WO2002020577A1 - Nouveau polypeptide, nucleoside reductase 10.49, et polynucleotide codant ce polypeptide - Google Patents
Nouveau polypeptide, nucleoside reductase 10.49, et polynucleotide codant ce polypeptide Download PDFInfo
- Publication number
- WO2002020577A1 WO2002020577A1 PCT/CN2001/001007 CN0101007W WO0220577A1 WO 2002020577 A1 WO2002020577 A1 WO 2002020577A1 CN 0101007 W CN0101007 W CN 0101007W WO 0220577 A1 WO0220577 A1 WO 0220577A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- polypeptide
- polynucleotide
- sequence
- nucleotide reductase
- nucleotide
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/0004—Oxidoreductases (1.)
- C12N9/0093—Oxidoreductases (1.) acting on CH or CH2 groups (1.17)
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
Definitions
- the present invention belongs to the field of biotechnology. Specifically, the present invention describes a new polypeptide, a nucleotide reductase 10.49, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and polypeptide. Background technique
- deoxynucleotides are formed from the corresponding nucleotides by replacing the 2'-0H group with hydrogen.
- ribonucleotide reductases that catalyze this nucleotide reduction.
- a class of enzymes widely distributed in nature and present in mammalian cells contains non-heme, which is composed of more than one polypeptide chain, and has specificity for the reduction of diphosphates (ADP, GDP, CDP, and UDP).
- the second enzyme is limited to certain microorganisms. This type of enzyme contains only one polypeptide chain, but in some cases forms oligomers.
- nucleotide reductase catalyzes the reduction and synthesis of deoxyribonucleotides in the body, which provides the precursors necessary for DNA synthesis.
- nucleotide reductase is a polymerase consisting of a large subunit (about 700-1 000 amino acid residues) and a small subunit (about 300-400 amino acid residues) Base composition).
- Small subunits bind to two iron ions in the organism (glutamic acid, asparagine, and two histidines in the amino acid sequence of the protein are involved in the binding of metal ions), and the subunit also contains Tyrosine site.
- This type of nucleotide reductase is contained in prokaryotes, eukaryotes and viruses, and their small subunits contain metal ion binding residues and active tyrosine sites [Pe ter Re i chard, 1993, Science, 260: 1773-1776].
- nucleotide reductases contained the conserved consensus sequence fragments as follows: [LIVMSEQJ -EX (1, 2)-[LIVTA]-[HY]-[GSA] -X- [STAVM ] -YX (2)-[LIVMQ]-X (3)-[LIFY]-[IVFYCSA];
- This sequence fragment is an active site that binds reductase to iron ions and exerts its reducing function.
- E and H in this sequence are the binding sites of the enzyme and iron ions, and Y is the amino acid residue at the active site of the enzyme.
- Mutations in this sequence may lead to a loss of enzyme activity, which affects the synthesis of deoxyribonucleotides, which in turn affects the synthesis of the genetic information vector DNA of the entire organism. It can be seen that this protein has an important role in the body. It regulates the expression of the genetic information of the organism from the first level. The abnormal expression of this protein is usually closely related to the development of some diseases such as developmental disorders and metabolic disorders. Related.
- nucleotide reductase 10.49 protein plays an important role in regulating important functions of the body such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes, so there has been a need in the art to identify more involved in these processes
- the nucleotide reductase 10.49 protein identifies the amino acid sequence of this protein.
- the isolation of the new nucleotide reductase 10.49 protein encoding gene also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so it is important to isolate its coding for DM. Disclosure of invention
- Another object of the invention is to provide a polynucleotide encoding the polypeptide.
- Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding a nucleotide reductase 10.49.
- Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding a nucleotide reductase 10.49.
- Another object of the present invention is to provide a method for producing a nucleotide reductase 10.49.
- Another object of the present invention is to provide an antibody against the polypeptide-to-nucleotide reductase 10.49 of the present invention.
- Another object of the present invention is to provide mimetic compounds, antagonists, agonists, and inhibitors against the polypeptide-to-nucleotide reductase 10.49 of the present invention.
- Another object of the present invention is to provide a method for diagnosing and treating a disease associated with an abnormality of nucleotide reductase 10.49.
- the present specification relates to an isolated polypeptide, which is of human origin, and includes: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment, or derivative thereof.
- the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
- the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
- sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 433-720 in SEQ ID NO: 1; and (b) a sequence having 1-904 in SEQ ID NO: 1 Sequence of bits.
- the present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
- the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
- the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit nucleotide reductase 10.49 protein activity, which comprises utilizing a polypeptide of the invention.
- the invention also relates to compounds obtained by this method.
- the present invention also relates to a method for in vitro detection of a disease or susceptibility to disease associated with abnormal expression of a nucleotide reductase 10.49 protein, comprising detecting a mutation in the polypeptide or a sequence encoding a polynucleotide thereof in a biological sample, or Detection of the amount or biological activity of a polypeptide of the invention in a biological sample.
- the invention also relates to a pharmaceutical composition
- a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
- the present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention in the preparation of a medicament for treating cancer, developmental disease or immune disease or other diseases caused by abnormal expression of nucleotide reductase 1 0.49.
- Nucleic acid sequence refers to oligonucleotides, nucleotides or polynucleotides and fragments or parts thereof, and can also refer to genomic or synthetic DNA or RNA, which can be single-stranded or double-stranded, representing the sense strand or Antisense strand.
- amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
- a protein or polynucleotide “variant” refers to a protein or polynucleotide that has one or more amino acid or nucleotide changes Amino acid sequence or polynucleotide sequence encoding it. The changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence. Variants may have "conservative" changes in which the substituted amino acid has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine. Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
- “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
- Insertion refers to an alteration in the amino acid sequence or nucleotide sequence that results in an increase in one or more amino acids or nucleotides compared to a naturally occurring molecule.
- Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
- Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
- immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response in appropriate animals or cells and to bind to specific antibodies.
- An "agonist” refers to a molecule that, when combined with a nucleotide reductase 10.49, can cause the protein to change, thereby regulating the activity of the protein.
- An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that can bind to a nucleotide reductase 1 0.49.
- Antagonist refers to a molecule that, when combined with a nucleotide reductase 10.49, can block or regulate the biological or immunological activity of the nucleotide reductase 10.49.
- Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates or any other molecule that can bind to a nucleotide reductase 10.49.
- “Regulation” refers to a change in the function of the nucleotide reductase 10.49, including an increase or decrease in protein activity, a change in binding characteristics, and any other biological property, function, or of the nucleotide reductase 10.49. Changes in immune properties.
- Substantially pure ' means essentially free of other proteins, lipids, sugars or other substances with which it is naturally associated.
- Those skilled in the art can purify nucleotide reductase 10.49 using standard protein purification techniques.
- Substantially pure nucleotide reductase 10.49 produces a single main band on a non-reducing polyacrylamide gel.
- Nucleotide reductase 10.49 The purity of a polypeptide can be analyzed by amino acid sequence.
- Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
- sequence C-T-G-A
- complementary sequence G-A-C-T.
- the complementarity between two single-stranded molecules may be partial or complete.
- the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
- “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
- Partial homology refers to a partially complementary sequence that at least partially inhibits the hybridization of a completely complementary sequence to a target nucleic acid. Pay. The inhibition of such hybridization can be detected by performing hybridization (Southern blotting or Northern blotting, etc.) under conditions of reduced stringency. Substantially homologous sequences or hybridization probes can compete and inhibit the binding of completely homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.
- Percent identity refers to the percentage of sequences that are the same or similar in a comparison of two or more amino acid or nucleic acid sequences. Percent identity can be determined electronically, such as through the MEGALIGN program
- the MEGALIGN program can compare two or more sequences according to different methods such as the Clus ter method (Hi gg ins, DG and PM Sharp (1988) Gene 73: 237-244). 0 The Clus ter method will check the distance between all pairs by Groups of sequences are arranged in clusters. The clusters are then assigned in pairs or groups.
- the percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula: The number of matching residues between sequence A and sequence X 100 The number of residues in sequence A-the number of spacer residues in sequence A The number of spacer residues in a sequence B can also be determined by Clus ter method or using methods known in the art such as Jotun Hein.
- the percent identity between nucleic acid sequences (Hein J., (1990) Methods in erazumo logy 183: 625-645 ) 0 "Similarity" refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
- Amino acids used for conservative substitutions may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
- Antisense refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence.
- Antisense strand refers to a nucleic acid strand that is complementary to a “sense strand.”
- Derivative refers to a chemical modification of HFP or a nucleic acid encoding it. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
- Antibody refers to a complete antibody molecule and its fragments, such as Fa,? (,) 2 and? , It can specifically bind to the epitope of nucleotide reductase 10.49.
- Humanized antibody means that the amino acid sequence of a non-antigen-binding region is replaced with a human antibody Antibodies that are similar but still retain the original binding activity.
- isolated refers to the removal of a substance from its original environment (for example, its natural environment if it is naturally occurring).
- a naturally-occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
- Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not part of its natural environment, they are still isolated.
- isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
- polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances in the natural state .
- isolated nucleotide reductase 10. 49 refers to nucleotide reductase 10. 49 which is essentially free of other proteins, lipids, sugars or other substances with which it is naturally associated. Those skilled in the art can purify nucleotide reductases using standard protein purification techniques 10.49. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. Nucleotide reductase 10. 49 The purity of the polypeptide can be analyzed by amino acid sequence.
- the present invention provides a novel polypeptide-to-nucleotide reductase 10.49, which is basically composed of the amino acid sequence shown in SEQ ID NO: 2.
- the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
- the polypeptides of the invention can be naturally purified products, or chemically synthesized products, or produced using recombinant techniques from prokaryotic or eukaryotic hosts (e.g., bacteria, yeast, higher plants, insects, and mammalian cells). Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
- the invention also includes fragments, derivatives and analogs of the nucleotide reductase 10.49.
- fragment refers to a polypeptide that substantially maintains the same biological function or activity of the nucleotide reductase 10.49 of the present invention.
- a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution
- the amino acid may or may not be encoded by a genetic codon; or ( ⁇ ) such a type in which one or more amino acid residues are substituted with other groups to include a substituent; or (III) such One, wherein the mature polypeptide is fused to another compound (such as a compound that extends the half-life of the polypeptide, such as polyethylene glycol); or (IV) such a polypeptide sequence in which an additional amino acid sequence is fused into the mature polypeptide ( Such as the leader sequence or secreted sequence or the sequence used to purify this polypeptide or protease sequence)
- an additional amino acid sequence is fused into the mature polypeptide
- the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
- the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
- the polynucleotide of the present invention is found from a CDM library of human fetal brain tissue. It contains a full-length polynucleotide sequence of 904 bases, and its open reading frame 433-720 encodes 95 amino acids.
- nucleotide reductase 10.49 has similar functions to nucleotide reductase.
- the polynucleotide of the present invention may be in the form of DNA or RNA.
- DNA forms include cDM, genomic DM, or synthetic DNA.
- DNA can be single-stranded or double-stranded.
- DM can be a coding chain or a non-coding chain.
- the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
- a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 in the present invention, but which differs from the coding region sequence shown in SEQ ID NO: 1.
