WO2001090178A1 - Nouveau polypeptide, dihydroorotase humaine 11, et polynucleotide codant ce polypeptide - Google Patents

Nouveau polypeptide, dihydroorotase humaine 11, et polynucleotide codant ce polypeptide Download PDF

Info

Publication number
WO2001090178A1
WO2001090178A1 PCT/CN2001/000871 CN0100871W WO0190178A1 WO 2001090178 A1 WO2001090178 A1 WO 2001090178A1 CN 0100871 W CN0100871 W CN 0100871W WO 0190178 A1 WO0190178 A1 WO 0190178A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
polynucleotide
human dihydroorotase
sequence
dihydroorotase
Prior art date
Application number
PCT/CN2001/000871
Other languages
English (en)
Chinese (zh)
Inventor
Yumin Mao
Yi Xie
Original Assignee
Shanghai Biowindow Gene Development Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shanghai Biowindow Gene Development Inc. filed Critical Shanghai Biowindow Gene Development Inc.
Priority to AU81689/01A priority Critical patent/AU8168901A/en
Publication of WO2001090178A1 publication Critical patent/WO2001090178A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y305/00—Hydrolases acting on carbon-nitrogen bonds, other than peptide bonds (3.5)
    • C12Y305/02—Hydrolases acting on carbon-nitrogen bonds, other than peptide bonds (3.5) in cyclic amides (3.5.2)
    • C12Y305/02003—Dihydroorotase (3.5.2.3)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/78—Hydrolases (3) acting on carbon to nitrogen bonds other than peptide bonds (3.5)
    • C12N9/86—Hydrolases (3) acting on carbon to nitrogen bonds other than peptide bonds (3.5) acting on amide bonds in cyclic amides, e.g. penicillinase (3.5.2)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • the present invention belongs to the field of biotechnology. Specifically, the present invention describes a new polypeptide ⁇ ⁇ dihydroorotase 11 and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and polypeptide.
  • Dihydroorotase also known as carbamyl aspartate dehydratase, catalyzes the initiation of the third stage of pyrimidine biosynthesis and makes ureidosuccinate (N-carbamyl-L-day Aspartic acid) is converted to dihydroorotate.
  • Dihydroorotase is one of the very few enzymes that can biosynthesize an amino bond-catalyzed reaction without directly coupling energy such as ATP. This catalytic reaction also incorporates a zinc atom necessary for catalytic activity.
  • dihydroorotase In bacteria, dihydroorotase is a dimer composed of two identical long chains of about 400 amino acid residues; in higher eukaryotes, dihydroorotase is one This function is part of a large protein; in Drosophila and mammals, it catalyzes the first three steps of pyrimidine biosynthesis. Dihydroorotase is located at the center of this multiprotein. In yeast, dihydroorotase is encoded by a monofunctional protein gene (URA4). However, a dihydroorotase mutant strain was found to be encoded by the multifunctional protein gene (URA2), catalyzing the first two steps of pyrimidine synthesis.
  • UAA4 monofunctional protein gene
  • UAA2 multifunctional protein gene
  • N-terminal conserved sequence D- [LIVMFYWSAPj -H- tLIVA]-H- [LIVF]-[RN]-x- [PGN], where two H may be sites of zinc ligands.
  • N-terminal and C-terminal conserved sequences of dihydroorotase found this time will help us to further understand the process of pyrimidine metabolism and have important significance for the prevention and treatment of pyrimidine metabolism diseases in the organism.
  • human dihydroorotase 11 protein plays an important role in regulating important functions of the body such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes, so there is always a need to identify more participants in this field. These processes are the human dihydroorotase 11 protein, and in particular the amino acid sequence of this protein is identified. Isolation of the new human dihydroorotase 11 protein encoding gene also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for developing diagnostic and / or therapeutic drugs for the disease, so isolating its coding DNA is important. Object of the invention
  • Another object of the invention is to provide a polynucleotide encoding the polypeptide.
  • Another object of the present invention is to provide a method for producing human dihydroorotase 11.
  • Another object of the present invention is to provide an antibody against the human dihydroorotase 11 of the polypeptide of the present invention.
  • Another object of the present invention is to provide mimetic compounds, antagonists, agonists, and inhibitors of the human dihydroorotase 11 of the polypeptide of the present invention.
  • Another object of the present invention is to provide a method for diagnosing and treating a disease associated with abnormal human dihydroorotase 11. Summary of invention
  • the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
  • the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the present invention also relates to an isolated polynucleotide comprising a nucleotide sequence selected from the group consisting of: Its variant:
  • sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 763-1071 in SEQ ID NO: 1; and (b) a sequence having 1-1775 in SEQ ID NO: 1 Sequence of bits.
  • the present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
  • the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
  • the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of human dihydroorotase 11 protein, which comprises utilizing the polypeptide of the invention.
  • the invention also relates to compounds obtained by this method.
  • the present invention also relates to a method for in vitro detection of a disease or susceptibility to disease associated with abnormal expression of human dihydroorotase 11 protein, comprising detecting mutations in the polypeptide or a polynucleotide sequence encoding the same in a biological sample, or Detection of the amount or biological activity of a polypeptide of the invention in a biological sample.
  • the invention also relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
  • the present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention for the preparation of a medicament for treating cancer, developmental disease or immune disease or other diseases caused by abnormal expression of human dihydroorotase 11.
  • FIG. 1 is a comparison diagram of gene chip expression profiles of the inventors dihydroorotase 11 and human dihydroorotase.
  • the upper graph is a graph of the expression profile of human dihydroorotase 11 and the lower graph is the graph of the expression profile of human dihydroorotase 11.
