WO2001070790A1 - Nouveau polypeptide, dihydrooratase humaine 23, et polynucleotide codant pour ce polypeptide - Google Patents
Nouveau polypeptide, dihydrooratase humaine 23, et polynucleotide codant pour ce polypeptide Download PDFInfo
- Publication number
- WO2001070790A1 WO2001070790A1 PCT/CN2001/000267 CN0100267W WO0170790A1 WO 2001070790 A1 WO2001070790 A1 WO 2001070790A1 CN 0100267 W CN0100267 W CN 0100267W WO 0170790 A1 WO0170790 A1 WO 0170790A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- polypeptide
- polynucleotide
- human dihydroorotase
- sequence
- seq
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/78—Hydrolases (3) acting on carbon to nitrogen bonds other than peptide bonds (3.5)
- C12N9/86—Hydrolases (3) acting on carbon to nitrogen bonds other than peptide bonds (3.5) acting on amide bonds in cyclic amides, e.g. penicillinase (3.5.2)
Definitions
- the present invention belongs to the field of biotechnology. Specifically, the present invention describes a novel polypeptide-human dihydroorotase 23, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and polypeptide. Background technique
- Dihydroorotase also known as carbamoyl aspartate dehydratase, catalyzes the initiation of the third stage of pyrimidine biosynthesis and makes ureidosuccinate (N-carbamoyl-L- Aspartic acid) is converted to dihydroorotate.
- Dihydroorotase is one of the very few enzymes that can biosynthesize an amino bond-catalyzed reaction without directly coupling energy such as ATP. This catalytic reaction also incorporates a zinc atom necessary for catalytic activity.
- dihydroorotase In bacteria, dihydroorotase is a dimer composed of two identical long chains of about 400 amino acid residues; in higher eukaryotes, dihydroorotase is one This function is part of a large protein; in Drosophila and mammals, it catalyzes the first three steps of pyrimidine biosynthesis. Dihydroorotase is located at the center of this multiprotein. In yeast, dihydroorotase is encoded by a monofunctional protein gene (URA4). However, a dihydroorotase mutant strain was found to be encoded by the multifunctional protein gene (URA2), catalyzing the first two steps of pyrimidine synthesis.
- UAA4 monofunctional protein gene
- UAA2 multifunctional protein gene
- N-terminal conserved sequence D- [LIVMFYWSAP] -H- [L IVA] -H- [L IVF]-[RN] -x- [PGN], where two H may be sites of zinc ligands .
- conserved sequences at the C-terminus [GA]-[ST]-D- X- A-P- H- x (4)-K, applicable to all dihydroorotase-related enzymes except allantoinase.
- human dihydroorotase 23 protein regulates body weight such as cell division and embryonic development. To play an important role in function, and it is believed that a large number of proteins are involved in these regulatory processes, it has been necessary in the art to identify more human dihydroorotase 23 proteins involved in these processes, especially the amino acid sequence of this protein. . Isolation of the new human dihydroorotase 23 protein encoding gene also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for disease 1 and it is therefore important to isolate its coding for DM. Disclosure of invention
- Another object of the invention is to provide a polynucleotide encoding the polypeptide.
- Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding human dihydroorotase 23.
- Another object of the present invention is to provide a method for producing human dihydroorotase 23.
- Another object of the present invention is to provide an antibody against the human dihydroorotase 23 of the polypeptide of the present invention.
- Another object of the present invention is to provide mimetic compounds, antagonists, agonists, and inhibitors of the human dihydroorotase 23 of the polypeptide of the present invention.
- Another object of the present invention is to provide a method for diagnosing and treating diseases related to abnormalities of human dihydroorotase 23.
- the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
- the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
- the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
- sequence of the polynucleotide is one selected from the group consisting of: (a) having SEQ ID NO: 1
- the invention further relates to a vector, in particular an expression vector, containing the polynucleotide of the invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; a package
- the method of preparing the polypeptide of the present invention includes culturing the host cell and recovering the expressed product.
- the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
- the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of human dihydroorotase 23 protein, which comprises utilizing the polypeptide of the invention.
- the invention also relates to compounds obtained by this method.
- the present invention also relates to a method for in vitro detection of a disease or disease susceptibility related to abnormal expression of human dihydroorotase 23 protein, which comprises detecting a mutation in the polypeptide or a polynucleotide sequence encoding the same in a biological sample, or Detection of the amount or biological activity of a polypeptide of the invention in a biological sample.
- the invention also relates to a pharmaceutical composition
- a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
- the present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention in the preparation of a medicament for treating cancer, developmental disease or immune disease or other diseases caused by abnormal expression of human dihydroorotase 23.
- Nucleic acid sequence refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
- amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
- amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
- a “variant" of a protein or polynucleotide refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it.
- the changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence.
- Variants can have "conservative" changes, in which the amino acid substituted has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine.
- Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
- “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
- “Insertion” or “addition” refers to an alteration in the amino acid sequence or nucleotide sequence that results in an increase in one or more amino acids or nucleotides compared to a naturally occurring molecule. "Replacement” refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
- Biological activity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
- the term “immunologically active” refers to the ability of natural, recombinant, or synthetic proteins and fragments thereof to induce a specific immune response and to bind specific antibodies in a suitable animal or cell.
- An "agonist” refers to a molecule that, when combined with human dihydroorotase 23, causes the protein to change, thereby regulating the activity of the protein.
- An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that binds human dihydroorotase 23.
- Antagonist refers to a molecule that, when combined with human dihydroorotase 23, can block or regulate the biological or immunological activity of human dihydroorotase 23.
- Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates, or any other molecule that binds human dihydroorotase 23.
- Regular refers to a change in the function of human dihydroorotase 23, including an increase or decrease in protein activity, a change in binding properties, and any other biological properties, functions, or immunity of human dihydroorotase 23 Change of nature.
- substantially pure ' means substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated.
- Those skilled in the art can purify human dihydroorotase enzyme 23 using standard protein purification techniques.
- Substantially pure human dihydroorotase 23 produces a single main band on a non-reducing polyacrylamide gel.
- the purity of human dihydroorotase 23 polypeptide can be analyzed by amino acid sequence.
- Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
- sequence C-T-G-A
- complementary sequence G-A-C-T.
- the complementarity between two single-stranded molecules may be partial or complete.
- the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
- “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
- Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Southern imprinting or Nor thern blotting, etc.) under conditions of reduced stringency.
- Substantially homologous sequences or hybridization probes can compete and inhibit the binding of fully homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that conditions with reduced stringency allow non-specific binding, because conditions with reduced stringency require that the two sequences bind to each other as either specific or selective interactions.
- Percent identity refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALIGN program (Lasergene sof tware package, DNASTAR, Inc., Madi son Wis.). The MEGALIGN program can compare two or more sequences according to different methods such as the Clus ter method (Hi gg ins, DG and PM Sharp (1988) Gene 73: 237-244). 0 The Clus ter method checks all The distances arrange the groups of sequences into clusters. The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula: The number of matching residues between sequence A and sequence X 1 00 The number of residues in sequence A-the interval residues in sequence A Number of interval residues in sequence B
- the percent identity between nucleic acid sequences can also be determined by the Cluster method or by methods known in the art such as: To tun He in (He in J., (1990) Me thods in emzumo l ogy 183: 625-645 ) 0 "Similarity” refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
- Amino acids used for conservative substitutions may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
- Antisense refers to a nucleotide sequence that is complementary to a particular DM or RNA sequence.
- Antisense strand refers to a nucleic acid strand that is complementary to a “sense strand.”
- Derivative refers to a chemical modification of HFP or a nucleic acid encoding it. This chemical modification may be a substitution of a hydrogen atom with a fluorenyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
- Antibody refers to a complete antibody molecule and its fragments, such as Fa,? ( ⁇ ') 2 and? , It can specifically bind to the epitope of human dihydroorotase 23.
- a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
- isolated refers to the removal of a substance from its original environment (for example, its natural environment if it occurs naturally).
- a naturally occurring polynucleotide or polypeptide is not isolated when it is present in a living animal, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
- Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not a component of its natural environment, they are still isolated.
- isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
- polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances existing in the natural state.
- isolated human dihydroorotase 23 means that human dihydroorotase 23 is substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated. Those skilled in the art can purify human dihydroorotase 23 using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of human dihydroorotase 23 polypeptide can be analyzed by amino acid sequence.
- the present invention provides a new polypeptide, human dihydroorotase 23, which is basically composed of the amino acid sequence shown in SEQ ID NO: 2.
- the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
- the polypeptides of the invention can be naturally purified products, or chemically synthesized products, or produced using recombinant techniques from prokaryotic or eukaryotic hosts (e.g., bacteria, yeast, higher plants, insects, and mammalian cells). Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
- the invention also includes fragments, derivatives, and analogs of human dihydroorotase 23.
- fragment refers to a polypeptide that substantially maintains the same biological function or activity of the human dihydroorotase 23 of the present invention.
- a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution
- the amino acid may or may not be encoded by a genetic codon; or ( ⁇ ) a type in which a group on one or more amino acid residues is replaced by another group to include a substituent; or ( ⁇ ⁇ )
- Such a polypeptide sequence in which the mature polypeptide is fused with another compound such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol
- a polypeptide sequence in which an additional amino acid sequence is fused into the mature polypeptide (Such as a leader sequence or a secreted sequence or a sequence used to purify this polypeptide or a protein sequence)
- fragments, 00 derivatives and analogs are considered to be within the knowledge of those skilled in the art.
- the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
- the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
- the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a full-length polynucleotide sequence of 1987 bases, and its open reading frame 764-1 384 encodes 206 amino acids.
- the polynucleotide of the present invention may be in the form of MA or RNA.
- DNA forms include cDNA, genomic DNA, or synthetic DM.
- DNA can be single-stranded or double-stranded.
- DNA can be coding or non-coding.