- the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
- polynucleotide encoding a polypeptide refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.
- the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
- Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
- an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
- the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity between the two sequences).
- the invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the invention under stringent conditions.
- "strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, Q.
- the polypeptide encoded by the hybridizable polynucleotide is identical to the mature polypeptide shown in SEQ ID NO: 2 Biological function and activity.
- nucleic acid fragments that hybridize to the sequences described above.
- a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, most preferably at least 100 More than nucleotides.
- Nucleic acid fragments can also be used in nucleic acid amplification techniques, such as PCR, to identify and / or isolate polynucleotides encoding nucleotide reductase 10.49.
- polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
- the specific polynucleotide sequence encoding the nucleotide reductase 10.49 of the present invention can be obtained by various methods.
- polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
- the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) separating a double-stranded DNA sequence from genomic DM; 2) chemically synthesizing a DNA sequence to obtain the double-stranded DM of the polypeptide.
- genomic DNA isolation is the least commonly used. Direct chemical synthesis of DM sequences is often the method of choice.
- the more commonly used method is the isolation of cDNA sequences.
- the standard method for isolating the cDM of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDM library.
- mRM plasmid or phage cDM library.
- kits are also commercially available (Qi agene).
- construction of cDNA libraries is also a common method (Sambrook, et al., Moleculolar Cloning, A Labora tory Manua, Coll Spring Harbor Labora tory. New York, 1989).
- Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
- genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DNA-RNA hybridization; (2) the presence or loss of marker gene function; (3) determining the level of the transcript of the nucleotide reductase 10.49; (4) Detecting the protein product of gene expression by immunological technology or measuring biological activity. The above methods can be used singly or in combination.
- the probe used for hybridization is the same as any part of the polynucleotide of the present invention.
- the source is at least 10 nucleotides in length, preferably at least 30 nucleotides, more preferably at least 50 nucleotides, and most preferably at least 100 nucleotides.
- the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
- the probe used here is usually a DM sequence chemically synthesized based on the gene sequence information of the present invention.
- the genes or fragments of the present invention can of course be used as probes.
- DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
- the protein product of the nucleotide reductase 1.049 gene expression can be detected using immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA).
- immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA).
- ELISA enzyme-linked immunosorbent assay
- the RACE method RACE-rapid cDNA end rapid amplification method
- the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein.
- the amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
- the polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al.
- Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, the sequencing must be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
- the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell genetically engineered using the vector of the present invention or directly using a nucleotide reductase 10.49 coding sequence, and a recombinant technology for producing the polypeptide of the present invention. method.
- the polynucleotide sequence encoding the nucleotide reductase 10.49 can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
- vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
- Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al.
- any plasmid and vector can be used to construct a recombinant expression vector.
- An important feature of expression vectors is that they usually contain origins of replication, promoters, marker genes, and translational regulatory elements.
- DM sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis.
- promoters are: the lac or p promoter of E.
- the expression vector also includes a ribosome binding site and a transcription terminator for translation initiation. Insertion of an enhancer sequence into a vector will allow it to be transcribed in higher eukaryotic cells.
- Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers on the late side of the origin of replication, and adenoviral enhancers.
- the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
- selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
- GFP fluorescent protein
- tetracycline or ampicillin resistance for E. coli.
- a polynucleotide encoding a nucleotide reductase 10.49 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to form a genetically engineered host cell containing the polynucleotide or the recombinant vector.
- the term "host cell” refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E.
- coli Streptomyces
- bacterial cells such as Salmonella typhimurium
- fungal cells such as yeast
- plant cells such as fly S2 or Sf 9
- animal cells such as CH0, COS or Bowes melanoma cells.
- Transformation of a host cell with a DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art.
- the host is a prokaryote such as E. coli
- competent cells capable of DNA uptake can be in the exponential growth phase were harvested, treated with CaC l 2 method used in steps well known in the art. The alternative is to use MgC l 2 .
- transformation can also be performed by electroporation.
- the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
- the polynucleotide sequence of the present invention can be used to express or produce a recombinant nucleotide reductase 10.49 (Scence, 1984; 224: 1431). Generally, the following steps are taken:
- the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
- the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If desired, recombinant proteins can be isolated and purified by various separation methods using their physical, chemical, and other properties. These methods are well known to those skilled in the art.
- Figure 1 is a comparison diagram of gene chip expression profiles of the nucleotide reductase 10.49 and nucleotide reductase of the present invention.
- the upper graph is a graph of the expression profile of nucleotide reductase 10.49, and the lower graph is the graph of the expression profile of nucleotide reductase.
- Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of the isolated nucleotide reductase 10.49.
- 49kDa is the molecular weight of the protein.
- the arrow indicates the isolated protein band.
- Total human fetal brain RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform.
- Poly (A) mRNA was isolated from total RNA using Quik mRNA Isolat ion Kit (product of Qiegene). 2ug poly (A) mRM forms cDNA by reverse transcription.
- the Smart cDNA cloning kit purchased from Clontech was used to insert the cDNA fragment into the multicloning site of pBSK (+) vector (Clontech) to transform DH5 ⁇ .
- the bacteria formed a cDNA library.
- Dye terminate cycle react ion sequencing kit Perkin-Elmer
- ABI 377 An automatic sequencer (Perkin-Elmer) determined the sequences at the 5 'and 3' ends of all clones. The determined cDNA sequence was compared with an existing public DNA sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 0419g08 was new DNA. A series of primers were synthesized to determine the inserted cDNA fragments of the clone in both directions.
- the 0419g08 clone contains a full-length cDNA of 904bp (as shown in Seq ID NO: l), and a 288bp open reading frame (0RF) from 433bp to 720bp, encoding a new protein (such as Seq ID NO : Shown in 2).