  • 1-bladder mucosa 2-PMA + Ecv304 cell line, 3-LPS + Ecv304 cell line thymus, 4- normal fibroblasts 1024NC, 5-Fibroblas t, growth factor stimulation, 1024NT, 6-scars into fc growth factor Stimulation, 10xia, 7-scar into fc without stimulation with growth factor, 1013HC, 8-bladder cancer EJ, 9-bladder cancer, 10-bladder cancer, 11-liver cancer, 12-liver cancer cell line, 13-fetal skin, 14-spleen, 15-prostate cancer, 16-jejunal adenocarcinoma, 17 cardiac cancer.
  • Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of isolated human dihydroorotase 11.
  • llkDa is the molecular weight of the protein.
  • the arrow indicates the isolated protein band.
  • Nucleic acid sequence refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DM or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
  • amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
  • amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
  • a “variant" of a protein or polynucleotide refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it.
  • the changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence.
  • Variants can have "conservative" changes, in which the amino acid substituted has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine.
  • Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
  • “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
  • Insertion means that a change in the amino acid sequence or nucleotide sequence results in an increase in one or more amino acids or nucleotides compared to a molecule that exists in nature.
  • Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
  • Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
  • immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response and to bind specific antibodies in a suitable animal or cell.
  • An "agonist” refers to a molecule that, when combined with human dihydroorotase 11, causes the protein to change, thereby regulating the activity of the protein.
  • An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that binds human dihydroorotase 11.
  • Antagonist refers to a molecule that can block or modulate the biological or immunological activity of human dihydroorotase 11 when combined with human dihydroorotase 11.
  • Antagonists and inhibitors can include proteins, nucleic acids, carbohydrates or any other component that binds human dihydroorotase 11. Child.
  • Regular refers to a change in the function of human dihydroorotase 11, including an increase or decrease in protein activity, a change in binding characteristics, and any other biological properties, functions, or immunity of human dihydroorotase 11 Change of nature.
  • substantially pure means substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated.
  • Those skilled in the art can purify human dihydroorotase 11 using standard protein purification techniques. Basically pure human dihydroorotase 11 produces a single main band on a non-reducing polyacrylamide gel. The purity of human dihydroorotase 11 polypeptide can be analyzed by amino acid sequence.
  • Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
  • sequence C-T-G-A
  • complementary sequence G-A-C-T.
  • the complementarity between two single-stranded molecules may be partial or complete.
  • the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
  • “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
  • Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Southern imprinting or Northern blotting, etc.) under conditions of reduced stringency. Substantially homologous sequences or hybridization probes can compete and inhibit the binding of fully homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.
  • Percent identity refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALIGN program (Lasergene sof tware package, DNASTAR, Inc., Madi son Wis.). The MEGALIGN program can compare two or more sequences according to different methods, such as the Clus ter method (Higg ins, DG and PM Sharp (1988) Gene 73: 237-244). 0 The Clus ter method checks the distance between all pairs The groups of sequences are arranged into clusters. The clusters are then assigned in pairs or groups. The percentage identity between two amino acid sequences, such as sequence A and sequence B, is calculated by the MEGALIGN program (Lasergene sof tware package, DNASTAR, Inc., Madi son Wis.). The MEGALIGN program can compare two or more sequences according to different methods, such as the Clus ter method (Higg ins, DG and PM Sharp (1988
  • the number of residues in the sequence-the number of spacer residues in the sequence-the number of spacer residues X in the sequence S can also be determined by the Clus ter method or by a method known in the art such as Jotun Hein (Hein L, (1990) Methods in enzymo logy 183: 625-645) a "Similarity" refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
  • Amino acids used for conservative substitution may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
  • Antisense refers to a nucleotide sequence that is complementary to a particular DM or RNA sequence.
  • Antisense strand refers to a nucleic acid strand that is complementary to a “sense strand.”
  • Derivative refers to HFP or a chemical modification of its nucleic acid. This chemical modification may be a substitution of a hydrogen atom with a fluorenyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
  • Antibody refers to a complete antibody molecule and its fragments, such as Fa,? ( ⁇ ') 2 and?, which can specifically bind to the epitope of human dihydroorotase 11.
  • a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
  • isolated refers to the removal of a substance from its original environment (for example, its natural environment if it is naturally occurring).
  • a naturally-occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
  • Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not part of its natural environment, they are still isolated.
  • isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
  • polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances in the natural state .
  • isolated human dihydroorotase 11 means that human dihydroorotase 11 is substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated. Those skilled in the art can purify human dihydroorotase 11 using standard protein purification techniques. Substantially pure peptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of human dihydroorotase 11 peptide can be analyzed by amino acid sequence.
  • the present invention provides a new polypeptide, human dihydroorotase 11, which is basically composed of the amino acid sequence shown in SEQ ID NO: 2.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
  • the polypeptide of the present invention may be a naturally purified product or a chemically synthesized product, or Recombinant technology is used to produce from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells). Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
  • the invention also includes fragments, derivatives and analogs of human dihydroorotase 11.
  • fragment refers to a polypeptide that substantially maintains the same biological function or activity of the human dihydroorotase 11 of the present invention.
  • a fragment, derivative or analog of the polypeptide of the present invention may be: (I) one in which one or more amino acid residues are replaced with conservative or non-conservative amino acid residues, preferably conservative amino acid residues, and Substituted amino acids may or may not be encoded by the genetic code; or ( ⁇ ) a type in which a group on one or more amino acid residues is replaced by another group to include a substituent; or ( ⁇ ) Such a type, in which the mature polypeptide is fused with another compound (such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol); or (IV) a type in which the additional amino acid sequence is fused into the mature polypeptide, resulting in a polypeptide sequence (Such as the leader or secretory sequence or the sequence used to purify the polypeptide or protease sequence).
  • the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
  • the polynucleotide of the present invention is found from a CDM library of human fetal brain tissue. It contains a full-length polynucleotide sequence of 1775 bases, and its open reading frame 763-1071 encodes 102 amino acids.
  • the polynucleotide of the present invention may be in the form of DM or RNA.
  • DM forms include cDNA, genomic DM, or synthetic DM.
  • DNA can be single-stranded or double-stranded.
  • DM can be coded or non-coded.
  • the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
  • a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
  • the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
  • polynucleotide encoding a polypeptide is meant to include polynucleotides that encode such polypeptides and polynucleotides that include additional coding and / or noncoding sequences.
  • the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention. Variants of this polynucleotide may be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
  • an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
  • the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity, between the two sequences).
  • the present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions.
  • “strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60 ° C; or (2) Add denaturants during hybridization, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% Ficol 1, 42 ° C, etc .; or (3) only between the two sequences Hybridization occurs only when the identity is at least 95%, and more preferably 97%.
  • the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
  • nucleic acid fragments that hybridize to the sequences described above.
  • a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 nuclei. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques, such as PCR, to identify and / or isolate polynucleotides encoding human dihydroorotase 11.
  • polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
  • the specific polynucleotide sequence encoding human dihydroorotase 11 of the present invention can be obtained by various methods.
  • polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
  • the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) separating the double-stranded DNA sequence from the DM of the genome; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.
  • genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the separation of the CDM sequences.
  • the standard method for isolating cDNA of interest is to isolate mRM from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library. There are many mature techniques for extracting mRM, and kits are also commercially available (Qiagene).
  • the construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold. Spring Harbor Laboratory. New York, 1989).
  • Commercially available cDNA libraries such as different cDNAs from Clontech library. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
  • the genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (1) DM-DNA or DNA-RNA hybridization; (2) the presence or absence of marker gene functions; (3) measuring the level of human dihydroorotase 11 transcripts; (4) Detecting the protein product of gene expression by immunological technology or measuring biological activity. The above methods can be used singly or in combination.
  • the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
  • the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
  • the probe used here is generally a DNA sequence chemically synthesized based on the gene sequence information of the present invention.
  • the genes or fragments of the present invention can of course be used as probes.
  • DM probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
  • immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) can be used to detect the protein product expressed by the human dihydroorotase 11 gene.
  • ELISA enzyme-linked immunosorbent assay
  • a method (Sa iki, et al. Sc; 1985; 230: 1350-1354) using PCR technology to amplify DNA / RNA is preferably used to obtain the gene of the present invention.
  • the RACE method RACE-Rapid Amplification of cDNA Ends
  • the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein Select and synthesize using conventional methods.
  • the amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
  • polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be measured by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 546 3-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, sequencing needs to be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
  • the present invention also relates to a vector comprising a polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using a human dihydroorotase 11 coding sequence, and the recombinant technology to produce the polypeptide of the present invention Methods.
  • a polynucleotide sequence encoding human dihydroorotase 11 can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
  • vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
  • Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al.
  • any plasmid and vector can be used to construct a recombinant expression vector.
  • An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
  • Methods well known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding human dihydroorotase 11 and suitable transcription / translation regulatory elements. These methods include in vitro recombinant DM technology, MA synthesis technology, and in vivo recombination technology (Sambroook, et al. Molecular Cloning, a Laboratory Manua, Cold Cold Harbor Laboratory. New York, 1989).
  • the DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis. Representative examples of these promoters are: the lac or trp promoter of E.
  • the expression vector also includes a ribosome binding site for translation initiation, a transcription terminator, and the like. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors expressed by DM, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers and adenovirus enhancers on the late side of the origin of replication.
  • the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • GFP fluorescent protein
  • tetracycline or ampicillin resistance for E. coli.
  • a polynucleotide encoding human dihydroorotase 11 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to form a genetically engineered host cell containing the polynucleotide or the recombinant vector.
  • host cell refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E.
  • coli Streptomyces
  • bacterial cells such as Salmonella typhimurium
  • fungal cells such as yeast
  • plant cells such as insect cells such as Fly S2 or Sf9
  • animal cells such as CH0, COS or Bowes melanoma cells.
  • Transformation of a host cell with a DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art.
  • the host is a prokaryote such as E. coli
  • competent cells capable of absorbing DNA can be harvested after the exponential growth phase and treated with the CaCl 2 method. It is well known in the art. Alternatively, MgCl 2 is used. If necessary, transformation can also be performed by electroporation.
  • the host is a eukaryotic organism, the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
  • polynucleotide sequence of the present invention can be used to express or produce recombinant human dihydroorotase 11 (Science, 1984; 224: 1431). Generally there are the following steps:
  • the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
  • a suitable method such as temperature conversion or chemical induction
  • the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If necessary, the recombinant protein can be isolated and purified by various separation methods using its physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
  • conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid
  • polypeptides of the present invention can be directly used in the treatment of diseases, for example, they can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection, and immune diseases. '
  • Dihydroorotase catalyzes the initiation of the third stage of pyrimidine biosynthesis, converting 'ureidosuccinic acid (N-carbamoyl-L-aspartic acid) to dihydroorotate.
  • Dihydroorotase is one of the very few enzymes that can biosynthesize an amino bond-catalyzed reaction without directly coupling energy such as ATP.
  • the pyrimidine biosynthesis is necessary for the production of nucleotides.
  • Dihydroorotase-specific conserved sequences are required to form its active mot if.
  • the abnormal expression of the specific dihydroorotase mot if will cause the function of the polypeptide containing the mot if of the present invention to be abnormal, thereby causing abnormalities in nucleotide biosynthesis and further affecting the regulation of genetic information. It is related to expression and produces diseases such as tumors, embryonic developmental disorders, growth and development disorders, inflammation, etc.
  • abnormal expression of human dihydroorotase 10 of the present invention will cause various diseases, especially Are tumors, embryonic developmental disorders, growth and development disorders, inflammation, and these diseases include, but are not limited to: embryonic developmental disorders: congenital abortion, cleft palate, limb absentness, limb differentiation disorders, hyaline membrane disease, pulmonary insufficiency, polycystic kidney disease , Double ureter, cryptorchidism, congenital inguinal hernia, double uterus, vaginal atresia, hypospadias, hermaphroditism, atrial septal defect, ventricular septal defect, pulmonary stenosis, open ductus arteriosus, neural tube defect, congenital hydrocephalus , Iris defect, congenital cataract, congenital glaucoma or cataract, congenital deafness
  • Growth and development disorders mental retardation, cerebral palsy, brain development disorders, mental retardation, familial cerebral nucleus dysplasia syndrome, strabismus, skin, fat and muscular dysplasia such as congenital skin laxity, premature aging Disease, congenital keratosis, various metabolic defects such as various amino acid metabolic defects, stunting, dwarfism, sexual retardation
  • Tumors of various tissues gastric cancer, liver cancer, lung cancer, esophageal cancer, breast cancer, leukemia, lymphoma, thyroid tumor, uterine fibroids, neuroblastoma, astrocytoma, ependymoma, glioblastoma, Colon cancer, melanoma, adrenal cancer, bladder cancer, bone cancer, osteosarcoma, myeloma, bone marrow cancer, brain cancer, uterine cancer, endometrial cancer, gallbladder cancer, thymic tumor, nasal cavity and sinus cancer, nasopharyngeal cancer, Laryngeal cancer, tracheal tumor, fibroma, fibrosarcoma, lipoma, liposarcoma, leiomyoma
  • Inflammation allergic reaction, bronchial asthma, allergic pneumonia, adult respiratory distress syndrome, sarcoidosis, rheumatoid arthritis, rheumatoid arthritis, osteoarthritis, cholecystitis, glomerulonephritis, immune complex Types of glomerulonephritis, acute anterior uveitis, dermatomyositis, urticaria, atopic dermatitis, hemochromatosis, polymyositis, Addison's disease, chronic active hepatitis, emergency bowel syndrome, atrophy Gastritis, systemic lupus erythematosus, myasthenia gravis, cerebrospinal spinal multiple sclerosis, Guillain-Barre syndrome, intracranial granuloma, pancreatitis, myocarditis, and inflammation caused by infections and trauma
  • human dihydroorotase 11 of the present invention will also produce certain hereditary, hematological and immune system diseases.
  • the invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) human dihydroorotase 11.
  • Agonists enhance human dihydroorotase 11 to stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
  • mammalian cells or a membrane preparation expressing human dihydroorotase 11 can be cultured with labeled human dihydroorotase 11 in the presence of a drug. The ability of the drug to increase or block this interaction is then determined.
  • Antagonists of human dihydroorotase 11 include antibodies, compounds, receptor deletions, and the like that have been screened. Antagonists of human dihydroorotase 11 can bind to human dihydroorotase 11 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot function biological functions.
  • human dihydroorotase 11 can be added to a bioanalytical assay to determine the compound by measuring the effect of the compound on the interaction between human dihydroorotase 11 and its receptor Whether it is an antagonist.
  • Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds.
  • Polypeptide molecules capable of binding to human dihydroorotase 11 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. When screening, human dihydroorotase 11 molecules should generally be labeled.
  • the present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies.
  • the invention also provides antibodies against human dihydroorotase 11 epitopes. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single-chain antibodies, Fab fragments, and fragments from Fab expression libraries.
  • Polyclonal antibodies can be produced by injecting human dihydroorotase 11 directly into immunized animals (such as rabbits, mice, rats, etc.).
  • immunized animals such as rabbits, mice, rats, etc.
  • adjuvants can be used to enhance the immune response, including but not limited to Freund's Adjuvant, etc.
  • Techniques for preparing monoclonal antibodies against human dihydroorotase 11 include, but are not limited to, hybridoma technology (Kohler and Mistein. Nature, 1975, 256: 495-497), triple tumor technology, human beta-cell hybridoma Technology, EBV-hybridoma technology, etc.
  • Embedding antibodies that bind human constant regions to non-human variable regions can be produced using known techniques (Morrison et al, PNAS, 1985, 81: 6851).
  • the existing technology for producing single chain antibodies U. S. Pat No. 4946778, can also be used to produce single chain antibodies against human dihydroorotase 11.
  • Antibodies against human dihydroorotidase 11 can be used in immunohistochemical techniques to detect human dihydroorotase 11 in biopsy specimens.
  • Monoclonal antibodies that bind to human dihydroorotase 11 can also be labeled with radioisotopes and injected into the body to track their location and distribution.
  • This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
  • Antibodies can also be used to design immunotoxins that target a particular part of the body.
  • human dihydroorotase 11 high affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
  • a common method is to attack the amino group of the antibody with a thiol crosslinker such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
  • This hybrid antibody can be used to kill human dihydroorotase 11 positive Cell.
  • the antibodies in the present invention can be used to treat or prevent diseases related to human dihydroorotase 11.
  • Administration of an appropriate dose of the antibody can stimulate or block the production or activity of human dihydroorotase 11.
  • the invention also relates to a diagnostic test method for quantitative and localized detection of human dihydroorotase 11 level.
  • tests are well known in the art and include FISH assays and radioimmunoassays.
  • the level of human dihydroorotase 11 detected in the test can be used to explain the importance of human dihydroorotase 11 in various diseases and to diagnose the role of human dihydroorotase 11 disease.
  • polypeptide of the present invention can also be used for peptide mapping analysis.
  • the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
  • the polynucleotide encoding human dihydroorotase 11 can also be used for a variety of therapeutic purposes. Gene therapy techniques can be used to treat abnormal cell proliferation, development, or metabolism caused by the non-expression or abnormal / inactive expression of human dihydroorotase 11.
  • Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated human dihydroorotase 11 to inhibit endogenous human dihydroorotase 11 activity.
  • a variant human dihydroorotase 11 may be a shortened human dihydroorotase 11 lacking a signaling domain, although it can bind to downstream substrates, but lacks signaling activity.
  • the recombinant gene therapy vector can be used for treating diseases caused by abnormal expression or activity of human dihydroorotase 11.
  • Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to transfer a polynucleotide encoding human dihydroorotase 11 into a cell.
  • Methods for constructing recombinant viral vectors carrying a polynucleotide encoding human dihydroorotase 11 can be found in the existing literature (Sambrook, et al.).
  • a recombinant polynucleotide encoding human dihydroorotase 11 can be packaged into liposomes and transferred into cells.
  • Methods for introducing a polynucleotide into a tissue or cell include: injecting the polynucleotide directly into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
  • a vector such as a virus, phage, or plasmid
  • Oligonucleotides including antisense RNA and DM
  • ribozymes that inhibit human dihydroorotase 11 mRNA are also within the scope of the present invention.
  • a ribozyme is an enzyme-like RNA molecule that specifically decomposes specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation.
  • Antisense RNA, DNA, and ribozymes can be obtained using any existing RM or DM synthesis techniques, such as the solid-phase phosphoramidite synthesis method for oligonucleotides, and are widely used.
  • Antisense A molecules can be obtained by in vitro or in vivo transcription of DM sequences encoding the RNA. This DM sequence has been integrated downstream of the RNA polymerase promoter of the vector. In order to increase the stability of the nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the linkage between ribonucleosides using phosphorothioate or peptide bonds instead of phosphodiester bonds.
  • the polynucleotide encoding human dihydroorotase 11 can be used for the diagnosis of diseases related to human dihydroorotase 11.
  • Polynucleotide encoding human dihydroorotase 11 can be used to detect human dihydroorotase 11 Expression or abnormal expression of human dihydroorotase 11 in disease states.
  • the DM sequence encoding human dihydroorotase 11 can be used to hybridize biopsy specimens to determine the expression of human dihydroorotase 11.
  • Hybridization techniques include Southern blotting, Northern blotting, and in situ hybridization. These techniques and methods are publicly available and mature, and related kits are commercially available.
  • a part or all of the polynucleotides of the present invention can be used as probes to be fixed on a micro array or a DNA chip (also called a "gene chip") for analyzing differential expression analysis and gene diagnosis of genes in tissues.
  • Human dihydroorotase 11 specific primers can be used for RNA-polymerase chain reaction (RT-PCR) in vitro amplification to detect human dihydroorotase 11 transcripts.
  • Detection of mutations in the human dihydroorotase 11 gene can also be used to diagnose human dihydroorotase 11-related diseases.
  • Human dihydroorotase 11 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type human dihydroorotase 11 DNA sequence. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression. Therefore, Northern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
  • sequences of the invention are also valuable for chromosome identification. This sequence will specifically target a specific position on a human chromosome and can hybridize to it. Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for marking chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DNA sequences on a chromosome.
  • the PCR primers (preferably 15-35bp) are prepared according to cDM, and the sequences can be located on the chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
  • PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
  • oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
  • Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.
  • Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step.
  • FISH Fluorescent in situ hybridization
  • the difference in cDNA or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be disease-causing. Comparing affected and unaffected individuals usually involves first looking for structural changes in the chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDM sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).
  • the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
  • suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
  • the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
  • the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which reminders permit their administration on the human body by government agencies that manufacture, use, or sell them.
  • the polypeptides of the invention can be used in combination with other therapeutic compounds.
  • the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
  • Human dihydroorotase 11 is administered in an amount effective to treat and / or prevent a specific indication.
  • the amount and range of human dihydroorotase 11 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician. Examples
  • Total human fetal brain RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform.
  • Quik mRNA Isolat ion Ki t Qiegene
  • Isolate poly A) mRNA from total RNA.
  • 2ug poly (A) mRNA is reverse transcribed to form cDNA.
  • the Smart cDNA cloning kit purchased from Clontech
  • the bacteria formed a cDNA library.
  • Dye terminate cycle react ion sequencing kit Perkin-Elraer
  • ABI 377 automatic sequencer Perkin-Elmer
  • the determined cDNA sequence was compared with the existing public D sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 0232h05 was a new D.
  • a series of primers were synthesized to determine the inserted cDNA fragments of the clone in both directions.
  • CDNA was synthesized using fetal brain total RNA as a template and ol igo-dT as a primer for reverse transcription reaction. After purification with Qiagene's kit, the following primers were used for PCR amplification:
  • Primerl 5'- GAGACAGAGTCTCGCTCTGTCACC-3, (SEQ ID NO: 3)
  • Primer2 5'- CTCATTCTGCTCATCTAAAAAAAA -3 '(SEQ ID NO: 4)
  • Pr imerl is a forward sequence starting at lbp at the 5 ′ end of SEQ ID NO: 1;
  • Pr imer 2 is the 3, terminal reverse sequence of SEQ ID NO: 1.
  • Amplification reaction conditions A reaction volume of 50 ⁇ 1 contains 50 mmol / LC 1, 1 Ommo 1 / L Tr is- HCl, pH 8. 5, 1. 5 mmol / L MgCl 2 , 200 mol / L dNTP, 1 Opmol primer, 1U of Taq DNA polymerase (Clontech).
  • the reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) for 25 cycles under the following conditions: 94. C 30sec; 55 ° C 30sec; 72. C 2min.
  • RT-PCR set ⁇ -act in as a positive control and template blank as a negative control.
  • the amplified product was purified using a QIAGEN kit and ligated to a pCR vector (Invitrogen) using a TA cloning kit.
  • the DNA sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as that of 1 to 1775 bp shown in SEQ ID NO: 1.
  • Example 3 Northern blot analysis of human dihydroorotase 11 gene expression
  • RNA extraction in one step [Anal. Biochem 1987, 162, 156-159].
  • This method involves acid guanidinium thiocyanate phenol-chloroform extraction. That is, the tissue is homogenized with 4M guanidine isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1), centrifuge after mixing. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. Will The obtained RM precipitate was washed with 70% ethanol, dried and dissolved in water.
  • 32P-labeled probe (about 2 x 10 6 cpm / ml) was hybridized with a nitrocellulose membrane to which RNA was transferred at 42 ° C overnight in a solution containing 50% formamide-25raM KH 2 P0 4 (pH7. 4) -5 x SSC-5 x Denhardt's solution and 200 g / ml salmon sperm DM. After hybridization, the filter was washed in 1 x SSC-0.1% SDS at 55 ° C for 30 min. Then, Phosphor Imager was used for analysis and quantification.
  • Example 4 In vitro expression, isolation and purification of recombinant human dihydroorotase 11
  • Pr imer3 5'-CCCCATATGATGGAGTTTCACTCTGTCACCCAC-3 '(Seq ID No: 5)
  • Pr imer4 5'-CATGGATCCCTATTGTACGTGAAAGCTACATTT-3' (Seq ID No: 6)
  • Ndel and BamHI restriction sites correspond to the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865. 3) Selective endonuclease site.
  • PCR was performed using the pBS-0232h05 plasmid containing the full-length target gene as a template.
  • the PCR reaction conditions were as follows: 10 pg of pBS-0232h05 plasmid was contained in a total volume of 50 ⁇ 1, and primers Primer-3 and Primer-4 were lOpmol and Advantage polymerase Mix (Clontech) 1 ⁇ 1, respectively. Cycle parameters: 94. C 20s, 60. C 30s, 68 ° C 2 min, a total of 25 cycles. Ndel and BamHI were used to double digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase.
  • the ligation product was transformed into E. coli DH5a by the calcium chloride method. After being cultured overnight in LB plates containing kanamycin (final concentration 30 ⁇ ⁇ / ⁇ 1), positive clones were selected by colony PCR method and sequenced. A positive clone (pET-0232h05) with the correct sequence was selected, and the recombinant plasmid was transformed into E. coli BL21 (DE3) plySs (product of Novagen) using the calcium chloride method. In containing kanamycin (final concentration of 30 ⁇ ⁇ / ⁇ 1) in LB liquid medium, host strain BL21 (P ET-0232h05) at 37. C.
  • a peptide synthesizer (product of PE company) was used to synthesize the following human dihydroorotase 11-specific peptides: NH2-Met-Glu-Phe-His-Ser-Val-Thr-His-Ala-Gly-Val- Gln-Trp-Cys-Asp-COOH (SEQ ID NO: 7).
  • the peptide was coupled with hemocyanin and bovine serum albumin to form a complex. For the method, see: Avrameas, et al.
  • the suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in various aspects.
  • the probes can be used to hybridize to the genome or CDM library of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
  • the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
  • the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method.
  • Filter hybridization methods include dot blotting, Southern blotting, Northern blotting, and copying methods. They all use the same steps of hybridization after fixing the polynucleotide sample to be tested on the filter.
  • the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer, so that the non-specific binding site of the sample on the filter is saturated with the carrier and the synthetic polymer.
  • the pre-hybridization solution is then replaced with a hybridization buffer containing the labeled probe and incubated to hybridize the probe to the target nucleic acid.
  • the unhybridized probes are removed by a series of membrane washing steps.
  • This embodiment utilizes higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals.
  • the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
  • the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
  • the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained. First, the selection of the probe
  • oligonucleotide fragments from the polynucleotide SEQ ID NO: 1 of the present invention for use as hybridization probes should follow the following principles and several aspects to be considered:
  • the preferred range of probe size is 18-50 nucleotides
  • Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements The regions are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, the primary probe should not be used;
  • Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
  • Probe 1 which belongs to the second type of probe, is equivalent to the replacement mutant sequence of the gene fragment or its complementary fragment (41Nt) of SEQ ID NO: 1: ⁇
  • PBS phosphate buffered saline
  • step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
  • NC membranes nitrocellulose membranes
  • Two NC membranes are required for each probe, so that they can be used in the following experimental steps. High strength Conditions and strength conditions wash the film.
  • the sample membrane was placed in a plastic bag, and 3-10 mg of prehybridization solution (10xDenhardt's; 6xSSC, 0.1 mg / ral CT DNA (calf thymus DNA)) was added. After sealing the mouth of the bag, shake at 68 ° C for 2 hours.
  • prehybridization solution 10xDenhardt's; 6xSSC, 0.1 mg / ral CT DNA (calf thymus DNA)
  • Gene chip or gene microarray is a new technology currently being developed by many national laboratories and large pharmaceutical companies.
  • the data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software to achieve the purpose of rapid, efficient, and high-throughput analysis of biological information.
  • the polynucleotide of the present invention can be used as a target DM for gene chip technology for high-throughput research of new gene functions; searching for and screening new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases .
  • the specific methods and steps have been reported in the literature.
  • a total of 4,000 polynucleotide sequences of various full-length cDMs are used as target DMs, including the polynucleotides of the present invention. They were respectively amplified by PCR. After the purified amplified product was purified, the concentration was adjusted to about 500 ng / ul, and spotted on a glass medium with a Cartesian 7500 spotter (purchased from Cartesian Company, USA). The distance between them is 280 ⁇ m. The spotted slides were hydrated, dried, and cross-linked in an ultraviolet cross-linker. After elution, the slides were fixed to fix the DM on the glass slides to prepare chips. The specific method steps have been reported in the literature. The sample post-processing steps in this embodiment are:
  • Total mRNA was extracted from human mixed tissues and specific tissues (or stimulated cell lines) in one step, and the mRNA was purified with Oligotex raRNA Midi Ki t (purchased from QiaGen).
  • Cy3dUTP (5-Amino-propargyl-2'-deoxyuridine 5'-triphate coupled to Cy3 f luorescent dye, purchased from Amersham Phamacia Biotech) was used to label mRNA of human mixed tissue, and the fluorescent reagent Cy5dUTP (5-Amino-propargyl-2 ' -deoxyuridine 5'-triphate coupled to Cy5 fluorescent dye, purchased from Araersham Phamacia Biotech Company, labeled the specific tissue (or stimulated cell line) mRNA of the body, and purified the probe to prepare a probe.
  • Cy3dUTP (5-Amino-propargyl-2'-deoxyuridine 5'-triphate coupled to Cy3 f luorescent dye, purchased from
  • the probes from the above two tissues and the chip were respectively hybridized in a UniHyb TM Hybridizat ion Solut ion (purchased from TeleChem) hybridization solution for 16 hours, and the washing solution was used at room temperature (1> ⁇ SSC, 0.2% SDS). After washing, scanning was performed with a ScanArray 3000 scanner (purchased from General Scanning, USA), and the scanned images were analyzed and processed with Imagene software (Biodiscovery, USA) to calculate the Cy3 / Cy5 ratio of each point.
  • the above specific tissues are bladder mucosa, PMA + Ecv304 cell line, LPS + Ecv304 cell line thymus, normal fibroblasts 1024NC, Fibroblas t, growth factor stimulation, 1024NT, scar-like fc growth factor Stimulation, 1013HT, scar into fc without stimulation with growth factors, 1 G13HC, 'bladder cancer cell EJ, bladder cancer, bladder cancer, liver cancer, liver cancer cell line, fetal skin, spleen, prostate cancer, jejunum adenocarcinoma, cardia cancer. Based on these 17 Cy3 / Cy5 ratios, a histogram is drawn (Figure 1). It can be seen from the figure that the expression profiles of human dihydroorotase 11 and human dihydroorotase according to the present invention are very similar.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

L'invention concerne un nouveau polypeptide, une dihydroorotase humaine 11, et un polynucléotide codant ce polypeptide ainsi qu'un procédé d'obtention de ce polypeptide par des techniques recombinantes d'ADN. L'invention concerne en outre les applications de ce polypeptide dans le traitement de maladies, notamment des tumeurs malignes, de l'hémopathie, de l'infection par VIH, de maladies immunitaires et de diverses inflammations. L'invention concerne aussi l'antagoniste agissant contre le polypeptide et son action thérapeutique ainsi que les applications de ce polynucléotide codant la dihydroorotase humaine 11.
PCT/CN2001/000871 2000-05-26 2001-05-28 Nouveau polypeptide, dihydroorotase humaine 11, et polynucleotide codant ce polypeptide WO2001090178A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU81689/01A AU8168901A (en) 2000-05-26 2001-05-28 A novel polypeptide - human dihydroorotase 11 and the polynucleotide encoding said polypeptide

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN 00115893 CN1325998A (zh) 2000-05-26 2000-05-26 一种新的多肽——人二氢乳清酸酶11和编码这种多肽的多核苷酸
CN00115893.7 2000-05-26

Publications (1)

Publication Number Publication Date
WO2001090178A1 true WO2001090178A1 (fr) 2001-11-29

Family

ID=4585335

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2001/000871 WO2001090178A1 (fr) 2000-05-26 2001-05-28 Nouveau polypeptide, dihydroorotase humaine 11, et polynucleotide codant ce polypeptide

Country Status (3)

Country Link
CN (1) CN1325998A (fr)
AU (1) AU8168901A (fr)
WO (1) WO2001090178A1 (fr)

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0260057A2 (fr) * 1986-09-02 1988-03-16 The University Of Melbourne 2-Oxo-4-carboxypyrimidines

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0260057A2 (fr) * 1986-09-02 1988-03-16 The University Of Melbourne 2-Oxo-4-carboxypyrimidines

Also Published As

Publication number Publication date
CN1325998A (zh) 2001-12-12
AU8168901A (en) 2001-12-03

Similar Documents

Publication Publication Date Title
WO2001090178A1 (fr) Nouveau polypeptide, dihydroorotase humaine 11, et polynucleotide codant ce polypeptide
WO2001092515A1 (fr) Nouveau polypeptide, facteur humain de transcription 29.26, et polynucleotide codant ce polypeptide
WO2001090352A1 (fr) Nouveau polypeptide, proteine 110.12 de liaison avec le centrosome nek-2, et polynucleotide codant ce polypeptide
WO2001090177A1 (fr) Nouveau polypeptide, activateur humain de la mort naturelle des cellules b13.64, et polynucleotide codant ce polypeptide
WO2001075048A2 (fr) Nouveau polypeptide, proteine ribosomale humaine s11 23, et polynucleotide codant pour ce polypeptide
WO2001094401A1 (fr) Nouveau polypeptide, proteine npat humaine 15, et polynucleotide codant pour ce polypeptide
WO2001094579A1 (fr) Nouveau polypeptide, proteine humaine 8.8 d'activation de gm2, et polynucleotide codant ce polypeptide
WO2001079434A2 (fr) Nouveau polypeptide, signal peptidase humaine 10, et polynucleotide codant pour ce polypeptide
WO2001090133A1 (fr) Nouveau polypeptide, uracil desoxyribonucleotide glycosylase humaine 22, et polynucleotide codant ce polypeptide
WO2001098488A1 (fr) Nouveau polypeptide, sous-unite 24 de flavoproteine humaine, et polynucleotide codant ce polypeptide
WO2001075037A2 (fr) Nouveau polypeptide, dihydroorotase humaine 40, et polynucleotide codant pour ce polypeptide
WO2001083758A2 (fr) Nouveau polypeptide, dihydroorotase humaine 8, et polynucleotide codant pour ce polypeptide
WO2001075017A2 (fr) Nouveau polypeptide, dihydroorotase humaine 17, et polynucleotide codant pour ce polypeptide
WO2001083724A1 (fr) Nouveau polypeptide, dihydroorotase humaine 17, et polynucleotide codant pour ce polypeptide
WO2001085776A1 (fr) Polypeptide humain dihydro-orotase 12 et polynucleotide codant pour ce polypeptide
WO2001083681A2 (fr) Nouveau polypeptide, dihydroorotase humaine 21, et polynucleotide codant pour ce polypeptide
WO2001087963A1 (fr) Proteine s18-12 ribosomale, polypeptide humain, et polynucleotide la codant
WO2001073054A1 (fr) Nouveau polypeptide, dihydroorotase humaine 11, et polynucleotide codant pour ce polypeptide
WO2001087967A1 (fr) Proteine s18-26 ribosomale, polypeptide humain, et polynucleotide la codant
WO2001090171A1 (fr) Nouveau polypeptide, proteine humaine ribosomale sii 12, et polynucleotide codant ce polypeptide
WO2001090172A1 (fr) Nouveau polypeptide, proteine ribosomale l39 13, et polynucleotide codant ce polypeptide
WO2001090131A1 (fr) Nouveau polypeptide, proteine humaine 10.56 du gene cancerigene tre, et polynucleotide codant ce polypeptide
WO2001077308A1 (fr) Nouveau polypeptide, quinine reductase humaine 18, et un polynucleotide codant pour ce polypeptide
WO2001090173A1 (fr) Nouveau polypeptide, chaperonine humaine cpn60 10, et polynucleotide codant pour ce polypeptide
WO2002012486A1 (fr) Nouveau polypeptide, recepteur humain de la serine kinase 10.34, et polynucleotide codant ce polypeptide

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP