Inc., Madi son Wis.). 0 The MEGALIGN program can compare two or more sequences according to different methods, such as the Clus ter method ( H i gg ins, DG and PM Sharp (1988)
  • the Cluster method arranges groups of sequences into clusters by checking the distance between all pairs. The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by:
  • the number of residues in sequence ⁇ -the number of spacer residues in sequence ⁇ -the number of spacer residues X in sequence ⁇ can also be determined by the C l ter method or using methods known in the art such as Jo tun He in. Sex percentage (He in J., (1990) Methods in enzymo ogy 183: 625-645).
  • Similarity refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
  • Amino acids used for conservative substitution for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
  • Antisense refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence.
  • the "antisense strand” refers to a nucleic acid strand that is complementary to the “sense strand”.
  • Derivative refers to HFP or a chemical modification of its nucleic acid. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
  • Antibody refers to an intact antibody molecules and fragments thereof, such as Fa, F (a b ') 2 and F V, which specifically binds to the ribosomal protein antigens S3 17 determinant.
  • a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
  • isolated refers to the removal of a substance from its original environment (for example, its natural environment if it occurs naturally).
  • a naturally occurring polynucleotide or polypeptide is not isolated when it is present in a living animal, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
  • Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not its natural environment The ingredients, they are still separated.
  • isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
  • polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances existing in the natural state. .
  • isolated ribosomal S3 protein 17 means that ribosomal S3 protein 17 is substantially free of other proteins, lipids, sugars, or other substances with which it is naturally associated. Those skilled in the art can purify ribosomal S3 protein 17 using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of ribosomal S 3 protein 17 peptide can be analyzed by amino acid sequence.
  • the present invention provides a new polypeptide, ribosomal S3 protein 17, which is basically composed of the amino acid sequence shown in SEQ ID NO: 2.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
  • the polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques. Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
  • the invention also includes fragments, derivatives and analogs of ribosomal S3 protein 17.
  • fragment refers to a polypeptide that substantially retains the same biological function or activity of the ribosome S3 protein 17 of the invention.
  • a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a type in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution The amino acid may or may not be encoded by a genetic codon; or (II) such a type in which a group on one or more amino acid residues is substituted by another group to include a substituent; or (III) such A type in which a mature polypeptide is fused to another compound (such as a compound that extends the half-life of a polypeptide, such as polyethylene glycol); or (IV) a type of polypeptide sequence in which an additional amino acid sequence is fused into a mature polypeptide (such as the leader sequence or secreted sequence or the sequence used to purify this polypeptide or protease sequence) As explained herein, such fragments, derivatives and analogs are considered to be within the knowledge of those skilled in the art.
  • the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
  • the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a polynucleotide sequence of 1924 bases in length and its open reading frames 354-827 encode 157 amino acids.
  • This polypeptide has the characteristic sequence of ribosomal S3 protein, and it can be deduced that ribosomal S3 protein 17 has ribosome S3 protein Structure and function represented by white feature sequences.
  • the polynucleotide of the present invention may be in the form of DNA or RNA.
  • DNA forms include cDNA, genomic DNA or synthetic DNA.
  • DNA can be single-stranded or double-stranded.
  • DNA can be coding or non-coding.
  • the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
  • a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
  • the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
  • polynucleotide encoding a polypeptide refers to a polynucleotide that includes the polypeptide and a polynucleotide that includes additional coding and / or non-coding sequences.
  • the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
  • This polynucleotide variant can be a naturally occurring allelic variant or a non-naturally occurring variant.
  • These nucleotide variants include substitution variants, deletion variants, and insertion variants.
  • an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but which does not substantially alter the polypeptides it encodes.
  • the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity between the two sequences).
  • the present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions.
  • “strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60 ° C; or (2) Add denaturants during hybridization, such as 50% (v / v) formamide, 0.1Vj, bovine serum / 0.1% Fi co ll, 42 ° C, etc .; or (3) only between two sequences Hybridization occurs only when the identity is at least 95%, and more preferably 97%.
  • the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
  • nucleic acid fragments that hybridize to the sequences described above.
  • a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, most preferably at least 100 More than nucleotides.
  • Nucleic acid fragments can also be used in nucleic acid amplification techniques, such as PCR, to identify and / or isolate polynucleotides encoding ribosomal S3 protein 17.
  • polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