- This clone pBS-0419g08 and the encoded protein was named nucleotide reductase 10.49.
- Example 2 Cloning of the gene encoding nucleotide reductase 10.49 by RT-PCR
- CDNA was synthesized using fetal brain total RNA as a template and ol igo-dT as a primer for reverse transcription reaction.
- PCR amplification was performed with the following primers:
- Pr iraerl 5,-CTCAGGACACAAAACGAGCTGGGC -3, (SEQ ID NO: 3)
- Pr iraer2 5'- GATGGTGTCTCACTCTGTTGTCCA -3 '(SEQ ID NO: 4)
- Pr imerl is a forward sequence located at the 5th end of SEQ ID NO: 1, starting at lbp;
- Pr imer2 is the 3'-end reverse sequence in SEQ ID NO: 1.
- Conditions for the amplification reaction 50 ⁇ l of Kol, KL1, 10 mmol / L Tris-Cl, (pH 8.5.5), 1.5 mmol / L MgCl 2 , 200 ⁇ raol / L dNTP, l Opmol primer, 1U Taq DNA polymerase (Clontech).
- the reaction was performed on a PE9600 DM thermal cycler (Perkin-Elmer) for 25 cycles under the following conditions: 94 ° C 30sec; 55 ° C 30sec; 72. C 2min.
- RT-PCR set ⁇ -act in as a positive control and template blank as a negative control.
- the amplified product was purified using a QIAGEN kit and ligated to a pCR vector (Invitrogen) using a TA cloning kit.
- the DNA sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as the 1-904bp shown in SEQ ID NO: 1.
- Example 3 Nor thern blot analysis of the expression of the nucleotide reductase 10.49 gene:
- RNA extraction in one step [Ana l. Biochem 1987, 162, 156-159] 0
- This method involves acid guanidinium thiocyanate-chloroform extraction. That is, the tissue is homogenized with 4M guanidine isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1), centrifuge after mixing. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water.
- RNA probe used is the PCR amplified nucleotide reductase 10.49 coding region sequence shown in FIG. 1 (433 bp to 7 2 0bp).
- a 32P-labeled probe (about 2 x 10 6 cpm / ml) was hybridized with a nitrocellulose membrane to which RNA was transferred at 42 C overnight in a solution containing 50% formamide-25mM KH 2 P0 4 ( pH7.4) -5 x SSC-5 x Denhardt's solution and 200 g / ml salmon sperm DNA. After hybridization, the filter was washed in 1 X SSC-0.1 ° / SDS at 55 ° C for 30 min. Then, Phosphor Imager was used for analysis and quantification.
- Example 4 In vitro expression, isolation and purification of recombinant nucleotide reductase 10.49
- Primer3 5 '-CCCCATATGATGGTAAATCGTAGTAATATTGAC-3' (Seq ID No: 5)
- Priraer4 5'-CATGGATCCTCAGGCTGGTCTCGAATTCCTGAC-3 '(Seq ID No: 6)
- the 5' ends of these two primers contain Ndel and BamHI restriction sites, respectively.
- the coding sequences for the 5 'and 3' ends of the gene of interest are followed, respectively.
- the Ndel and BamHI restriction sites correspond to the selectivity within the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865.3). Digestion site.
- the pBS-0419g08 plasmid containing the full-length target gene was used as a template for the PCR reaction.
- the PCR reaction conditions were as follows: a total volume of 50 ⁇ 1 containing 10 pg of pBS-0419 g 08 plasmid, primers Primer-3 and Primer-4; 3 ⁇ 4 ⁇ J 10praol Advantage polymerase Mix (Clontech) 1 ⁇ 1. Cycle parameters: 94 C 20s, 60 ° C 30s, 68 C 2 min, a total of 25 cycles. Ndel and BamHI were used to double-digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase.
- the ligation product was transformed into E. coli DH5a by the calcium chloride method. After being cultured overnight on an LB plate containing kanamycin (final concentration 30 g / ml), positive clones were selected by colony PCR method and sequenced. A positive clone (pET-0419g08) with the correct sequence was selected, and the recombinant plasmid was transformed into E. coli BL21 (DE3) plySs (product of Novagen) using the calcium chloride method.
- the host bacteria BL21 (pET-0419 g 08) was cultured at 37 ° C to the logarithmic growth phase, and IPTG was added to a final concentration of 1 ol / L, continue to cultivate for 5 hours.
- the bacteria were collected by centrifugation, and the supernatant was collected by centrifugation. The supernatant was collected by centrifugation.
- a peptide synthesizer specific to the following nucleotide reductase 10.49 was synthesized using a peptide synthesizer (product of PE Co.): -Gly-Trp- C00H (SEQ ID NO: 7).
- the polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex, respectively.
- Rabbits were immunized with 4 mg of the hemocyanin polypeptide complex plus complete Freund's adjuvant, and 15 days later, the hemocyanin polypeptide complex plus incomplete Freund's adjuvant was used to boost immunity once.
- a titer plate coated with a 15 g / ml bovine serum albumin peptide complex was used as an ELISA to determine antibody titers in rabbit serum.
- Total IgG was isolated from antibody-positive rabbit sera using protein A-Sepharose.
- the peptide was bound to a cyanogen bromide-activated Sepharose4B column, and anti-peptide antibodies were separated from the total IgG by affinity chromatography. Immunoprecipitation demonstrated that the purified antibody could specifically bind to nucleotide reductase 10.49.
- Example 6 Application of the polynucleotide fragment of the present invention as a hybridization probe
- the suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in various aspects.
- the probes can be used to hybridize to the genome or CDM library of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
- the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissues or Whether the expression in tissue cells is abnormal.
- the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method Acid sequence or a homologous polynucleotide sequence thereof.
- Filter hybridization methods include dot blotting, Southern imprinting, Northern blotting, and copying methods. They all use the same steps to immobilize the polynucleotide sample to be tested on the filter.
- the sample-immobilized filter is pre-hybridized with a probe-free hybridization buffer to saturate the non-specific binding site of the sample on the filter with the carrier and synthetic polymer.
- the pre-hybridization solution is then replaced with a hybridization buffer containing labeled probes and incubated to hybridize the probes to the target nucleic acid.
- the unhybridized probes are removed by a series of membrane washing steps.
- This embodiment uses higher-intensity washing conditions (such as lower salt concentration and higher temperature), so that the hybridization background is reduced and only strong specific signals are retained.
- the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
- the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
- the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
- oligonucleotide fragments from the polynucleotide SEQ ID NO: 1 of the present invention as hybridization probes should follow the following principles and several aspects to be considered: 1.
- the preferred range of probe size is 18-50 nucleotides;
- Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements The regions are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, the primary probe should not be used;
- Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
- Probe 2 (probe2), which belongs to the second type of probe, is equivalent to the replacement mutation sequence lNt of the gene fragment of SEQ ID NO: 1 or its complementary fragment):
- step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
- NC membranes nitrocellulose membranes
- Two NC membranes are required for each probe, so that they can be used in the following experimental steps.
- the film was washed with high-strength conditions and strength conditions, respectively.
- pre-hybridization solution 10xDenhardt's; 6xSSC, 0. Irag / ral CT DNA (calf thymus DM).
- Seal the bag and shake at 68 ° C for 2 hours in a water bath .
- Gene chip or gene microarray is a new technology currently being developed by many national laboratories and large pharmaceutical companies. It refers to the orderly and high-density arrangement of a large number of target gene fragments on glass, The data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software to achieve the purpose of rapid, efficient, and high-throughput analysis of biological information.
- the polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research of new gene functions; search for and screen new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases . The specific method steps have been reported in the literature.
- a total of 4,000 polynucleotide sequences of various full-length cDNAs are used as target DNA, including the polynucleotide of the present invention. They were respectively amplified by PCR. After purification, the concentration of the amplified product was adjusted to about 500 ng / ul, and the samples were spotted on a glass medium with a Cartesian 7500 spotter (purchased from Cartesian Company, USA). The distance between the points is 280 ⁇ ⁇ . The spotted slides were hydrated, dried, and cross-linked in a purple diplomatic coupling instrument. After elution, the DNA was fixed on a glass slide to prepare a chip. The specific method steps have been reported in the literature in various ways. The post-spot processing steps of this embodiment are:
- the fluorescent test J Cy3dUTP (5-Amino-propargy 1-2 '-deoxyur dine 5'-triphate coupled to Cy3 f luorescent dye, purchased from Amersham Phamacia Biotech) was used to label the mRNA of human mixed tissue, using a fluorescent reagent Cy5dUTP (5-Amino-propargy l-2'-deoxyur idine 5'-tr iphate coupled to Cy5 f luorescent dye, purchased from Amersham Phamacia Biotech) to label mRNA of specific tissues (or stimulated cell lines) in the body, after purification A probe was prepared.
- Cy3dUTP 5-Amino-propargy 1-2 '-deoxyur dine 5'-triphate coupled to Cy3 f luorescent dye, purchased from Amersham Phamacia Biotech
- the probes from the above two types of tissues were hybridized with the chip in a UniHyb TM Hybridization Solution (purchased from TeleChem) hybridization solution for 16 hours, and washed with a washing solution (lx SSC, 0.2% SDS) at room temperature. Scanning was then performed with a ScanArray 3000 scanner (purchased from General Scanning, USA). The scanned images were analyzed and processed with Imagene software (Biodiscovery, USA) to calculate the Cy3 / Cy5 ratio of each point.
- the above specific tissues are fetal brain, bladder mucosa, PMA + Ecv304 cell line, LPS + Ecv304 cell line thymus, normal fibroblasts 1024NC, Fibroblas t, growth factor stimulation, 1024NT, scar formation fc growth factor stimulation, 1013HT, scar into fc without growth factor stimulation, 1 G13HC, bladder cancer plant cell EJ, bladder cancer, bladder cancer, liver cancer, liver cancer cell line, fetal skin, spleen, prostate cancer, jejunal adenocarcinoma Cardiac cancer. Draw a graph based on these 18 Cy3 / Cy5 ratios. (figure 1 ) . The figure shows that the nucleotide reductase 10.49 and nucleotide reductase expression profiles of the present invention are very similar.
- polypeptides of the present invention and the antagonists, agonists and inhibitors of the polypeptides can be directly used in the treatment of diseases.
- they can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection, and immune diseases.
- deoxynucleotides are formed from the corresponding nucleotides by replacing the 2'-0H group with hydrogen.
- the ribonucleotide reductase that catalyzes this type of nucleotide reduction contains non-heme, which is composed of more than one polypeptide chain, and has a reducing effect on diphosphate (ADP, GDP, CDP and UDP). Be specific. Its small subunit is combined with two iron ions in the organism (glutamic acid, asparagine and two histidines in the amino acid sequence of the protein are involved in the binding of metal ions), and the subunit also contains Active tyrosine site. It can be seen that the conserved sequence specific for the small subunit of the nucleotide reductase is necessary to form its active motif.
- the abnormal expression of the specific nucleotide reductase small subunit mo tif will cause the function of the polypeptide containing the mo tif of the present invention to be abnormal, thereby causing the nucleotide reductase to function abnormally, thereby affecting deoxynucleosides.
- the synthesis of acid affects the transmission of genetic information and produces related diseases such as purine and pyrimidine metabolism defects, tumors, embryonic development disorders, and growth and development disorders.
- the abnormal expression of the nucleotide reductase 10.49 of the present invention will produce various diseases, especially purine and pyrimidine metabolism deficiency diseases, various tumors, embryonic development disorders, and growth and development disorders. These diseases include But not limited to:
- Purine and Pyrimidine Metabolism Defects Abnormal purine metabolism such as Ray-niney syndrome, xanthineuria, abnormal pyrimidine metabolism such as orotic aciduria, adenine deaminase deficiency
- Embryonic disorders congenital abortion, cleft palate, limb absentness, limb differentiation disorder, hyaline membrane disease, atelectasis, polycystic kidney disease, double ureter, crypto, congenital inguinal hernia, double uterus, vaginal atresia, hypospadias , Bisexual deformity, Atrial septal defect, Ventricular septal defect, Pulmonary stenosis, Arterial duct occlusion, Neural tube defect, Congenital hydrocephalus, Iris defect, Congenital cataract, Congenital glaucoma or cataract, Congenital deafness
- Growth and development disorders mental retardation, cerebral palsy, brain development disorders, mental retardation, familial cerebral nucleus hypoplasia syndrome, strabismus, skin, fat and muscular dysplasia such as congenital skin sagging, premature aging Disease, congenital keratosis, various metabolic defects such as various amino acid metabolic defects, stunting, dwarfism, sexual retardation
- Tumors of various tissues gastric cancer, liver cancer, lung cancer, esophageal cancer, breast cancer, leukemia, lymphoma, thyroid tumor, uterine fibroids, neuroblastoma, astrocytoma, ependymoma, glioblastoma, Colon cancer, melanoma, adrenal cancer, bladder cancer, bone cancer, osteosarcoma, myeloma, bone marrow cancer, brain cancer, uterine cancer, endometrial cancer, gallbladder cancer, colon cancer, thymic tumor, nasal cavity and sinus tumor, nose Pharyngeal, laryngeal, tracheal, fibroid, fibrosarcoma, lipoma, liposarcoma, leiomyoma
- This invention also provides screening compounds to identify improving (agonist) or repressing (antagonist) nucleotide reductase 1 0.
- nucleotide reductase 10.49 method of medicament.
- Agonists increase the biological functions of nucleotide reductase 10.49 to stimulate cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
- mammalian cells or membrane preparations expressing nucleotide reductase 10.49 can be cultured with labeled nucleotide reductase 10.49—in the presence of a drug. Then measure the ability of the drug to increase or block this interaction Force.
- Antagonists of nucleotide reductase 10.49 include antibodies, compounds, receptor deletions, and the like that have been screened.
- An antagonist of nucleotide reductase 10.49 can bind to nucleotide reductase 10.49 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide to render the polypeptide incapable. Play biological functions.
- nucleotide reductase 10.49 When screening compounds as antagonists, nucleotide reductase 10.49 can be added to the bioanalytical assay and determined by measuring the effect of the compound on the interaction between the nucleotide reductase 10.49 and its receptor Whether the compound is an antagonist. Receptor deletions and analogs that function as antagonists can be screened in the same manner as described above for screening compounds. Polypeptide molecules capable of binding to nucleotide reductase 10.49 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. When screening, the molecule of the nucleotide reductase 10.49 should generally be labeled.
- the present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies.
- the invention also provides antibodies directed against a nucleotide reductase 10.49 epitope. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by Fab expression libraries.
- Polyclonal antibodies can be produced by injecting nucleotide reductase 10.49 directly into immunized animals (such as rabbits, mice, rats, etc.).
- immunized animals such as rabbits, mice, rats, etc.
- a variety of adjuvants can be used to enhance the immune response, including but not limited to 'S adjuvant and so on.
- Techniques for preparing monoclonal antibodies for nucleotide reductase 10.49 include, but are not limited to, hybridoma technology (Kohler and Miste in. Nature, 1975, 256: 495-497), triple tumor technology, human beta cells Hybridoma technology, EBV-hybridoma technology, etc.
- Embedding antibodies that bind human constant regions to non-human variable regions can be produced using known techniques (Morrison et al., PNAS, 1985, 81: 6851).
- the existing technology for producing single chain antibodies U.S. Pat No. 4946778, can also be used to produce single chain antibodies against nucleotide reductase 1 0.49.
- Antibodies against nucleotide reductase 10.49 can be used in immunohistochemical techniques to detect nucleotide reductase 10.49 in biopsy specimens.
- Monoclonal antibodies that bind to nucleotide reductase 10.49 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
- Antibodies can also be used to design immunotoxins that target a particular part of the body.
- High-affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
- a common method is to attack the amino group of the antibody with a thiol crosslinker such as SPDP, Through the exchange of disulfide bonds, toxins are bound to antibodies.
- This hybrid antibody can be used to kill cells that are positive for nucleotide reductase 10.49.
- the antibodies of the present invention can be used to treat or prevent diseases related to nucleotide reductase 10.49.
- Administration of an appropriate dose of antibody can stimulate or block the production or activity of nucleotide reductase 10.49.
- the invention also relates to a diagnostic test method for quantitatively and locally detecting the level of nucleotide reductase 10.49.
- tests are well known in the art and include FISH assays and radioimmunoassays.
- the level of nucleotide reductase 10.49 detected in the test can be used to explain the importance of nucleotide reductase 10.49 in various diseases and to diagnose diseases in which nucleotide reductase 10.49 plays a role.
- polypeptide of the present invention can also be used for peptide mapping analysis.
- the polypeptide can be specifically cleaved by physical, chemical or enzyme, and one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis. .
- a polynucleotide encoding a nucleotide reductase 10.49 can also be used for a variety of therapeutic purposes.
- Gene therapy techniques can be used to treat abnormal cell proliferation, development, or metabolism caused by the absence or abnormal / inactive expression of nucleotide reductase 10.49.
- Recombinant gene therapy vectors (such as viral vectors) can be designed to express the mutated nucleotide reductase 10.49 to inhibit endogenous nucleotide reductase 10.49 activity.
- a mutated nucleotide reductase 10.49 may be a shortened nucleotide reductase 10.49 that lacks a signaling domain, although it can bind to downstream substrates, but lacks signaling activity. Therefore, recombinant gene therapy vectors can be used to treat diseases caused by abnormal expression or activity of nucleotide reductase 10.49.
- Expression vectors derived from viruses such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to transfer a polynucleotide encoding a nucleotide reductase 10.49 into a cell.
- recombinant viral vectors carrying a polynucleotide encoding a nucleotide reductase 10.49 can be found in the literature (Sambrook, et al.).
- a recombinant polynucleotide encoding a nucleotide reductase 10.49 can be packaged into liposomes and transferred into cells.
- Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
- a vector such as a virus, phage, or plasmid
- Oligonucleotides including antisense RNA and DNA
- ribozymes that inhibit the nucleotide reductase 10.49 mRNA are also within the scope of the present invention.
- a ribozyme is an enzyme-like RNA molecule that can specifically decompose a specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation.
- Antisense RNA and DM and ribozymes can be obtained by any existing RNA or DNA synthesis technology. For example, the technology for the synthesis of oligonucleotides by solid-phase phosphate amide chemical synthesis has been widely used.
- Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA. RNA polymerase Promoter downstream. In order to increase the stability of a nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the ribonucleoside linkages should use phosphate thioester or peptide bonds instead of phosphodiester bonds.
- the polynucleotide encoding the nucleotide reductase 10.49 can be used for the diagnosis of diseases related to the nucleotide reductase 10.49.
- the polynucleotide encoding the nucleotide reductase 1 0.49 can be used to detect the expression of the nucleotide reductase 1 0.49 or the abnormal expression of the nucleotide reductase 1 0.49 in a disease state.
- a DNA sequence encoding a nucleotide reductase 1 0.49 can be used to hybridize a biopsy specimen to determine the expression status of the nucleotide reductase 1 0.49.
- Hybridization techniques include Sou thern blotting, Nor thern blotting, and in situ hybridization. These techniques and methods are publicly available and mature, and related kits are commercially available. Some or all of the polynucleotides of the present invention can be used as probes to be fixed on a micro array (Mi croar ray) or a DNA chip (also known as a "gene chip") for analyzing differential expression analysis of genes and genetic diagnosis in tissues . Nucleotide reductase 10.49 specific primers can be used for RNA-polymerase chain reaction (RT-PCR) amplification in vitro to detect the transcription products of nucleotide reductase 10.49.
- RT-PCR RNA-polymerase chain reaction
- Nucleotide reductase 10.49 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to normal wild-type nucleotide reductase 10.49 DNA sequences. Mutations can be detected using existing techniques such as Sou thern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression. Therefore, Nor thern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
- the sequences of the invention are also valuable for chromosome identification.
- the sequence specifically targets a specific position on a human chromosome and can hybridize to it.
- specific sites for each gene on the chromosome need to be identified.
- only a few chromosome markers based on actual sequence data are available for marking chromosome positions.
- an important first step is to locate these DNA sequences on a chromosome.
- a PCR primer (preferably 15-35 bp) is prepared from the cDNA, and the sequence can be located on the chromosome. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
- PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
- oligonucleotide primers of the present invention by a similar method, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
- Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and hybrid pre-selection to construct chromosome-specific cDNA libraries.
- Fluorescent in situ hybridization (FISH) of cDNA clones to metaphase chromosomes allows precise chromosomal localization in one step.
- FISH fluorescent in situ hybridization
- the physical location of the sequence on the chromosome can be correlated with the genetic map data. These data can be found in, for example, V. Mckusick, Mendelian Inheritance in Man (available online with Johns Hopkins University Welch Medical Library). Linkage analysis can then be used to determine the relationship between genes and diseases that are mapped to chromosomal regions.
- the difference in cDNA or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the CDM that is accurately mapped to a disease-related chromosomal region can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).
- the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
- suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
- the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
- the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
- a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
- these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell.
- the polypeptides of the invention can be used in combination with other therapeutic compounds.
- the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
- Nucleotide reductase 10. 49 is administered in an amount effective to treat and / or prevent a specific indication.
- the amount and range of nucleotide reductases 10.49 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician.
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- Microbiology (AREA)
- Biotechnology (AREA)
- Biomedical Technology (AREA)
- Molecular Biology (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Enzymes And Modification Thereof (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Peptides Or Proteins (AREA)
Abstract
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
AU2001295393A AU2001295393A1 (en) | 2000-06-21 | 2001-06-19 | A novel polypeptide-homo ribonucleotide reductase 10.49 and polynucleotide encoding said polypeptide |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN 00116643 CN1329146A (zh) | 2000-06-21 | 2000-06-21 | 一种新的多肽——核苷酸还原酶10.49和编码这种多肽的多核苷酸 |
CN00116643.3 | 2000-06-21 |
Publications (1)
Publication Number | Publication Date |
---|---|
WO2002020577A1 true WO2002020577A1 (fr) | 2002-03-14 |
Family
ID=4586045
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/CN2001/001007 WO2002020577A1 (fr) | 2000-06-21 | 2001-06-19 | Nouveau polypeptide, nucleoside reductase 10.49, et polynucleotide codant ce polypeptide |
Country Status (3)
Country | Link |
---|---|
CN (1) | CN1329146A (fr) |
AU (1) | AU2001295393A1 (fr) |
WO (1) | WO2002020577A1 (fr) |
Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN1256632A (zh) * | 1997-03-19 | 2000-06-14 | 吉倪塞思技术公司 | 利用核糖核苷酸还原酶r1抑制恶性肿瘤 |
-
2000
- 2000-06-21 CN CN 00116643 patent/CN1329146A/zh active Pending
-
2001
- 2001-06-19 WO PCT/CN2001/001007 patent/WO2002020577A1/fr active Application Filing
- 2001-06-19 AU AU2001295393A patent/AU2001295393A1/en not_active Abandoned
Patent Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN1256632A (zh) * | 1997-03-19 | 2000-06-14 | 吉倪塞思技术公司 | 利用核糖核苷酸还原酶r1抑制恶性肿瘤 |
Non-Patent Citations (2)
Title |
---|
QIAN LISHENG ET AL.: "Cloning and sequencing of pSTY28 DNA fragment of human herpesvirus-6", VIROLOGICA SINICA, vol. 10, no. 4, December 1995 (1995-12-01), pages 309 - 316 * |
QIAN LISHENG ET AL.: "Study on gene expression and function for ribonucleotide reductase of HHV-6", CHIN. J. MICROBIOL. IMMUNOL., vol. 16, no. 5, September 1995 (1995-09-01), pages 370 - 373 * |
Also Published As
Publication number | Publication date |
---|---|
CN1329146A (zh) | 2002-01-02 |
AU2001295393A1 (en) | 2002-03-22 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
WO2001072812A1 (fr) | Nouveau polypeptide, bromodomaine humain 10, et polynucleotide codant pour ce polypeptide | |
WO2002020795A1 (fr) | Nouveau polypeptide, hexokinase proteine 9.68, et polynucleotide codant ce polypeptide | |
WO2002014510A1 (fr) | Nouveau polypeptide, proteine cbp20 humaine 47.74, et polynucleotide codant ce polypeptide | |
WO2002020577A1 (fr) | Nouveau polypeptide, nucleoside reductase 10.49, et polynucleotide codant ce polypeptide | |
WO2001070956A1 (fr) | Nouveau polypeptide, proteine humaine de reparation 8 du mesappariement de l'adn, et polynucleotide codant pour ce polypeptide | |
WO2001098488A1 (fr) | Nouveau polypeptide, sous-unite 24 de flavoproteine humaine, et polynucleotide codant ce polypeptide | |
WO2001047975A1 (fr) | Nouveau polypeptide, proteine 10 contenant un domaine chromo, et polynucleotide codant pour ce polypeptide | |
WO2001046437A1 (fr) | Nouveau polypeptide, region de liaison d'arn-eucaryote rnp-1-21, et polynucleotide codant pour ce polypeptide | |
WO2001075048A2 (fr) | Nouveau polypeptide, proteine ribosomale humaine s11 23, et polynucleotide codant pour ce polypeptide | |
WO2001083758A2 (fr) | Nouveau polypeptide, dihydroorotase humaine 8, et polynucleotide codant pour ce polypeptide | |
WO2001073009A1 (fr) | Nouveau polypeptide, bromodomaine humain 11, et polynucleotide codant pour ce polypeptide | |
WO2001087968A1 (fr) | Proteine s4-36 ribosomale, polypeptide humain, et polynucleotide la codant | |
WO2001079437A2 (fr) | Nouveau polypeptide, facteur humain de transcription de la differentiation cellulaire 14, et polynucleotide codant pour ce polypeptide | |
WO2001070790A1 (fr) | Nouveau polypeptide, dihydrooratase humaine 23, et polynucleotide codant pour ce polypeptide | |
WO2001070784A1 (fr) | Nouveau polypeptide, proteine humaine 17 contenant un domaine de structure chromo, et polynucleotide codant pour ce polypeptide | |
WO2001075018A2 (fr) | Nouveau polypeptide, facteur humain de regulation de la transcription 31, et polynucleotide codant pour ce polypeptide | |
WO2001083724A1 (fr) | Nouveau polypeptide, dihydroorotase humaine 17, et polynucleotide codant pour ce polypeptide | |
WO2001070957A1 (fr) | Nouveau polypeptide, proteine humaine de reparation 9.4 du mesappariement de l'adn, et polynucleotide codant pour ce polypeptide | |
WO2001085776A1 (fr) | Polypeptide humain dihydro-orotase 12 et polynucleotide codant pour ce polypeptide | |
WO2001048166A1 (fr) | Nouveau polypeptide, ribonucleotide reductase 10, et polynucleotide codant pour ce polypeptide | |
WO2002026795A1 (fr) | Nouveau polypeptide, dihydrooratase humaine 15.29, et polynucleotide codant ce polypeptide | |
WO2001075126A1 (fr) | Nouveau polypeptide, proteine ribosomale humaine s18-9, et polynucleotide codant pour ce polypeptide | |
WO2001075100A1 (fr) | Nouveau polypeptide, proteine humaine de reparation 10 du mesappariement de l'adn, et polynucleotide codant pour ce polypeptide | |
WO2001079436A2 (fr) | Nouveau polypeptide, facteur humain de transcription de la differentiation cellulaire 10, et polynucleotide codant pour ce polypeptide | |
WO2001055419A1 (fr) | Nouveau polypeptide, site de liaison 27 d'arn s1, et polynucleotide codant pour ce polypeptide |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A1 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
122 | Ep: pct application non-entry in european phase | ||
NENP | Non-entry into the national phase |
Ref country code: JP |