- the coding region sequence encoding the mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
- a "degenerate variant" is in the present invention It refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1.
- the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
- polynucleotide encoding a polypeptide refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.
- the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
- Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
- an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
- the present invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity, between the two sequences).
- the present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions.
- "strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60 ° C; or (2) Add a denaturant during hybridization, such as 50 ° /.
- the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
- nucleic acid fragments that hybridize to the sequences described above.
- a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 cores. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques, such as PCR, to identify and / or isolate polynucleotides encoding human dihydroorotase 23.
- polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
- the specific polynucleotide sequence encoding human dihydroorotase 23 of the present invention can be obtained by various methods.
- polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
- the DM fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DM sequence from the genome DM; 2) chemically synthesizing the DM sequence to obtain the double-stranded DNA of the polypeptide.
- genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences Is the method of choice. The more commonly used method is the isolation of cDNA sequences.
- the standard method for isolating the CDM of interest is to isolate mRM from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library.
- the construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989).
- Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
- genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DNA-RNA hybridization; (2) the presence or absence of a marker gene function; (3) determining the level of human dihydroorotase 23 transcripts; (4) Detecting the protein product of gene expression by immunological technology or measuring biological activity. The above methods can be used singly or in combination.
- the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
- the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
- the probe used here is usually a DM sequence chemically synthesized based on the gene sequence information of the present invention.
- the genes or fragments of the present invention can of course be used as probes.
- DM probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
- immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) can be used to detect the protein product expressed by the human dihydroorotase 23 gene.
- ELISA enzyme-linked immunosorbent assay
- the RACE method RACE-cDM terminal rapid amplification method
- the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein.
- the amplified DM / RM fragment can be isolated and purified by conventional methods such as by gel electrophoresis.
- polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5403-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, the sequencing must be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDM sequence.
- the present invention also relates to a vector comprising a polynucleotide of the present invention, and a host cell that is genetically engineered using the vector of the present invention or directly using a human dihydroorotase 23 coding sequence, and to produce the polypeptide of the present invention by recombinant technology. Methods.
- a polynucleotide sequence encoding human dihydroorotase 23 can be inserted into a vector to It constitutes a recombinant vector containing the polynucleotide of the present invention.
- vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
- Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Ros enberg, et al.
- any plasmid and vector can be used to construct a recombinant expression vector.
- An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
- Methods well known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding human dihydroorotase 23 and appropriate transcription / translation regulatory elements. These methods include in vitro recombination DM technology, naval synthesis technology, in vivo recombination technology, etc. (Sambroook, et al. Mo lecu lar Cloning, a Laboratory Manua, cold Harbor Labora tory. New York, 1989).
- the DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide mRM synthesis. Representative examples of these promoters are: the l ac or trp promoter of E.
- the expression vector also includes a ribosome binding site for translation initiation, a transcription terminator, and the like. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors expressed by DM, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Examples include the SV40 enhancer of 100 to 270 base pairs on the late side of the origin of replication, the polyoma enhancer on the late side of the origin of replication, and the adenoviral enhancer.
- the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
- selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
- GFP fluorescent protein
- tetracycline or ampicillin resistance for E. coli.
- a polynucleotide encoding human dihydroorotase 23 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to form a genetically engineered host cell containing the polynucleotide or the recombinant vector.
- host cell refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E.
- Transformation of a host cell with a DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art.
- the host is a prokaryote such as E. coli
- competent cells capable of absorbing DM can be harvested after the exponential growth phase and treated with the CaCl 2 method. The steps used are well known in the art. Alternatively, M g Cl 2 is used. If necessary, transformation can also be performed by electroporation.
- the host is a eukaryotic organism, the following DM transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
- the polynucleotide sequence of the present invention can be used to express or produce recombinant human dihydroorotase 23 (Scieence, 1984; 224: 1431). Generally, the following steps are taken:
- the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
- a suitable method such as temperature conversion or chemical induction
- the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell.
- recombinant proteins can be separated and purified by various separation methods using their physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
- conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography
- FIG. 1 is a comparison diagram of gene chip expression profiles of the dihydroorotase 23 and human dihydroorotase 10 of the present invention.
- the upper graph is a graph of the expression profile of human dihydroorotase 23, and the lower sequence is the graph of the expression profile of human dihydroorotase 23.
- Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of isolated human dihydroorotase 23.
- 23 kDa is the molecular weight of the protein.
- the arrow indicates the isolated protein band.
- Dye terminate cycle reaction sequencing kit Perkin-Elmer
- ABI 377 automatic sequencer Perkin-Elmer
- CDNA was synthesized using fetal brain total RNA as a template and oligo-dT as a primer for reverse transcription reaction. After purification using Qiagene's kit, the following primers were used for PCR amplification:
- Primer 1 5'- AAAAATTGGTTTGATGAGAAGATT -3 '(SEQ ID NO: 3)
- Primer2 5'- GACAGAGTCTTGCTCTGCCACGCA -3 '(SEQ ID NO: 4)
- Primerl is a forward sequence located at the 5th end of SEQ ID NO: 1, starting at lbp;
- Priraer2 is the 3 'end reverse sequence in SEQ ID NO: 1.
- Amplification reaction conditions 50 mmol / L KC1, 10 mmol / L Tris-CI, (pH 8.5), 1.5 mraol / L MgCl 2 , 200 ⁇ mol / L dNTP, lOpmol primer, 1 U in a reaction volume of 50 ⁇ 1 Taq DNA polymerase (Clontech).
- the reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) under the following conditions for 25 cycles: 94 ° C 30sec; 55 ° C 30sec; 72 ° C 2min 0 ⁇ -actin was also set as a positive control during RT-PCR And template blank is negative control.
- the amplified product was purified using a QIAGEN kit and ligated to a pCR vector (Invitrogen product) using a TA cloning kit. DNA sequence analysis results indicate PCR The DM sequence of the product is exactly the same as the 1-1987bp shown in SEQ ID NO: 1.
- Example 3 Northern blot analysis of human dihydroorotase 23 gene expression:
- RNA extraction in one step [Anal. Biochera 1987, 162, 156-159] 0
- This method involves acid guanidinium thiocyanate-chloroform extraction. That is, the tissue is homogenized with 4M guanidinium isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1 ) And centrifuge after mixing. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. The obtained RM precipitate was washed with 70% ethanol, dried and dissolved in water.
- RNA was synthesized by electrophoresis on a 1.2% agarose gel containing 20 mM 3- (N-morpholino) propanesulfonic acid (pH 7.0)-5 mM sodium acetate-ImM EDTA-2.2M formaldehyde. It was then transferred to a nitrocellulose membrane.
- the DNA probe used was the PCR amplified human dihydroorotase 23 coding region sequence (764bp to 1384bp) shown in FIG. 1.
- a 32P-labeled probe (approximately 2 x 10 6 cpm / ml) was hybridized with a nitrocellulose membrane to which RM was transferred at 42 ° C overnight in a solution containing 50% formamide-25mM ⁇ 2 ⁇ 0 4 ( ⁇ 7.4)-5 x SSC-5 x Denhardt's solution and 200 ⁇ g / ml salmon sperm DNA. After hybridization, the filters were washed in 1 x SSC-0.1 ° / «SDS at 55 ° C for 30 min. Then, Phosphor Imager was used for analysis and quantification.
- Example 4 In vitro expression, isolation and purification of recombinant human dihydroorotase 23
- Primer3 5 '-CCCCATATGATGTTTCCTGTGTTCTTTCACAAG-3' (Seq ID No: 5)
- Primer4 5'-CATGGATCCTCATTGAAACTGATTGGGTGGTTG- 3 '(Seq ID No: 6)
- the 5' ends of these two primers contain Ndel and BamHI digestion sites, respectively, followed by the coding sequences of the 5 'and 3' ends of the target gene, respectively.
- the Ndel and BamHI restriction sites correspond to the selective endonuclease sites on the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865.3).
- the PCR reaction was performed using the pBS-0039c05 plasmid containing the full-length target gene as a template.
- the PCR reaction conditions were as follows: 10 pg of pBS-0039c05 plasmid, Primer-3, and Primer-4 in a total volume of 50 ⁇ 1 (J is lOpmol, Advantage polymerase Mix (Clontech)) 1 ⁇ 1. Cycle parameters: 94 ° C 20s, 60 ° C 30s, 68. C 2 min, a total of 25 cycles. Digestion of the amplified product and plasmid pET-28 (+) with Ndel and BamHI respectively, large fragments were recovered and ligated with T4 Enzyme ligation. The ligation product was transformed into E. coli DH5 ⁇ using the calcium chloride method.
- a peptide specific to human dihydroorotase 23 was synthesized using a peptide synthesizer (product of PE): NH2-Met-Phe-Pro-Val-Phe-Phe-His-Lys-Asp-Lys-Gly-Arg -Gly-Cys-Ser- COOH (SEQ ID NO: 7).
- the polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex, respectively.
- Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
- the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
- the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
- the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method.
- Filter hybridization methods include dot blot method, Southern blot method, Northern blot method, and complex method, etc. They are all used to fix the polynucleotide sample to be tested on the filter and then hybridize using basically the same steps.
- the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer, so that the non-specific binding site of the sample on the filter is saturated with the carrier and the synthetic polymer.
- the pre-hybridization solution is then replaced with a hybridization buffer containing the labeled probe and incubated to hybridize the probe to the target nucleic acid.
- the unhybridized probes are removed by a series of membrane washing steps Off.
- This embodiment utilizes higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals.
- the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
- the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
- the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
- oligonucleotide fragments from the polynucleotide SEQ ID NO: 1 of the present invention for use as hybridization probes should follow the following principles and several aspects to be considered:
- the preferred range of probe size is 18-50 nucleotides
- the GC content is 30% -70%, and the non-specific hybridization increases when it exceeds;
- Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other unknown genomic sequences and their complements The regions are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, the primary probe should not be used;
- Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
- Probe 2 (probe2), which belongs to the second type of probe, is equivalent to the replacement mutant sequence (41Nt) of the gene fragment of SEQ ID NO: 1 or its complementary fragment:
- PBS phosphate buffered saline
- step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
- the sample membrane was placed in a plastic bag, and 3-1 Omg pre-hybridization solution (1 OxDenhardf s; 6xSSC, 0. lrag / ml
- CT DNA (calf thymus DNA).
- Gene chip or DNA microarray is a new technology that many national laboratories and large pharmaceutical companies are currently developing and developing. It refers to the orderly and high-density arrangement of a large number of target gene fragments on glass, The data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software to achieve the purpose of fast, efficient, and high-throughput analysis of biological information.
- the polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research on the function of new genes; search for and screen new tissue-specific genes, especially new genes related to diseases such as tumors; disease diagnosis, such as hereditary diseases .
- the specific method steps have been reported in the literature.
- a total of 4,000 polynucleotide sequences of various full-length cDMs are used as target DNA, including the polynucleotide of the present invention. They were respectively amplified by PCR, and the concentration of the amplified product was adjusted to about 500ng / ul after purification. The spots were spotted on a glass medium with a Cartesian 7500 spotter (purchased from Cartesian Company, USA). The distance between them is 280 ⁇ ⁇ . The spotted slides were hydrated, dried, and cross-linked in a purple diplomatic coupling instrument. After elution, the DNA was fixed on a glass slide to prepare a chip. The specific method steps have been reported in the literature in various ways. The post-spot processing steps of this embodiment are:
- Total mRNA was extracted from human mixed tissues and specific tissues (or stimulated cell lines) in one step, and mRNA was purified with Oligotex mRNA Midi Kit (purchased from QiaGen), and separated by reverse transcription! ]
- the fluorescent test was also Cy3dUTP (5-Amino-propargyl-2'_deoxyuridine 5 '-tr iphate coupled to Cy3 f luorescent dye, purchased from Amersham Phamacia Biotech), and the mRNA of human mixed tissue was labeled with Cy5dUTP (5 -Amino- propargyl- 2'- deoxyur idine 5 '-tr iphate coupled to Cy5 f luorescent dye, purchased from Amersham Phamacia Biotech Company, labeled the specific tissue (or stimulated cell line) mRNA of the body, and purified the probe to prepare a probe .
- Cy3dUTP 5-Amino-propargyl-2'_deoxyuridine
- the probes from the above two types of tissues were hybridized with the chip in a UniHyb TM Hybridization Solution (purchased from TeleChem) hybridization solution for 16 hours, and washed with a washing solution (lx SSC, 0.2% SDS) at room temperature. Scanning was then performed with a ScanArray 3000 scanner (purchased from General Scanning, USA), and the scanned images were analyzed and processed with Imagene software (Biodi scovery, USA) to calculate the Cy3 / Cy5 ratio of each point.
- the above specific tissues are thymus, testis, muscle, spleen, lung, skin, thyroid, liver, PMA + Ecv304 cell line, PMA-Ecv304 cell line, non-starved L02 cell line, Arsenic stimulated the L02 cell line and prostate tissue for 1 hour.
- polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat malignant tumors, adrenal deficiency, skin diseases, various inflammations, HIV infections and immune diseases.
- Dihydroorotase catalyzes the initiation of the third stage of pyrimidine biosynthesis, making ureidosuccinate (N- Carbamoyl-L-aspartic acid) is converted to dihydroorotate.
- Dihydroorotase is one of the very few enzymes that can biosynthesize an amino bond-catalyzed reaction without directly coupling energy such as ATP. The biosynthesis of pyrimidine is necessary for the production of nucleotides.
- Dihydroorotase-specific conserved sequences are required to form its active mot if.
- the abnormal expression of the specific dihydroorotase mot if will cause the function of the polypeptide containing the mot if of the present invention to be abnormal, thereby causing abnormalities in nucleotide biosynthesis, and then affecting the regulation and control of genetic information.
- Expression, and produce related diseases such as tumors, embryonic developmental disorders, growth and development disorders, inflammation, etc.
- human dihydroorotase 23 of the present invention will produce various diseases, especially tumors, embryonic developmental disorders, growth and development disorders, and inflammation. These diseases include, but are not limited to:
- Embryonic disorders congenital abortion, cleft palate, limb absentness, limb differentiation disorder, hyaline membrane disease, atelectasis, polycystic kidney disease, double ureter, crypto, congenital inguinal hernia, double uterus, vaginal atresia, hypospadias , Bisexual deformity, Atrial septal defect, Ventricular septal defect, Pulmonary stenosis, Arterial duct occlusion, Neural tube defect, Congenital hydrocephalus, Iris defect, Congenital cataract, Congenital glaucoma or cataract, Congenital deafness
- Growth and development disorders mental retardation, cerebral palsy, brain development disorders, mental retardation, familial cerebral nucleus dysplasia syndrome, strabismus, skin, fat and muscular dysplasia such as congenital skin laxity, premature aging Disease, congenital keratosis, various metabolic defects such as various amino acid metabolic defects, stunting, dwarfism, sexual retardation
- Tumors of various tissues gastric cancer, liver cancer, lung cancer, esophageal cancer, breast cancer, leukemia, lymphoma, thyroid tumor, uterine fibroids, neuroblastoma, astrocytoma, ependymoma, glioblastoma, Colon cancer, melanoma, adrenal cancer, bladder cancer, bone cancer, osteosarcoma, myeloma, bone marrow cancer, brain cancer, uterine cancer, endometrial cancer, gallbladder cancer, colon cancer, thymic tumor, nasal cavity and sinus tumor, nose Pharyngeal cancer, Laryngeal cancer, Tracheal tumor, Fibroma, Fibrosarcoma, Lipoma, Liposarcoma, Leiomyoma Inflammation: Allergic reaction, Bronchial asthma, Allergic pneumonia, Adult respiratory distress syndrome, Sarcoidosis, Rheumatoid Arthritis, rheumatoid arthritis, osteoarthritis,
- human dihydroorotase 23 of the present invention will also produce certain hereditary, hematological and immune system diseases.
- the invention also provides screening compounds to identify improving (agonist) or repressing (antagonist) human dihydrogenated milk.
- Method of pharmacological agents for acidase 23 Agonists enhance biological functions such as human dihydroorotase 23, which stimulates cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
- mammalian cells or membrane preparations expressing human dihydroorotase 23 can be cultured with labeled human dihydroorotase 23 in the presence of a drug. The ability of the drug to increase or block this interaction is then determined.
- Antagonists of human dihydroorotase 23 include screened antibodies, compounds, receptor deletions, and the like. Antagonists of human dihydroorotase 23 can bind to human dihydroorotase 23 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot function biological functions.
- human dihydroorotase 23 When screening compounds as antagonists, human dihydroorotase 23 can be added to a bioanalytical assay to determine the compound by measuring the effect of the compound on the interaction between human dihydroorotase 23 and its receptor Whether it is an antagonist. Receptor deletions and analogs that function as antagonists can be screened in the same manner as described above for screening compounds. Polypeptide molecules capable of binding to human dihydroorotase 23 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. When screening, human dihydroorotase 23 molecules should generally be labeled.
- the present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies.
- the invention also provides antibodies against human dihydroorotase 23 epitopes. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments generated from Fab expression libraries.
- Polyclonal antibodies can be produced by injecting human dihydroorotase 23 directly into immunized animals (such as rabbits, mice, rats, etc.).
- immunized animals such as rabbits, mice, rats, etc.
- adjuvants can be used to enhance the immune response, including but not limited to Freund's Adjuvant, etc.
- Techniques for preparing monoclonal antibodies to human dihydroorotase 23 include, but are not limited to, hybridoma technology (Kohler and Miste in. Nature, 1975, 256: 495-497), triple tumor technology, human beta- Cell hybridoma technology, EBV-hybridoma technology, etc.
- Chimeric antibodies that bind human constant regions to non-human variable regions can be produced using existing techniques (Morrison et al, PNAS, 1985, 81: 6851). 0 Existing techniques for producing single-chain antibodies (US Pat No. 4946778) can also be used to produce single chain antibodies against human dihydroorotase 23.
- Anti-human dihydroorotase 23 antibodies can be used in immunohistochemical techniques to detect human dihydroorotase 23 in biopsy specimens.
- Monoclonal antibodies that bind to human dihydroorotase 23 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
- Antibodies can also be used to design immunotoxins that target a particular part of the body.
- Human dihydroorotase 23 High-affinity monoclonal antibodies can covalently bind to bacterial or phytotoxins (such as diphtheria toxin, ricin, ormosine, etc.).
- a common method is to attack the amino group of the antibody with a thiol crosslinker such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
- This hybrid antibody can be used to kill human dihydroorotase 23 positive Cell.
- the antibodies of the present invention can be used to treat or prevent diseases related to human dihydroorotase 23.
- Administration of an appropriate dose of the antibody can stimulate or block the production or activity of human dihydroorotase 23.
- the invention also relates to a diagnostic test method for quantitative and localized detection of human dihydroorotase 23 levels. These tests are well known in the art and include FISH assays and radioimmunoassays. The level of human dihydroorotase 23 detected in the test can be used to explain the importance of human dihydroorotase 23 in various diseases and to diagnose the role of human dihydroorotase 23 disease.
- polypeptide of the present invention can also be used for peptide mapping analysis.
- the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
- the polynucleotide encoding human dihydroorotase 23 can also be used for a variety of therapeutic purposes. Gene therapy techniques can be used to treat abnormal cell proliferation, development, or metabolism caused by the non-expression or abnormal / inactive expression of human dihydroorotase 23.
- Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated human dihydroorotase 23 to inhibit endogenous human dihydroorotase 23 activity.
- a mutated human dihydroorotase 23 may be a shortened human dihydroorotase 23 lacking a signaling domain, although it can bind to downstream substrates, but lacks signaling activity.
- the recombinant gene therapy vector can be used for treating diseases caused by abnormal expression or activity of human dihydroorotase 23.
- Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to transfer a polynucleotide encoding human dihydroorotase 23 into a cell.
- Methods for constructing recombinant viral vectors carrying a polynucleotide encoding human dihydroorotase 23 can be found in the existing literature (Sambrook, et al.).
- a recombinant polynucleotide encoding human dihydroorotase 23 can be packaged into liposomes and transferred into cells.
- Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
- a vector such as a virus, phage, or plasmid
- Oligonucleotides including antisense RNA and DNA
- ribozymes that inhibit human dihydroorotase 23 mRNA are also within the scope of the present invention.
- a ribozyme is an enzyme-like RNA molecule that specifically decomposes specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RM to perform endonucleation.
- Antisense RM, DNA and ribozymes can be obtained by any existing RM or DNA synthesis technology, such as the technique of solid phase phosphate amide synthesis of oligonucleotides, which is widely used.
- Antisense RM molecules can encode this RNA The DNA sequence is obtained by in vitro or in vivo transcription.
- This DNA sequence has been integrated downstream of the RNA polymerase promoter of the vector.
- it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the ribonucleoside linkages should use phosphate thioester or peptide bonds instead of phosphodiester bonds.
- the polynucleotide encoding human dihydroorotase 23 can be used for the diagnosis of diseases related to human dihydroorotase 23.
- the polynucleotide encoding human dihydroorotase 23 can be used to detect the expression of human dihydroorotase 23 or the abnormal expression of human dihydroorotase 23 in a disease state.
- the DNA sequence encoding human dihydroorotase 2 3 can be used to hybridize biopsy specimens to determine the expression of human dihydroorotase 23.
- Hybridization techniques include Sou thern blotting, Nor thern blotting, and in situ hybridization.
- polynucleotide of the present invention can be used as a probe to be fixed on a micro array (Mi croa rray) or a DNA chip
- Human dihydroorotase 23 specific primers can also be used for RNA-polymerase chain reaction (RT-PCR) in vitro amplification to detect human dihydroorotase 23 transcripts.
- RT-PCR RNA-polymerase chain reaction
- Detection of mutations in the human dihydroorotase 23 gene can also be used to diagnose human dihydroorotase 23-related diseases.
- Human dihydroorotase 23 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type human dihydroorotase 23 DNA sequence. Mutations can be detected using well-known techniques such as Southern blotting, DM sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression. Therefore, the Nort Hern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
- the sequences of the invention are also valuable for chromosome identification.
- the sequence specifically targets a specific position on a human chromosome and can hybridize to it.
- specific sites for each gene on the chromosome need to be identified.
- only a few chromosome markers based on actual sequence data are available for marking chromosome positions.
- an important first step is to locate these DNA sequences on a chromosome.
- PCR primers (preferably 15-35bp) are prepared according to cDM, and the sequences can be located on chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those hybrid cells that have a human gene corresponding to the primer will produce amplified fragments.
- PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
- oligonucleotide primers of the present invention by a similar method, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
- Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and hybrid pre-selection to construct chromosome-specific cDNA libraries.
- Fluorescent in situ hybridization (FISH) of cDNA clones to metaphase chromosomes allows precise chromosomal localization in one step.
- FISH fluorescent in situ hybridization
- the physical location of the sequence on the chromosome can be correlated with the genetic map data. These data can be found in, for example, V. Mckusick, Mendelian Inheritance in Man (available online with Johns Hopkins University Wetch Medical Library). Linkage analysis can then be used to determine the relationship between genes and diseases that have been mapped to chromosomal regions.
- the difference in cDNA or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in the chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDM sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).
- the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
- suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
- the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
- the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
- a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
- these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell.
- the polypeptides of the invention can be used in combination with other therapeutic compounds.
- the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
- Human dihydroorotase 23 is administered in an amount effective to treat and / or prevent a specific indication.
- the amount and range of human dihydroorotase 23 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician.
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Biotechnology (AREA)
- Biomedical Technology (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Enzymes And Modification Thereof (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
AU44063/01A AU4406301A (en) | 2000-03-02 | 2001-02-26 | A novel polypeptide-human dihydroorotase 23 and the polynucleotide encoding saidpolypeptide |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN00111841.2 | 2000-03-02 | ||
CN 00111841 CN1311328A (zh) | 2000-03-02 | 2000-03-02 | 一种新的多肽——人二氢乳清酸酶23和编码这种多肽的多核苷酸 |
Publications (1)
Publication Number | Publication Date |
---|---|
WO2001070790A1 true WO2001070790A1 (fr) | 2001-09-27 |
Family
ID=4581737
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/CN2001/000267 WO2001070790A1 (fr) | 2000-03-02 | 2001-02-26 | Nouveau polypeptide, dihydrooratase humaine 23, et polynucleotide codant pour ce polypeptide |
Country Status (3)
Country | Link |
---|---|
CN (1) | CN1311328A (fr) |
AU (1) | AU4406301A (fr) |
WO (1) | WO2001070790A1 (fr) |
Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP0260057A2 (fr) * | 1986-09-02 | 1988-03-16 | The University Of Melbourne | 2-Oxo-4-carboxypyrimidines |
-
2000
- 2000-03-02 CN CN 00111841 patent/CN1311328A/zh active Pending
-
2001
- 2001-02-26 WO PCT/CN2001/000267 patent/WO2001070790A1/fr active Application Filing
- 2001-02-26 AU AU44063/01A patent/AU4406301A/en not_active Abandoned
Patent Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP0260057A2 (fr) * | 1986-09-02 | 1988-03-16 | The University Of Melbourne | 2-Oxo-4-carboxypyrimidines |
Also Published As
Publication number | Publication date |
---|---|
AU4406301A (en) | 2001-10-03 |
CN1311328A (zh) | 2001-09-05 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
WO2001068694A1 (fr) | Nouveau polypeptide, proteine humaine d'hexokinase 10, et polynucleotide codant pour ce polypeptide | |
WO2001070790A1 (fr) | Nouveau polypeptide, dihydrooratase humaine 23, et polynucleotide codant pour ce polypeptide | |
WO2001070956A1 (fr) | Nouveau polypeptide, proteine humaine de reparation 8 du mesappariement de l'adn, et polynucleotide codant pour ce polypeptide | |
WO2001075017A2 (fr) | Nouveau polypeptide, dihydroorotase humaine 17, et polynucleotide codant pour ce polypeptide | |
WO2001083724A1 (fr) | Nouveau polypeptide, dihydroorotase humaine 17, et polynucleotide codant pour ce polypeptide | |
WO2001085776A1 (fr) | Polypeptide humain dihydro-orotase 12 et polynucleotide codant pour ce polypeptide | |
WO2001075037A2 (fr) | Nouveau polypeptide, dihydroorotase humaine 40, et polynucleotide codant pour ce polypeptide | |
WO2001075079A1 (fr) | Nouveau polypeptide, dihydroorotase humaine 13, et polynucleotide codant pour ce polypeptide | |
WO2002026795A1 (fr) | Nouveau polypeptide, dihydrooratase humaine 15.29, et polynucleotide codant ce polypeptide | |
WO2001083758A2 (fr) | Nouveau polypeptide, dihydroorotase humaine 8, et polynucleotide codant pour ce polypeptide | |
WO2001083681A2 (fr) | Nouveau polypeptide, dihydroorotase humaine 21, et polynucleotide codant pour ce polypeptide | |
WO2002020577A1 (fr) | Nouveau polypeptide, nucleoside reductase 10.49, et polynucleotide codant ce polypeptide | |
WO2001075018A2 (fr) | Nouveau polypeptide, facteur humain de regulation de la transcription 31, et polynucleotide codant pour ce polypeptide | |
WO2001090178A1 (fr) | Nouveau polypeptide, dihydroorotase humaine 11, et polynucleotide codant ce polypeptide | |
WO2001072979A1 (fr) | Nouveau polypeptide, dihydroorotase humaine 15, et polynucleotide codant pour ce polypeptide | |
WO2001077285A2 (fr) | Nouveau polypeptide, proteine 13 de la famille des amidases, et polynucleotide codant pour ce polypeptide | |
WO2001079437A2 (fr) | Nouveau polypeptide, facteur humain de transcription de la differentiation cellulaire 14, et polynucleotide codant pour ce polypeptide | |
WO2001081396A1 (fr) | Nouveau polypeptide, proteine ribosomale s7 humaine 14, et polynucleotide codant pour ce polypeptide | |
WO2001047984A1 (fr) | Nouveau polypeptide, proteine 10 de la famille des amidases, et polynucleotide codant pour ce polypeptide | |
WO2001072795A1 (fr) | Nouveau polypeptide, quinine reductase humaine 16, et polynucleotide codant pour ce polypeptide | |
WO2001047974A1 (fr) | Nouveau polypeptide, dihydroorotase humaine 10, et polynucleotide codant pour ce polypeptide | |
WO2001073061A1 (fr) | Nouveau polypeptide, proteine humaine 22 du retinoblastome, et polynucleotide codant pour ce polypeptide | |
WO2001048157A1 (fr) | Nouveau polypeptide, adn methylase 13, et polynucleotide codant pour ce polypeptide | |
WO2001064732A1 (fr) | Nouveau polypeptide, facteur humain associe a la retrotransposition 14, et polynucleotide codant pour ce polypeptide | |
WO2001073054A1 (fr) | Nouveau polypeptide, dihydroorotase humaine 11, et polynucleotide codant pour ce polypeptide |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A1 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
122 | Ep: pct application non-entry in european phase | ||
REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
NENP | Non-entry into the national phase |
Ref country code: JP |