  • the specific polynucleotide sequence encoding ribosomal S 3 protein 17 of the present invention can be obtained by various methods.
  • polynucleotides are isolated using hybridization techniques well known in the art. These technologies include, but are not limited to: 1) Hybridize a probe with a genomic or cDNA library to detect homologous polynucleotide sequences, and 2) screen antibodies for the expression library to detect cloned polynucleotide fragments with common structural characteristics.
  • the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.
  • genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences.
  • the standard method for isolating the cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library.
  • mRNA extraction There are many mature techniques for mRNA extraction, and kits are also commercially available (Qiagene).
  • the construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989).
  • Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
  • genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DNA-RNA hybridization; (2) the presence or absence of a marker gene function; (3) determination of the level of the ribosomal S3 protein 17 transcript; (4) Detection of gene-expressed protein products by immunological techniques or determination of biological activity. The above methods can be used singly or in combination.
  • the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and has a length of at least 10 nucleotides, preferably at least 3G nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
  • the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
  • the probe used here is usually a DNA sequence chemically synthesized based on the gene sequence information of the present invention.
  • the genes or fragments of the present invention can of course be used as probes.
  • DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
  • immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) can be used to detect the protein product of ribosomal S3 protein 17 gene expression.
  • ELISA enzyme-linked immunosorbent assay
  • a method using PCR technology to amplify DNA / RNA is preferably used to obtain the gene of the present invention.
  • the RACE method RACE-rapid cDNA end rapid amplification method
  • the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Select and synthesize using conventional methods.
  • the amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
  • polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. For full-length CDM Sequence, sequencing needs to be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
  • the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using a ribosome S3 protein 17 coding sequence, and a method for producing a polypeptide of the present invention by recombinant technology. .
  • a polynucleotide sequence encoding ribosomal S3 protein 17 may be inserted into a vector to form a recombinant vector containing the polynucleotide of the present invention.
  • vector refers to bacterial plasmids, bacteriophages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses or other vectors well known in the art.
  • Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors expressed in bacteria (Rosenberg, et al.
  • any plasmid and vector can be used to construct a recombinant expression vector.
  • An important feature of expression vectors is that they usually contain origins of replication, promoters, marker genes, and translational regulatory elements.
  • Methods well known to those skilled in the art can be used to construct expression vectors containing DM sequences encoding ribosomal S3 protein 17 and appropriate transcription / translation regulatory elements. These methods include in vitro recombinant DNA technology, DNA synthesis technology, and in vivo recombination technology (Sambroook, et al. Molecular Cloning, a Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989).
  • the DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide mRM synthesis. Representative examples of these promoters are: the lac or trp promoter of E.
  • the expression vector also includes a ribosome binding site for translation initiation, a transcription terminator, and the like. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers and adenovirus enhancers on the late side of the origin of replication.
  • the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • GFP fluorescent protein
  • tetracycline or ampicillin resistance for E. coli.
  • a polynucleotide encoding ribosomal S3 protein 17 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a genetically engineered host cell containing the polynucleotide or the recombinant vector.
  • the term "host cell” refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E.
  • coli Streptomyces
  • bacterial cells such as Salmonella typhimurium
  • fungal cells such as yeast
  • plant cells such as insect cells such as Fly S2 or Sf9
  • animal cells such as CH0, COS or Bowes melanoma cells.
  • Transformation of a host cell with a DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art.
  • the host is a prokaryote, such as E. coli
  • competent cells capable of absorbing DNA can be harvested after the exponential growth phase and treated with the CaCl 2 method.
  • the steps used are well known in the art.
  • the alternative is to use MgC l 2 .
  • transformation can also be performed by electroporation.
  • the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
  • the polynucleotide sequence of the present invention can be used to express or produce recombinant ribosomal S3 protein 17 (Science, 1984; 224: 1431). Generally there are the following steps:
  • the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
  • a suitable method such as temperature conversion or chemical induction
  • the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If necessary, the recombinant protein can be isolated and purified by various separation methods using its physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
  • conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid
  • the polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection and immune diseases.
  • the correct translation of proteins requires the cooperation of various aminoacyl-tRNA synthetases, various tRNAs, and ribosomes. Ribosomes and other cofactors together provide the full enzymatic activity of the translation process. These enzyme activities are only in the ribosome. Only if the overall structure is complete. Ribosomal protein S3 is one of the proteins in the small subunit of the ribosome. It binds to the starting Met-tRNA.
  • S3 family proteins are involved in functions such as protein synthesis and DNA repair. May be involved in the initiation of peptide chain synthesis, specifically the formation of the amino acid Met-t RNA, which may be involved in the initiation of translation, and can participate in the initiation of translation, and can be combined with the initiation factors e IF-2 and e IF-3 . And it is related to the formation of ribosome-mRNA-aminoacyl tRNA complex.
  • S 3 family proteins may have AP endonuclease I activity and UV endonuclease III activity.
  • AP endonuclease I can play a role in catalysing the excision of AP site 3 and end in damaged DNA.
  • it may have N-glycosylation activity.
  • Most N-glycosylation enzymes act on oxidatively damaged purines and pyrimidines, and have AP lyase activity. It may also be related to the immortal proliferation of the cell, as it is found to have transient expression in some cancer cells.
  • the abnormal expression of the specific S3 family protein mot if will cause the malfunction of the polypeptide containing the S 3 family protein motif of the present invention, resulting in the loss of DNA repair function and the activity of its AP endonuclease I And / or UV endonuclease III activity abnormalities, and cause related diseases such as tumors, embryonic development disorders, growth and development disorders.
  • the abnormal expression of the ribosomal S 3 protein 17 of the present invention will produce various diseases, especially skin dryness, various tumors, embryonic development disorders, and growth and development disorders. These diseases include, but are not limited to:
  • Tumors of various tissues skin melanoma, gastric cancer, liver cancer, lung cancer, esophageal cancer, breast cancer, leukemia, lymphoma, thyroid tumor, uterine fibroids, neuroblastoma, astrocytoma, ependymoma, glue Cytoplasmoma, colon cancer, malignant histiocytosis, melanoma, teratoma, sarcoma, adrenal cancer, bladder cancer, bone cancer, osteosarcoma, myeloma, bone marrow cancer, brain cancer, uterine cancer, endometrial cancer, Gallbladder cancer, colon cancer, thymic tumor, nasal cavity and sinus tumor, nasopharyngeal cancer, laryngeal cancer, tracheal tumor, pleural mesothelioma, fibroid, fibrosarcoma, lipoma, liposarcoma, leiomyoma
  • Embryonic developmental disorders congenital abortion, cleft palate, facial oblique fissure, cervical sac, cervical fistula, limb absentness, limb differentiation disorder, gastrointestinal atresia or stenosis, ileum diverticulum, umbilical fistula, congenital umbilical hernia, congenital nervelessness Megalocolic colon, laryngotracheal stenosis or atresia, tracheoesophageal fistula, hyaline membrane disease, congenital pulmonary cyst, atelectasis, polycystic kidney, ectopic kidney, horse telluride, double ureter, umbilical fistula, cryptorchidism, congenital Inguinal hernia, double uterus, vaginal atresia, hypospadias, hermaphroditism, atrial septal defect, ventricular septal defect, abnormal separation of arterial stem, aortic or pulmonary
  • Growth and development disorders mental retardation, cerebral palsy, brain development disorders, mental retardation, familial cerebral nucleus dysplasia syndrome, strabismus, skin, fat and muscular dysplasia such as congenital skin laxity, premature aging Disease, congenital keratosis, various metabolic defects such as various amino acid metabolic defects, stunting, dwarfism, sexual retardation
  • Abnormal expression of the ribosomal S3 protein 17 of the present invention will also produce certain hereditary, hematological and immune system diseases.
  • polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat various diseases, especially dry skin disease, various tumors, embryonic developmental disorders, and developmental disorders. Diseases, certain hereditary, hematological and immune system diseases.
  • the invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) ribosomal S3 protein 17.
  • Agonists increase ribosomal S3 protein 17 to stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
  • mammalian cells or membrane preparations expressing ribosomal S3 protein 17 can be cultured together with labeled ribosomal S3 protein 17 in the presence of drugs. The ability of the drug to increase or block this interaction is then determined.
  • Antagonists of ribosomal S3 protein 17 include screened antibodies, compounds, receptor deletions, and the like. Antagonists of ribosomal S3 protein 17 can bind to ribosome S3 protein 17 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot perform biological functions.
  • ribosomal S3 protein 17 can be added to the bioanalytical assay to determine whether the compound is an antagonist by measuring the effect of the compound on the interaction between ribosomal S3 protein 17 and its receptor. Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds.
  • Polypeptide molecules capable of binding to ribosomal S3 protein 17 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. When screening, 17 molecules of ribosomal S3 protein should generally be labeled.
  • the present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies.
  • the invention also provides antibodies directed against the ribosome S3 protein 17 epitope. These antibodies include (but are not limited to): Doklon antibodies, monoclonal antibodies, chimeric antibodies, single-chain antibodies, Fab fragments, and fragments from Fab expression libraries.
  • Polyclonal antibodies can be produced by injecting ribosomal S3 protein 17 directly into immunized animals (such as rabbits, small Rat, rat, etc.), a variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's adjuvant.
  • immunized animals such as rabbits, small Rat, rat, etc.
  • adjuvants can be used to enhance the immune response, including but not limited to Freund's adjuvant.
  • Techniques for preparing monoclonal antibodies against ribosomal S3 protein 17 include, but are not limited to, hybridoma technology (ohler and Milstein. Nature, 1975, 256: 495-497), triple tumor technology, human beta-cell hybridoma technology, and EBV-hybridization Tumor technology, etc.
  • Chimeric antibodies that bind human constant regions and non-human variable regions can be produced using existing techniques (Morrison et al, PNAS, 1985, 81: 6851). And existing techniques for producing single-chain antibodies (US Pat No. .4946778) can also be used to produce single chain antibodies against ribosomal S3 protein 17.
  • Antibodies against ribosomal S3 protein 17 can be used in immunohistochemical techniques to detect ribosome S3 protein 17 in biopsy specimens.
  • Monoclonal antibodies that bind to ribosomal S3 protein 17 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
  • Antibodies can also be used to design immunotoxins that target a particular part of the body.
  • ribosomal S3 protein 17 high affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
  • a common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
  • This hybrid antibody can be used to kill ribosome S3 protein 17 positive cells.
  • the antibodies of the present invention can be used to treat or prevent diseases related to ribosomal S3 protein 17.
  • Administration of an appropriate dose of antibody can stimulate or block the production or activity of ribosomal S3 protein 17.
  • the invention also relates to a diagnostic test method for quantitative and localized detection of ribosomal S3 protein 17 levels.
  • tests are well known in the art and include FISH assays and radioimmunoassays.
  • the level of ribosomal S3 protein 17 detected in the test can be used to explain the importance of ribosomal S3 protein 17 in various diseases and to diagnose diseases in which ribosomal S3 protein 17 plays a role.
  • polypeptide of the present invention can also be used for peptide mapping analysis.
  • the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
  • the polynucleotide encoding ribosomal S3 protein 17 can also be used for a variety of therapeutic purposes. Gene therapy technology can be used to treat abnormalities in cell proliferation, development, or metabolism caused by the non-expression or abnormal / inactive expression of ribosomal S3 protein 17.
  • Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated ribosome S3 protein 17 to inhibit endogenous ribosome S3 protein 17 activity.
  • a variant ribosomal S3 protein 17 may be a shortened ribosome S3 protein 17 that lacks a signaling domain. Although it can bind to downstream substrates, it lacks signaling activity.
  • So recombinant gene therapy contains It can be used to treat diseases caused by abnormal expression or activity of ribosomal S 3 protein 17.
  • Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus and the like can be used to transfer a polynucleotide encoding ribosomal S 3 protein 17 into a cell.
  • the method of encoding construct recombinant viral vectors carrying polynucleotides ribosomal protein S3 17 can be found in existing literature (Sambrook, e tal.).
  • a recombinant polynucleotide encoding ribosomal S 3 protein 17 can be packaged into liposomes and transferred into cells.
  • Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
  • a vector such as a virus, phage, or plasmid
  • Oligonucleotides including antisense RNA and DNA
  • ribozymes that inhibit ribosomal S3 protein 17 mRNA are also within the scope of the present invention.
  • a ribozyme is an enzyme-like RNA molecule that specifically decomposes specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation.
  • Antisense NA, DNA, and ribozymes can be obtained using any existing RNA or DNA synthesis technology, such as solid-phase phosphate amide chemical synthesis to synthesize oligonucleotides.
  • Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA.
  • This DNA sequence has been integrated downstream of the RNA polymerase promoter of the vector.
  • it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the linkage between ribonucleosides using phosphorothioate or peptide bonds instead of phosphodiester bonds.
  • the polynucleotide encoding ribosomal S3 protein 17 can be used for the diagnosis of diseases related to ribosomal S3 protein 17.
  • a polynucleotide encoding ribosomal S3 protein 17 can be used to detect the expression of ribosome S 3 protein 17 or the abnormal expression of ribosome S 3 protein 17 in a disease state.
  • the DNA sequence encoding ribosomal S3 protein 17 can be used to hybridize biopsy specimens to determine the expression of ribosomal S3 protein 17.
  • Hybridization techniques include Southern blotting, Northern blotting, and in situ hybridization. These techniques and methods are all mature and open technologies, and related kits are commercially available.
  • a part or all of the polynucleotides of the present invention can be used as probes to be fixed on a micro array or a DNA chip (also called a "gene chip") for analyzing differential expression analysis and gene diagnosis of genes in tissues.
  • RNA-polymerase chain reaction (RT-PCR) in vitro amplification with ribosome S 3 protein 17 specific primers can also detect ribosome S 3 protein 17 transcription products.
  • Ribosome S 3 protein 17 mutations can also be used to diagnose ribosome S3 protein 17-related diseases.
  • Ribosome S 3 protein 17 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type ribosome S 3 protein 17 DNA sequence. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations can be Can affect protein expression, so Northern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
  • sequences of the invention are also valuable for chromosome identification. This sequence will specifically target a specific position on a human chromosome and can hybridize to it. Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for marking chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DNA sequences on a chromosome.
  • a PCR primer (preferably 15-35bp) is prepared from the cDNA, and the sequence can be located on the chromosome. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
  • PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
  • oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
  • Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.
  • Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step.
  • FISH Fluorescent in situ hybridization
  • the difference in cDNA or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).
  • the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
  • suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers Liquid, glycerin and their combinations.
  • the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients that do not affect the effect of the drug. ii Some of the compositions can be used as drugs for the treatment of diseases.
  • the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell.
  • the polypeptides of the invention can be used in combination with other therapeutic compounds.
  • the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
  • Ribosome S3 protein 17 is administered in an amount effective to treat and / or prevent specific indications.
  • the amount and range of ribosomal S3 protein 17 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician.
  • Total human fetal brain RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform.
  • Poly (A) mRNA was isolated from total RNA using Quik mRNA Isolation Kit (Qiegene). 2ug poly (A) mRNA is reverse transcribed to form cDNA. Use Smart cDNA Cloning Kit (purchased from Clontech). The 0 fragment was inserted into the multiple cloning site of pBSK (+) vector (Clontech), and transformed into DH5 ⁇ . The bacteria formed a cDNA library.
  • Dye terminate cycle react ion sequencing kit Perkin-Elmer
  • ABI 377 automatic sequencer Perkin-Elmer
  • the determined cDNA sequence was compared with the existing public DNA sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 0041g02 was new DNA.
  • a series of primers were synthesized to determine the inserted cDNA fragments of the clone in both directions.
  • the ribosome S3 protein 17 of the present invention has homology with the characteristic sequence of the domain ribosome S3 protein at 29-114, and the homology result is shown in Fig. 1.
  • the homology rate is 0.21, and the score is 9.55;
  • Example 3 Cloning of a gene encoding ribosomal S3 protein 17 by RT-PCR
  • CDNA was synthesized using fetal brain total RNA as a template and oligo-dT as a primer for reverse transcription reaction. After purification with Qiagene's kit, the following primers were used for PCR amplification:
  • Primerl 5-GTGCTCGACTCTTTGAACGCCTCA -3 '(SEQ ID NO: 3)
  • Primer2 5'- AAAAGATATTTATTATTTACACCA -3 '(SEQ ID NO: 4)
  • Primerl is a forward sequence located at the 5th end of SEQ ID NO: 1, starting at lbp;
  • Primer2 is the 3, terminal reverse sequence of SEQ ID NO: 1.
  • Amplification reaction conditions 50 ⁇ l of Kl1, 10 mmol / L Tris- HC1, pH 8.5, 1.5 mmol / L MgCl 2 , 200 ⁇ 1 / ⁇ dNTP, lOpmol primer, 1U Taq DNA in a 50 ⁇ 1 reaction volume Polymerase (Clontech).
  • the reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) for 25 cycles under the following conditions: 94. C 30sec; 55 ° C 30sec; 72 ° C 2min.
  • RT-PCR set ⁇ -act in as a positive control and template blank as a negative control.
  • the amplified product was purified using a QIAGEN kit and ligated to a PCR vector using a TA cloning kit (Invitrogen). DNA sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as l-1924bp shown in SEQ ID NO: 1.
  • Example 4 Northern blot analysis of ribosomal S3 protein 17 gene expression
  • RNA extraction in one step [Anal. Biochem 1987, 162, 156-159].
  • This method involves acid guanidinium thiocyanate phenol-chloroform extraction. That is, the tissue is homogenized with 4M guanidinium isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1 ), Mix and centrifuge. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. The obtained RM precipitate was washed with 70% ethanol, dried and dissolved in water.
  • a 32P-labeled probe (approximately 2 x 10 6 cpm / ml) and RM-transferred nitrocellulose membrane were placed in a solution at 42 ° C. C hybridization overnight, the solution contains 50% formamide-25mM KH 2 P0 4 (pH7.4) -5 ⁇ SSC-5 ⁇ Denhardt's solution and 200 ⁇ ⁇ / ⁇ 1 salmon sperm DM. After hybridization, place the filter at 1 x SSC- Wash in 0.1% SDS at 55 ° C for 30 min. Then, Phosphor Imager was used for analysis and quantification.
  • Example 5 In vitro expression, isolation and purification of recombinant ribosomal S3 protein 17
  • Primer3 5'- CCCCATATGATGCGGCCATATCTTCATGAATTTC -3 '(Seq ID No: 5)
  • Primer4 5'- CATGGATCCCTACTGTCCTTGCTTCTTTGAGAGA -3, (Seq ID No: 6)
  • the 5' ends of these two primers contain Ndel and BamHI restriction sites, respectively.
  • the coding sequences of the 5 'and 3' ends of the target gene are followed, respectively.
  • the Nde I and BamH I restriction sites correspond to the selection on the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865.3). Sex endonuclease site.
  • the PCR reaction was performed using the pBS-0042g02 plasmid containing the full-length target gene as a template.
  • the PCR reaction conditions are as follows: a total volume of 50 ⁇ 1 contains 10 pg of pBS-0042g02 plasmid, primer Primer-3 and? 1 "1 [ ⁇ 1-4 are 10 0101, Advantage polymerase Mix (Clontech) 1 ⁇ 1. Cycle parameters: 94 ° C 20s, 60 ° C 30s, 68 ° C 2 min, a total of 25 cycles.
  • Use Ndel and BamHI separately digested the amplified product and plasmid pET-28 (+), recovered large fragments, and ligated them with T4 ligase.
  • the ligation products were transformed by the calcium chloride method of colibacillus DH5oc, and the kanamycin ( After the LB plate was cultured overnight at a final concentration of 30 ⁇ ⁇ / ⁇ 1), positive clones were screened by colony PCR and sequenced. The positive clones (pET-0042g02) with the correct sequence were selected and the recombinant plasmid was transformed into E. coli BL21 by the calcium chloride method. DE3) pIySs (Novagen Co.).
  • peptides specific to ribosomal S3 protein 17 were synthesized using a peptide synthesizer (product of PE): NH 2 -Me t-Arg-Pro-Tyr-Leu-H i sG 1 u- Phe- Leu-Thr-Ser- A 1 a-Tyr-G 1 u-Asp-COOH (SEQ ID NO: 7).
  • the polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex, respectively.
  • Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
  • the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
  • the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
  • the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method.
  • Filter hybridization methods include dot blotting, Sou thern imprinting, Nor thern blotting, and copying methods. They are all used to fix the polynucleotide sample to be tested on the filter and then hybridize using basically the same steps.
  • the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer to saturate the non-specific binding site of the sample on the filter with the carrier and the synthesized polymer.
  • the pre-hybridization solution is then replaced with a hybridization buffer containing labeled probes and incubated to hybridize the probes to the target nucleic acid.
  • the unhybridized probes are removed by a series of membrane washing steps.
  • This embodiment uses higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals.
  • the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention;
  • the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
  • the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
  • oligonucleotide fragments for use as hybridization probes from the polynucleotide SEQ ID NO: 1 of the present invention should follow the following principles and several aspects to be considered:
  • the preferred range of probe size is 18-50 nucleotides
  • GC content is 30% -70%, if it exceeds, non-specific hybridization will increase
  • the primary probe is compared with the region of its source sequence (ie, SEQ ID NO: 1) and other known genomic sequences and their complementary regions, respectively. If the homology with the non-target molecular region is greater than 85% or there is If more than 15 consecutive bases are identical, the primary probe should generally not be used;
  • Probe 1 (probel), which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt)
  • Probe 2 (probe2), which belongs to the second type of probe, is equivalent to the replacement mutant sequence of the gene fragment of SEQ ID NO: 1 or its complementary fragment (41Nt):
  • PBS phosphate buffered saline
  • step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
  • NC membranes nitrocellulose membranes
  • Two NC membranes are required for each probe for subsequent experiments.
  • the film is washed with high-strength conditions and strength conditions, respectively.
  • the 32 P-Probe (the second peak is free ⁇ - 32P -dATP) is prepared.
  • the sample membrane was placed in a plastic bag, and 3-10 mg of pre-hybridization solution (10xDenhardfs; 6xSSC, 0.1 mg / ml CT DNA (calf DM)) was added. After the bag was sealed, it was shaken in a 68 C water bath for 2 hours.
  • pre-hybridization solution 10xDenhardfs; 6xSSC, 0.1 mg / ml CT DNA (calf DM)
  • probe 1 can be used to qualitatively and quantitatively analyze the presence and differential expression of the polynucleotide of the present invention in different tissues.
  • Gene chip or DNA microarray is a new technology that many national laboratories and large pharmaceutical companies are currently developing and developing. It refers to the orderly and high-density arrangement of large numbers of target gene fragments on glass, The data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software to achieve the purpose of rapid, efficient, and high-throughput analysis of biological information.
  • the polynucleotide of the present invention can be used as a target DM for gene chip technology for high-throughput research of new gene functions; searching for and screening new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases .
  • the specific method steps have been reported in the literature. For example, refer to the documents DeRisi, JL, Lyer, V. & Brown, P.0. (1997) Science 278, 680-686. And the documents Helle, RA, Schema, M., Chai, A., Shalom, D.,
  • a total of 4,000 polynucleotide sequences of various full-length cDNAs are used as target DNA, including the polynucleotide of the present invention. They were respectively amplified by PCR. After purification, the concentration of the amplified product was adjusted to about 500 ng / ul, and spotted on a glass medium with a Cartesian 7500 spotter (purchased from Cartesian Company, USA), between the points. The distance is 280 ⁇ m. The spotted slides were hydrated and dried, cross-linked in a UV cross-linker, and dried after elution to fix the DNA on the glass slides to prepare chips. The specific method steps have been reported in the literature. The sample post-processing steps in this embodiment are:
  • Total mRNA was extracted from normal liver and liver cancer in one step, and mRNA was purified with Oligotex mRNA Midi Kit (purchased from QiaGen).
  • the fluorescent reagent Cy3dUTP (S-Amino- propargyH-deoxyuridine 5'-tr iphate coupled) to Cy3 fluorescent dye purchased from Amersham Phamacia Biotech
  • Cy3 fluorescent dye purchased from Amersham Phamacia Biotech
  • Probes from the two types of tissues and the chip were hybridized in a UniHyb TM Hybridization Solution (purchased from TeleChem) hybridization solution for 16 hours, washed with a washing solution (1 x SSC, 0.2% SDS) at room temperature, and then scanned with ScanArray 3000.
  • Scanner purchased from General Scanning Company, USA
  • the scanned image was analyzed and processed with Imagene software (Biodiscovery, USA), and the Cy3 / Cy5 ratio of each point was calculated. The points with the ratio less than 0.5 and greater than 2 were considered.
  • Genes with differential expression were used to analyze a UniHyb TM Hybridization Solution for 16 hours, washed with a washing solution (1 x SSC, 0.2% SDS) at room temperature, and then scanned with ScanArray 3000.
  • Scanner purchased from General Scanning Company, USA
  • the scanned image was analyzed and processed with Imagene software (Biodiscovery, USA), and the Cy3 / Cy5

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Molecular Biology (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Genetics & Genomics (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Peptides Or Proteins (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

L'invention concerne un nouveau polypeptide, une protéine ribosomale S3 17, et un polynucléotide codant pour ce polypeptide ainsi qu'un procédé d'obtention de ce polypeptide par des techniques recombinantes d'ADN. L'invention concerne en outre les applications de ce polypeptide dans le traitement de maladies, notamment des tumeurs malignes, de l'hémopathie, de l'infection par VIH, de maladies immunitaires et de diverses inflammations. L'invention concerne aussi l'antagoniste agissant contre le polypeptide et son action thérapeutique ainsi que les applications de ce polynucléotide codant pour la protéine ribosomale S3 17.
PCT/CN2000/000570 1999-12-21 2000-12-11 Nouveau polypeptide, proteine ribosomale s3 17, et polynucleotide codant pour ce polypeptide WO2001046235A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU19843/01A AU1984301A (en) 1999-12-21 2000-12-11 A novel polypeptide - ribosomal s3 protein 17 and the polynucleotide encoding said polypeptide

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN 99124293 CN1300738A (zh) 1999-12-21 1999-12-21 一种新的多肽－核糖体s3蛋白17和编码这种多肽的多核苷酸
CN99124293.9 1999-12-21

Publications (1)

Publication Number Publication Date
WO2001046235A1 true WO2001046235A1 (fr) 2001-06-28

Family

ID=5283377

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2000/000570 WO2001046235A1 (fr) 1999-12-21 2000-12-11 Nouveau polypeptide, proteine ribosomale s3 17, et polynucleotide codant pour ce polypeptide

Country Status (3)

Country Link
CN (1) CN1300738A (fr)
AU (1) AU1984301A (fr)
WO (1) WO2001046235A1 (fr)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1997012617A1 (fr) * 1995-10-06 1997-04-10 University Of Medicine And Dentistry Of New Jersey Proteines impliquees dans le ciblage du centre de transfert de peptidyle, et procedes et agents therapeutiques correspondants
JPH10323190A (ja) * 1997-05-23 1998-12-08 Asahi Breweries Ltd 微生物検出用オリゴヌクレオチド及び微生物検出方法
WO2000008173A1 (fr) * 1998-08-04 2000-02-17 Ludwig Institute For Cancer Research Identification et caracterisation fonctionnelle d'une nouvelle proteine kinase s6 ribosomique

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1997012617A1 (fr) * 1995-10-06 1997-04-10 University Of Medicine And Dentistry Of New Jersey Proteines impliquees dans le ciblage du centre de transfert de peptidyle, et procedes et agents therapeutiques correspondants
JPH10323190A (ja) * 1997-05-23 1998-12-08 Asahi Breweries Ltd 微生物検出用オリゴヌクレオチド及び微生物検出方法
WO2000008173A1 (fr) * 1998-08-04 2000-02-17 Ludwig Institute For Cancer Research Identification et caracterisation fonctionnelle d'une nouvelle proteine kinase s6 ribosomique

Also Published As

Publication number Publication date
CN1300738A (zh) 2001-06-27
AU1984301A (en) 2001-07-03

Similar Documents

Publication Publication Date Title
WO2001046235A1 (fr) Nouveau polypeptide, proteine ribosomale s3 17, et polynucleotide codant pour ce polypeptide
WO2001046409A1 (fr) Nouveau polypeptide, proteine ribosomale s7 9, et polynucleotide codant pour ce polypeptide
WO2001075048A2 (fr) Nouveau polypeptide, proteine ribosomale humaine s11 23, et polynucleotide codant pour ce polypeptide
WO2001072793A1 (fr) Nouveau polypeptide, proteine humaine de regulation 12 de la proteine hydrolase, et polynucleotide codant pour ce polypeptide
WO2001046248A1 (fr) Nouveau polypeptide, proteine ribosomale s9 26, et polynucleotide codant pour ce polypeptide
WO2001048195A1 (fr) Nouveau polypeptide, proteine rcc1 10, et polynucleotide codant pour ce polypeptide
WO2001046437A1 (fr) Nouveau polypeptide, region de liaison d'arn-eucaryote rnp-1-21, et polynucleotide codant pour ce polypeptide
WO2001070965A1 (fr) Nouveau polypeptide, facteur humain de regulation de la transcription 15, et polynucleotide codant pour ce polypeptide
WO2001048194A1 (fr) Nouveau polypeptide, proteine ribosomale s18 13, et polynucleotide codant pour ce polypeptide
WO2001075044A2 (fr) Nouveau polypeptide, proteine ribosomale humaine s18-18, et polynucleotide codant pour ce polypeptide
WO2001087963A1 (fr) Proteine s18-12 ribosomale, polypeptide humain, et polynucleotide la codant
WO2001074881A1 (fr) Nouveau polypeptide, proteine ribosomale humaine s18-10, et polynucleotide codant pour ce polypeptide
WO2001087971A1 (fr) Proteine s18-14 ribosomale, polypeptide humain, et polynucleotide la codant
WO2001087967A1 (fr) Proteine s18-26 ribosomale, polypeptide humain, et polynucleotide la codant
WO2001048197A1 (fr) Nouveau polypeptide, proteine ribosomale s5 8, et polynucleotide codant pour ce polypeptide
WO2001047973A1 (fr) Nouveau polypeptide, proteine 14 associee a la vesicule a gaz, et polynucleotide codant pour ce polypeptide
WO2001090171A1 (fr) Nouveau polypeptide, proteine humaine ribosomale sii 12, et polynucleotide codant ce polypeptide
WO2001075126A1 (fr) Nouveau polypeptide, proteine ribosomale humaine s18-9, et polynucleotide codant pour ce polypeptide
WO2001081396A1 (fr) Nouveau polypeptide, proteine ribosomale s7 humaine 14, et polynucleotide codant pour ce polypeptide
WO2001074895A1 (fr) Nouveau polypeptide, facteur humain de transcription de la differentiation cellulaire 12.1, et polynucleotide codant pour ce polypeptide
WO2001047987A1 (fr) Nouveau polypeptide, gene $g(s)-54, et polynucleotide codant pour ce polypeptide
WO2001046242A1 (fr) NOUVEAU POLYPEPTIDE, GENE σ-54 9, ET POLYNUCLEOTIDE CODANT POUR CE POLYPEPTIDE
WO2001079436A2 (fr) Nouveau polypeptide, facteur humain de transcription de la differentiation cellulaire 10, et polynucleotide codant pour ce polypeptide
WO2001047985A1 (fr) Nouveau polypeptide, proteine kinase c-13, et polynucleotide codant pour ce polypeptide
WO2001074996A2 (fr) Nouveau polypeptide, c. elegans 52 humain, et polynucléotide codant pour ce polypeptide

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP