WO2001075037A2 - Nouveau polypeptide, dihydroorotase humaine 40, et polynucleotide codant pour ce polypeptide - Google Patents

Nouveau polypeptide, dihydroorotase humaine 40, et polynucleotide codant pour ce polypeptide Download PDF

Info

Publication number
WO2001075037A2
WO2001075037A2 PCT/CN2001/000414 CN0100414W WO0175037A2 WO 2001075037 A2 WO2001075037 A2 WO 2001075037A2 CN 0100414 W CN0100414 W CN 0100414W WO 0175037 A2 WO0175037 A2 WO 0175037A2
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
polynucleotide
human dihydroorotase
sequence
dihydroorotase
Prior art date
Application number
PCT/CN2001/000414
Other languages
English (en)
Chinese (zh)
Other versions
WO2001075037A3 (fr
Inventor
Yumin Mao
Yi Xie
Original Assignee
Shanghai Biowindow Gene Development Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shanghai Biowindow Gene Development Inc. filed Critical Shanghai Biowindow Gene Development Inc.
Priority to AU56063/01A priority Critical patent/AU5606301A/en
Publication of WO2001075037A2 publication Critical patent/WO2001075037A2/fr
Publication of WO2001075037A3 publication Critical patent/WO2001075037A3/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/78—Hydrolases (3) acting on carbon to nitrogen bonds other than peptide bonds (3.5)
    • C12N9/86—Hydrolases (3) acting on carbon to nitrogen bonds other than peptide bonds (3.5) acting on amide bonds in cyclic amides, e.g. penicillinase (3.5.2)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders

Definitions

  • the present invention belongs to the field of biotechnology. Specifically, the present invention describes a novel polypeptide ⁇ -dihydroorotase 40, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and polypeptide.
  • Dihydroorotase also known as carbamoyl aspartate dehydratase, catalyzes the initiation of the third stage of pyrimidine biosynthesis and makes ureidosuccinate (N-carbamoyl-L- Aspartic acid) is converted to dihydroorotate.
  • Dihydroorotase is one of the very few enzymes that can biosynthesize an amino bond-catalyzed reaction without directly coupling energy such as ATP. This catalytic reaction also incorporates a zinc atom necessary for catalytic activity.
  • dihydroorotase In bacteria, dihydroorotase is a dimer composed of two identical long chains of about 400 amino acid residues; in higher eukaryotes, dihydroorotase is one This function is part of a large protein; in Drosophila and mammals, it catalyzes the first three steps of pyrimidine biosynthesis. Dihydroorotase is located at the center of this multiprotein. In yeast, dihydroorotase is encoded by a monofunctional protein gene (URA4). However, a dihydroorotase mutant strain was found to be encoded by the multifunctional protein gene (URA2), catalyzing the first two steps of pyrimidine synthesis.
  • UAA4 monofunctional protein gene
  • UAA2 multifunctional protein gene
  • N-terminal conserved sequence D- [LIVMFYWSAP]-H- [L IVA] -H- [LIVF]-[RN] -x- [PGN], where the two fluorene may be sites of zinc ligands.
  • conserved sequence at the C-terminus [GA]-[ST] -D-x- A- P- ⁇ - ⁇ (4) -K, applicable to all enzymes related to dihydroorotase except allantoinase.
  • the human dihydroorotase 40 protein plays an important role in regulating important functions of the body such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes, so the identification of more participation has been required in the field These processes are the human dihydroorotase 40 protein, and in particular the amino acid sequence of this protein is identified. Isolation of the new human dihydroorotase 40 protein encoding gene also provides the basis for research to determine the role of this protein in health and disease states. This protein may form the basis for developing diagnostic and / or therapeutic drugs for the disease, so isolating its coding DNA is important. Object of the invention
  • Another object of the invention is to provide a polynucleotide encoding the polypeptide.
  • Another object of the invention is to provide a genetically engineered host cell containing a polynucleotide encoding human dihydroorotase 40.
  • Another object of the present invention is to provide a method for producing human dihydroorotase 40.
  • Another object of the present invention is to provide an antibody against the polypeptide of the present invention, human dihydroorotase 40.
  • Another object of the present invention is to provide mimetic compounds, antagonists, agonists, and inhibitors of the human dihydroorotase 40 of the polypeptide of the present invention.
  • Another object of the present invention is to provide a method for diagnosing and treating a disease associated with abnormal human dihydroorotase 40. Summary of invention
  • the present invention relates to an isolated polypeptide, which is of human origin, and includes: a polypeptide having the amino acid sequence of SEQ ID No., or a conservative variant, biologically active fragment, or derivative thereof.
  • the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
  • polynucleotide complementary to polynucleotide (a);
  • sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 18-1121 in SEQ ID NO: 1; and (b) a sequence having 1-1688 in SEQ ID NO: 1 Sequence of bits.
  • the present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
  • the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
  • the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of human dihydroorotase 40 protein, which comprises utilizing the polypeptide of the invention.
  • the invention also relates to compounds obtained by this method.
  • the invention also relates to a method for detecting a disease or susceptibility to disease associated with abnormal expression of human dihydroorotase 40 protein in vitro, which comprises detecting a mutation in the polypeptide or a sequence encoding a polynucleotide thereof in a biological sample, or Detection of the amount or biological activity of a polypeptide of the invention in a biological sample.
  • the invention also relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
  • the present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention for the preparation of a medicament for treating cancer, developmental disease or immune disease or other diseases caused by abnormal expression of human dihydroorotase 40.
  • FIG. 1 is a comparison diagram of gene chip expression profiles of the dihydroorotase 40 and human dihydroorotase 10 of the present invention.
  • the upper graph is a graph of the expression profile of human dihydroorotase 40
  • the lower graph is the graph of the expression profile of human dihydroorotase 10.
  • 1 indicates fetal kidney
  • 2 indicates fetal large intestine
  • 3 indicates fetal small intestine
  • 4 indicates fetal muscle
  • 5 indicates fetal brain
  • 6 indicates fetal bladder
  • 7 indicates non-starved L02
  • 8 indicates L02 +, lhr, As 3+
  • 9 indicates ECV304 PMA-
  • 10 means ECV304 PMA +
  • 11 means fetal liver
  • 12 means normal liver
  • 13 means thyroid
  • 14 means skin
  • 15 means fetal lung
  • 16 means lung
  • 17 means lung cancer
  • 18 means fetal spleen
  • 19 means spleen
  • 20 Indicates prostate
  • 21 indicates fetal heart
  • 22 indicates heart
  • 23 indicates muscle
  • 24 indicates testis
  • 25 indicates fetal thymus
  • 26 indicates thymus.
  • FIG. 2 is a polyacrylamide gel electrophoresis diagram (SDS-PAGE) of isolated human dihydroorotase 40.
  • FIG. 40KDa is the molecular weight of the protein. The arrow indicates the isolated protein band. Summary of the invention
  • Nucleic acid sequence refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
  • amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
  • amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
  • a “variant" of a protein or polynucleotide refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it.
  • the changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence.
  • Variants can have "conservative" changes, in which the amino acid substituted has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine.
  • Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
  • “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
  • Insertion means that a change in the amino acid sequence or nucleotide sequence results in an increase in one or more amino acids or nucleotides compared to a molecule that exists in nature.
  • Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
  • Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
  • immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response and to bind specific antibodies in a suitable animal or cell.
  • An "agonist” refers to a molecule that, when combined with human dihydroorotase 40, causes the protein to change, thereby regulating the activity of the protein.
  • An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that binds human dihydroorotase 40.
  • Antagonist refers to a molecule that, when combined with human dihydroorotase 40, blocks or regulates the biological or immunological activity of human dihydroorotase 40.
  • Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates, or any other molecule that binds human dihydroorotase 40.
  • “Regulation” refers to a change in the function of human dihydroorotase 40, including an increase in protein activity Or decrease, changes in binding properties, and any other biological, functional or immune properties of human dihydroorotase 40.
  • substantially pure means substantially free of other proteins, lipids, carbohydrates or other substances with which it is naturally associated.
  • Those skilled in the art can purify human dihydroorotase 40 using standard protein purification techniques. Basically pure human dihydroorotase 40 produces a single main band on a non-reducing polyacrylamide gel. The purity of the human dihydroorotase 40 peptide can be analyzed by amino acid sequence.
  • Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
  • sequence C-T-G-A
  • complementary sequence G-A-C-T.
  • the complementarity between two single-stranded molecules may be partial or complete.
  • the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
  • “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
  • Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Southern imprinting or Northern blotting, etc.) under conditions of reduced stringency. Substantially homologous sequences or hybridization probes can compete and inhibit the binding of fully homologous sequences to target sequences under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.
  • Percent identity refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALIGN program (Lasergene sof tware package, DNASTAR, Inc., Madi son Wis.). The MEGALIGN program can compare two or more sequences according to different methods such as the Clus ter method (Hi ggins, DG and PM Sharp (1988) Gene 73: 237-244). The D Clus ter method compares each pair by checking the distance between all pairs. Group sequences are arranged in clusters. The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula:
  • the percent identity between nucleic acid sequences can also be determined by the Clus ter method or by methods known in the art such as Jotun Hein (Hein L, (1990) Methods in enzymology 183: 625-645). 0 "Similarity” refers to the amino acid sequence The degree of identical or conservative substitutions of amino acid residues at corresponding positions when aligning between them.
  • negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine Acids and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
  • Antisense refers to a nucleotide sequence that is complementary to a particular DNA or MA sequence.
  • Antisense strand refers to a nucleic acid strand that is complementary to a “sense strand.”
  • Derivative refers to HFP or a chemical modification of its nucleic acid. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
  • Antibody refers to a complete antibody molecule and its fragments, such as Fa,? ( ⁇ ') 2 and? , It can specifically bind to the epitope of human dihydroorotase 40.
  • a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
  • isolated refers to the removal of a substance from its original environment (for example, its natural environment if it is naturally occurring).
  • a naturally-occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
  • Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not part of its natural environment, they are still isolated.
  • isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
  • polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances in the natural state .
  • isolated human dihydroorotase 40 means that human dihydroorotase 40 is substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated. Those skilled in the art can purify human dihydroorotase 40 using standard protein purification techniques. Substantially pure peptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of the human dihydroorotase 40 peptide can be analyzed by amino acid sequences.
  • the present invention provides a new polypeptide, human dihydroorotase 40, which basically consists of the amino acid sequence shown in SEQ ID NO: 2.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, a synthetic polypeptide, and preferably a recombinant polypeptide.
  • the polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques. Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
  • the invention also includes fragments, derivatives and analogs of human dihydroorotase 40.
  • fragment refers to a polypeptide that substantially retains the same biological function or activity of the human dihydroorotase 40 of the present invention.
  • a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution
  • the amino acid may or may not be encoded by a genetic codon; or ( ⁇ ) a type in which a group on one or more amino acid residues is replaced by another group to include a substituent; or ( ⁇ ⁇ )
  • Such a type in which the mature polypeptide is fused with another compound such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol
  • (IV) a type in which the additional amino acid sequence is fused into the mature polypeptide and the polypeptide sequence is formed (Such as the leader or secretory sequence or the sequence used to purify the polypeptide or protease sequence).
  • such fragments, derivatives and analogs are considered to be within the knowledge of those skilled in the art.
  • the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
  • the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a full-length polynucleotide sequence of 1688 bases, and its open reading frames 18-1121 encode 367 amino acids.
  • the polynucleotide of the present invention may be in the form of DNA or RNA.
  • DNA forms include cDNA, genomic DM, or synthetic DM.
  • DNA can be single-stranded or double-stranded.
  • DM can be coded or non-coded.
  • the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
  • a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
  • the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
  • polynucleotide encoding a polypeptide refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.
  • the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
  • Variants of this polynucleotide may be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
  • an allelic variant is a polynucleotide A replacement form, which may be a substitution, deletion or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes.
  • the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity, between the two sequences).
  • the present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions.
  • “strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60 ° C; or (2) Add denaturants during hybridization, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% Ficol 1, 42 ° C, etc .; or (3) only between the two sequences Hybridization occurs only when the identity is at least 95%, and more preferably 97%.
  • the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
  • nucleic acid fragments that hybridize to the sequences described above.
  • a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 cores. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques, such as PCR, to identify and / or isolate polynucleotides encoding human dihydroorotase 40.
  • polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
  • the specific polynucleotide sequence encoding human dihydroorotase 40 of the present invention can be obtained by various methods.
  • polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or CDM libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
  • the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the DM of the genome; 2) chemically synthesizing the DM sequence to obtain the double-stranded DM of the polypeptide.
  • genomic DM is the least commonly used. Direct chemical synthesis of MA sequences is often the method of choice. The more commonly used method is the separation of cDM sequences.
  • the standard method for isolating the cDM of interest is to isolate raRM from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDM library.
  • fflRNA extraction There are many mature techniques for fflRNA extraction, and kits are also commercially available (Qiagene). It is also a common method to construct a CDM library (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spiring Harbor Laboratory. New York, 1989).
  • Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
  • genes can be screened from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DNA-RNA hybridization; (2) the presence or absence of marker gene functions; (3) determining the level of human dihydroorotase 40 transcripts; (4) through immunological techniques or determination of biological activity, To detect gene-expressed protein products. The above methods can be used singly or in combination.
  • the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
  • the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
  • the probes used herein are generally MA sequences chemically synthesized based on the gene sequence information of the present invention.
  • the genes or fragments of the present invention can of course be used as probes.
  • DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
  • immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) can be used to detect the protein product expressed by the human dihydroorotase 40 gene.
  • ELISA enzyme-linked immunosorbent assay
  • a method for amplifying DM / RNA by PCR is preferably used to obtain the gene of the present invention.
  • the RACE method RACE-rapid amplification of cDNA ends
  • the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Select and synthesize using conventional methods.
  • the amplified DNA / RM fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
  • polynucleotide sequence of the gene of the present invention or various DM fragments and the like obtained as described above can be measured by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, sequencing needs to be repeated. Sometimes it is necessary to determine the cDM sequence of multiple clones in order to splice into a full-length cDNA sequence.
  • the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using a human dihydroorotase 40 coding sequence, and the recombinant technology to produce the polypeptide of the present invention Methods.
  • a polynucleotide sequence encoding human dihydroorotase 40 can be inserted into a vector to form a recombinant vector containing the polynucleotide of the present invention.
  • vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
  • Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al.
  • any plasmid and vector can be used to construct a recombinant expression vector.
  • An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements. Methods known to those skilled in the art can be used to construct expression vectors containing the DM sequence encoding human dihydroorotase 40 and appropriate transcriptional / translational regulatory elements.
  • the DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis.
  • promoters are: the lac or trp promoter of E.
  • the expression vector also includes a ribosome binding site and a transcription terminator for translation initiation. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for D expression, usually about 10 to 300 base pairs that act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers on the late side of the origin of replication, and adenoviral enhancers.
  • the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase for eukaryotic cell culture, neomycin resistance, and Green fluorescent protein (GFP), or tetracycline or ampicillin resistance for E. coli.
  • selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase for eukaryotic cell culture, neomycin resistance, and Green fluorescent protein (GFP), or tetracycline or ampicillin resistance for E. coli.
  • a polynucleotide encoding human dihydroorotase 40 or a recombinant vector containing the polynucleotide can be transformed or introduced into a host cell to form a genetically engineered host cell containing the polynucleotide or the recombinant vector.
  • the term "host cell” refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E.
  • coli Streptomyces
  • bacterial cells such as Salmonella typhimurium
  • fungal cells such as yeast
  • plant cells such as insect cells such as Fly S2 or Sf9
  • animal cells such as CH0, COS or Bowes melanoma cells.
  • Transformation of a host cell with a DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art.
  • the host is a prokaryote, such as E. coli
  • competent cells capable of absorbing DNA can be harvested after the exponential growth phase and treated with the CaCl 2 method. The steps used are well known in the art. Alternatively, MgCl 2 is used. If necessary, transformation can also be performed by electroporation.
  • the host is a eukaryote, the following DM transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
  • the polynucleotide sequence of the present invention can be used for expression or production Recombinant human dihydroorotase 40 (Sc ience, 1984; 224: 1431). Generally there are the following steps:
  • the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
  • a suitable method such as temperature conversion or chemical induction
  • the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If necessary, the recombinant protein can be isolated and purified by various separation methods using its physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
  • conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid
  • polypeptides of the present invention as well as antagonists, agonists and inhibitors of the polypeptides, can be directly used in the treatment of diseases, for example, they can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection, and immune diseases.
  • Dihydroorotase catalyzes the initiation of the third stage of pyrimidine biosynthesis, converting ureidosuccinic acid (N-carbamoyl-L-aspartic acid) to dihydroorotate.
  • Dihydroorotase is one of the very few enzymes to biosynthesize an amino bond-catalyzed reaction without directly coupling energy such as ATP.
  • the pyrimidine biosynthesis is necessary for the production of nucleotides.
  • Dihydroorotase-specific conserved sequences are required to form its active mot if.
  • the abnormal expression of the specific dihydroorotase mot if will cause the function of the polypeptide containing the mot if of the present invention to be abnormal, thereby causing abnormalities in nucleotide biosynthesis, and then affecting the regulation and control of genetic information.
  • Expression, and produce related diseases such as tumors, embryonic developmental disorders, growth and development disorders, inflammation, etc.
  • human dihydroorotase 40 of the present invention will produce various diseases, especially tumors, embryonic developmental disorders, growth and development disorders, and inflammations. These diseases include, but are not limited to:
  • Fetal developmental disorders congenital abortion, cleft palate, limb loss, limb differentiation disorder, hyaline membrane disease, atelectasis, multiple kidneys, double ureters, cryptorchidism, congenital inguinal hernia, double uterus, vaginal atresia, suburethral urethra Fissure, hermaphroditism, atrial septal defect, ventricular septal defect, pulmonary stenosis, arterial conduction Tube closure, neural tube defects, congenital hydrocephalus, iris defect, congenital cataract, congenital glaucoma or cataract, congenital deafness
  • Growth and development disorders mental retardation, cerebral palsy, brain development disorders, mental retardation, familial cerebral nucleus dysplasia syndrome, strabismus, skin, fat and muscular dysplasia such as congenital skin laxity, premature aging Disease, congenital keratosis, various metabolic defects such as various amino acid metabolic defects, stunting, dwarfism, sexual retardation
  • Tumors of various tissues gastric cancer, liver cancer, lung cancer, esophageal cancer, breast cancer, leukemia, lymphoma, thyroid tumor, uterine fibroids, neuroblastoma, astrocytoma, ependymoma, glioblastoma, Colon cancer, melanoma, adrenal cancer, bladder cancer, bone cancer, osteosarcoma, myeloma, bone marrow cancer, brain cancer, uterine cancer, endometrial cancer, gallbladder cancer, thymic tumor, nasal cavity and sinus cancer, nasopharyngeal cancer, Laryngeal cancer, tracheal tumor, fibroma, fibrosarcoma, lipoma, liposarcoma, leiomyoma
  • Inflammation allergic reaction, bronchial asthma, allergic pneumonia, adult respiratory distress syndrome, sarcoidosis, rheumatoid arthritis, rheumatoid arthritis, osteoarthritis, cholangitis, glomerulonephritis, immune complex Types of glomerulonephritis, acute anterior uveitis, dermatomyositis, urticaria, atopic dermatitis, hemochromatosis, polymyositis, Addison's disease, chronic active hepatitis, emergency bowel syndrome, atrophy Gastritis, systemic lupus erythematosus, myasthenia gravis, cerebrospinal spinal multiple sclerosis, Guillain-Barre syndrome, intracranial granuloma, pancreatitis, myocarditis, and inflammation caused by infections and trauma
  • human dihydroorotase 40 of the present invention will also produce certain hereditary, hematological and immune system diseases.
  • the invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) human dihydroorotase 40.
  • Agonists enhance human dihydroorotase 40 to stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
  • mammalian cells or membrane preparations expressing human dihydroorotase 40 can be cultured with labeled human dihydroorotase 40 in the presence of a drug. The ability of the drug to increase or block this interaction is then determined.
  • Antagonists of human dihydroorotase 40 include antibodies, compounds, receptor deletions, and the like that have been screened. Antagonists of human dihydroorotase 40 can bind to human dihydroorotase 40 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide such that the polypeptide cannot function biological functions.
  • human dihydroorotase 40 When screening compounds as antagonists, human dihydroorotase 40 can be added to a bioanalytical assay to determine the compound by measuring the effect of the compound on the interaction between human dihydroorotase 40 and its receptor Whether it is an antagonist. Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds.
  • the polypeptide molecule capable of binding to human dihydroorotase 40 may be It is obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. In screening, human dihydroorotase 40 molecules should generally be labeled.
  • the present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies.
  • the invention also provides antibodies against human dihydroorotase 40 epitopes. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single-chain antibodies, Fab fragments, and fragments from Fab expression libraries.
  • Polyclonal antibodies can be produced by injecting human dihydroorotase 40 directly into immunized animals (such as rabbits, mice, rats, etc.).
  • immunized animals such as rabbits, mice, rats, etc.
  • adjuvants can be used to enhance the immune response, including, but not limited to Adjuvant, etc.
  • Techniques for preparing monoclonal antibodies against human dihydroorotase 40 include, but are not limited to, hybridoma technology (Kohl er and Mistein. Nature, 1975, 256: 495-497), triple tumor technology, human beta-cell hybridization Tumor technology, EBV-hybridoma technology, etc.
  • Chimeric antibodies that bind human constant regions to non-human-derived variable regions can be produced using existing techniques (Morrison et al, PNAS, 1985, 81: 6851).
  • the existing technology for producing single chain antibodies U.S. Pat No. 4946778, can also be used to produce single chain antibodies against human dihydroorotase 40.
  • Anti-human dihydroorotase 40 antibodies can be used in immunohistochemical techniques to detect human dihydroorotase 40 in biopsy specimens.
  • Monoclonal antibodies that bind to human dihydroorotase 40 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
  • Antibodies can also be used to design immunotoxins that target a particular part of the body.
  • human dihydroorotase 40 high affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
  • a common method is to attack the amino group of the antibody with a thiol crosslinker such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
  • This hybrid antibody can be used to kill human dihydroorotase 40 positive Cell.
  • the antibodies in the present invention can be used to treat or prevent diseases related to human dihydroorotase 40.
  • Administration of an appropriate dose of the antibody can stimulate or block the production or activity of human dihydroorotase 40.
  • the invention also relates to a diagnostic test method for quantitative and localized detection of human dihydroorotase 40 levels. These tests are well known in the art and include FISH assays and radioimmunoassays. The level of human dihydroorotase 40 detected in the test can be used to explain the importance of human dihydroorotase 40 in various diseases and to diagnose the role of human dihydroorotase 40 disease.
  • polypeptides of the present invention can also be used for peptide mapping, for example, the polypeptides can be physically, chemically or enzymatically Specific cleavage and one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, preferably mass spectrometry.
  • the polynucleotide encoding human dihydroorotase 40 can also be used for a variety of therapeutic purposes. Gene therapy techniques can be used to treat abnormal cell proliferation, development, or metabolism caused by the non-expression or abnormal / inactive expression of human dihydroorotase 40.
  • Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated human dihydroorotase 40 to inhibit endogenous human dihydroorotase 40 activity.
  • a mutated human dihydroorotase 40 may be a shortened human dihydroorotase 40 lacking a signaling domain. Although it can bind to a downstream substrate, it lacks signaling activity.
  • the recombinant gene therapy vector can be used for treating diseases caused by abnormal expression or activity of human dihydroorotase 40.
  • Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to transfer a polynucleotide encoding human dihydroorotase 40 into a cell.
  • Methods for constructing recombinant viral vectors carrying a polynucleotide encoding human dihydroorotase 40 can be found in the existing literature (Sarabrook, et al.).
  • a recombinant polynucleotide encoding human dihydroorotase 40 can be packaged into liposomes and transferred into cells.
  • Methods for introducing a polynucleotide into a tissue or cell include: injecting the polynucleotide directly into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
  • a vector such as a virus, phage, or plasmid
  • Oligonucleotides including antisense RNA and DNA
  • ribozymes that inhibit human dihydroorotase 40 mRNA are also within the scope of the present invention.
  • a ribozyme is an enzyme-like RM molecule that can specifically decompose a specific MA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA and performs endonucleation.
  • Antisense RNA, DNA and ribozymes can be obtained using any of the existing RNA or DNA synthesis techniques. For example, solid-phase phosphoramidite chemical synthesis for the synthesis of oligonucleotides has been widely used.
  • Antisense RM molecules can be obtained by in vitro or in vivo transcription of a DM sequence encoding the RM.
  • This DM sequence has been integrated downstream of the RNA polymerase promoter of the vector.
  • it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the linkage between ribonucleosides using phosphorothioate or peptide bonds instead of phosphodiester bonds.
  • the polynucleotide encoding human dihydroorotase 40 can be used for the diagnosis of diseases related to human dihydroorotase 40.
  • the polynucleotide encoding human dihydroorotase 40 can be used to detect the expression of human dihydroorotase 40 or the abnormal expression of human dihydroorotase 40 in a disease state.
  • the DM sequence encoding human dihydroorotase 40 can be used to hybridize biopsy specimens to determine the expression of human dihydroorotase 40.
  • Hybridization techniques include Southern blotting, Northern blotting, and in situ hybridization. These techniques and methods are publicly available and mature, and related kits are commercially available.
  • the hair Some or all of the polynucleotides can be used as probes to be fixed on a microarray or DM chip (also known as a "gene chip") for analyzing differential expression analysis and gene diagnosis of genes in tissues.
  • Human dihydroorotase 40-specific primers can be used to perform RNA-polymerase chain reaction (RT-PCR) in vitro amplification to detect human dihydroorotase 40 transcripts.
  • Detection of mutations in the human dihydroorotase 40 gene can also be used to diagnose human dihydroorotase 40-related diseases.
  • Human dihydroorotase 40 mutant forms include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type human dihydroorotase 40 DM sequence. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression. Therefore, Northern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
  • sequences of the invention are also valuable for chromosome identification. This sequence will specifically target a specific position on a human chromosome and can hybridize to it. Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for marking chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DNA sequences on a chromosome.
  • PCR primers (preferably 15-35bp) are prepared based on cDNA, and the sequences can be located on chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
  • PCR localization of somatic hybrid cells is a quick way to localize DM to specific chromosomes.
  • oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
  • Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and hybrid pre-selection to construct a chromosome-specific c-leg bank.
  • Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step.
  • FISH Fluorescent in situ hybridization
  • the differences in cDNA or genomic sequences between the affected and unaffected individuals need to be determined. If at A mutation is observed in some or all of the affected individuals, and the mutation is not observed in any normal individuals, then the mutation may be the cause of the disease. Comparing diseased and unaffected individuals usually involves first looking for structural changes in the chromosome, such as deletions or translocations that are visible at the chromosomal level or detectable with cDM sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).
  • the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
  • suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
  • the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
  • the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell.
  • the polypeptides of the invention can be used in combination with other therapeutic compounds.
  • the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
  • Human dihydroorotase 40 is administered in an amount effective to treat and / or prevent a specific indication.
  • the amount and dose range of human dihydroorotase 40 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician. Examples
  • Total human fetal brain RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform.
  • Poly (A) mRNA was isolated from total RNA using Quik mRNA Isolat ion Kit (product of Qiegene). 2ug poly (A) mRNA is reverse transcribed to form cDNA. Use Smart cDM Cloning Kit (purchased from Clontech). The 0 fragment was inserted into the multiple cloning site of the pBSK (+) vector (Clontech), and transformed into DH5a. The bacteria formed a cDNA library.
  • Dye terminate cycle react ion sequencing kit Perkin—Elmer
  • ABI 377 An automatic sequencer (Perkin-Elmer) determined all cloned and 3 'end sequences. The determined cDNA sequence was compared with an existing public DNA sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 0763a02 was new DNA. A series of primers were synthesized to determine the inserted cDNA fragments of the clone in both directions.
  • CDNA was synthesized using fetal brain total RNA as a template and ol igo-dT as a primer for reverse transcription reaction. After purification with Qiagene's kit, the following primers were used for PCR amplification:
  • Primer 1 5'- GGATCAAAGTAGGCAAGATGGCGT -3, (SEQ ID NO: 3)
  • Pr itner2 5,-TGCCTATCTTTATTTCTATTGTAA -3, (SEQ ID NO: 4)
  • Pr imerl is a forward sequence located at the 5th end of SEQ ID NO: 1, starting at lbp;
  • Primer 2 is the 3 'terminal reverse sequence of SEQ ID NO: 1.
  • Amplification reaction conditions 50m1 of reaction volume containing 50mfflo l / L KC1, 10 mmol / L Tris-HCl, pH 8. 5, 1. 5 mmol / L MgCl 2 , 20 (mol / L dNTP, l Opmol Primer, 1U Taq DNA polymerase (Clontech).
  • the reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) for 25 cycles under the following conditions: 94 ° C 30sec; 55 ° C 30sec; 72 ° C 2min During RT-PCR, ⁇ -act in was used as a positive control and template blank was used as a negative control.
  • Amplification products were purified using a QIAGEN kit and ligated to a pCR vector (a product of Invitrogen) using a TA cloning kit.
  • DM sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as 1-1688bp shown in SEQ ID NO: 1.
  • Example 3 Northern blot analysis of human dihydroorotase 40 gene expression
  • RNA extraction in one step [Anal. Biochem 1987, 162, 156-159] 0
  • This method involves acid guanidinium thiocyanate-chloroform extraction. That is, the tissue is homogenized with 4M guanidine isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1) Centrifuge after mixing. The aqueous layer was aspirated, isopropanol (0.8 vol) was added and the mixture was centrifuged to obtain RM precipitate. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water.
  • a 32P-labeled probe (about 2 x 10 6 cpm / ml) was hybridized with a nitrocellulose membrane to which RNA was transferred at 42 ° C overnight in a solution containing 50% formamide-25mM KH 2 P0 4 (pH7. 4)-5 x SSC- 5 x Denhardt's solution and 20 ( ⁇ g / ml salmon sperm DNA. After hybridization, the filter was washed in 1 x SSC-0.1% SDS at 55 ° C for 30 minutes. Then Phosphor Imager was used for analysis and quantification.
  • Example 4 In vitro expression, isolation and purification of recombinant human dihydroorotase 40
  • Primer3 5,-CATGCTAGCATGGCGTCGAGCGGCGGGGAGCTA -3 '(Seq ID No: 5)
  • Primer4 5'- CATGGATCCCTATATTCTTCTTCTTTGTTTTTTAA -3' (Seq ID No: 6)
  • Nhel and BamHI restriction sites correspond to the selection on the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865. 3). Sex endonuclease site.
  • PCR reaction was performed using the pBS-0763a02 plasmid containing the full-length target gene as a template.
  • PCR reaction conditions were: 1 in a total volume of 50 ⁇ plasmid pBS-0763a02 containing 10pg, primer Primer - 3 respectively, and Pr imer- 4 l Opmol, Advantage polymerase Mix (Clontech Products) 1 ⁇ 1.
  • Cycle parameters 94. C 20s, 60. C 30s, 68 ° C 2 min, a total of 25 cycles. Nhel and BamHI were used to double digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase.
  • the ligated product was transformed into Escherichia coli DH5 ct using the calcium chloride method. After being cultured overnight in LB plates containing kanamycin (final concentration 30 ⁇ ⁇ / ⁇ 1), positive clones were selected by colony PCR method and sequenced. A positive clone (PET-0763a02) with the correct sequence was selected, and the recombinant plasmid was transformed into E. coli BL21 (DE3) plySs (product of Novagen) using the calcium chloride method.
  • Polypeptide synthesizer (product of PE company) was used to synthesize the following human dihydroorotase 40-specific peptides: -Asp-His-His-C00H (SEQ ID NO: 7).
  • the polypeptide is coupled with hemocyanin and bovine serum albumin to form a complex, respectively.
  • Rabbits were immunized with 4 mg of the hemocyanin polypeptide complex plus complete Freund's adjuvant, and 15 days later, the hemocyanin polypeptide complex plus incomplete Freund's adjuvant was used to boost immunity once.
  • a titer plate coated with a 15 ⁇ / ⁇ 1 bovine serum albumin peptide complex was used as an ELISA to determine the antibody titer in rabbit serum.
  • Total IgG was isolated from antibody-positive rabbit serum using protein A-Sepharose.
  • the peptide was bound to a cyanogen bromide-activated Sepharose4B column, and anti-peptide antibodies were separated from the total IgG by affinity chromatography.
  • the immunoprecipitation method demonstrated that the purified antibody could specifically bind to human dihydroorotase 40.
  • Example 6 Application of the polynucleotide fragment of the present invention as a hybridization probe
  • Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
  • the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
  • the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
  • the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by using a filter hybridization method.
  • Filter hybridization methods include dot blotting, Southern imprinting, Northern blotting, and copying methods. They all use the same steps to immobilize the polynucleotide sample to be tested on the filter.
  • the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer to saturate the non-specific binding site of the sample on the filter with the carrier and the synthesized polymer.
  • the pre-hybridization solution is then replaced with a hybridization buffer containing labeled probes and incubated to hybridize the probes to the target nucleic acid.
  • the unhybridized probes are removed by a series of membrane washing steps.
  • This embodiment uses higher-intensity washing conditions (such as lower salt concentration and higher temperature), so that the hybridization background is reduced and only strong specific signals are retained.
  • the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
  • the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
  • the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
  • oligonucleotide fragments from the polynucleotide SEQ ID NO: 1 of the present invention as hybridization probes should follow the following principles and several aspects to be considered: 1.
  • the preferred range of probe size is 18-50 nucleotides;
  • Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genome sequences and their complement For homology comparison of the regions, if the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, the primary probe should not be used generally;
  • Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
  • Probe 2 which belongs to the second type of probe, is equivalent to the replacement mutant sequence of the gene fragment of SEQ ID NO: 1 or its complementary fragment (41Nt):
  • PBS phosphate buffered saline
  • step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
  • NC membrane nitrocellulose membrane
  • the sample membrane was placed in a plastic bag and 3-lOmg pre-hybridization solution (lOxDenhardt-s; 6xSSC, 0.1 mg / ml CT DNA (calf thymus DNA)) was added. After sealing the bag, shake at 68 ° C for 2 hours.
  • 3-lOmg pre-hybridization solution lOxDenhardt-s; 6xSSC, 0.1 mg / ml CT DNA (calf thymus DNA)
  • Gene chip or gene microarray is a new technology currently being developed by many national laboratories and large pharmaceutical companies.
  • the data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software to achieve the purpose of rapid, efficient, and high-throughput analysis of biological information.
  • the polynucleotide of the present invention can be used as a target DM for gene chip technology for high-throughput research of new gene functions; search for and screen new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases, such as genetic diseases .
  • the specific method steps have been reported in the literature. For example, see DeRis i, L L., Lyer, V. & Brown, P. 0. (1997) Science 278, 680-686. And Hel le, RA. , Schema, M., Chai, A., Shalom, D., (1997) PNAS 94: 2150-2155.
  • a total of 4,000 polynucleotide sequences of various full-length cDNAs are used as the target DM, including the polynucleotide of the present invention. They were respectively amplified by PCR. After purification, the concentration of the amplified product was adjusted to about 500 ng / ul, and spotted on a glass medium with a Cartesian 7500 spotter (purchased from Cartesian Company, USA). The distance between them is 280 ⁇ . The spotted slides were hydrated and dried, cross-linked in a UV cross-linker, and dried after elution to fix the DNA on the glass slides to prepare chips. The specific method steps have been reported in the literature. The sample post-processing steps in this embodiment are:
  • Total m A was extracted from human mixed tissues and specific tissues (or stimulated cell lines) in one step, and mRM was purified with Ol igotex mRNA Midi Kit (purchased from QiaGen).
  • J Cy3dUTP (5-Amino-propargyl-2'-deoxyur idine 5'-tr iphate coupled to Cy3 f luorescent dye, purchased from Amersham Phamacia Biotech) was used to label the mRNA of human mixed tissue, and the fluorescent reagent Cy5dUTP ( 5- Amino- propargyl-2'-deoxyur idine 5'-triphate coupled to Cy5 f luorescent dye, purchased from Amersham Phamacia Biotech company, labeled the specific tissue (or stimulated cell line) mRNA of the body, and purified the probe to prepare a probe .
  • Cy5dUTP 5- Amino- propargyl-2'-deoxyur idine 5'-triphate coupled to Cy5
  • the probes from the above two tissues and the chip were respectively hybridized in a UniHyb TM Hybridizat ion Solut ion (purchased from TeleChem) hybridization solution for 16 hours, and washed with a washing solution (lx SSC, 0.2% SDS) at room temperature. Scanning was performed with a ScanArray 3000 scanner (purchased from General Scanning, USA), and the scanned images were analyzed and processed with Imagene software (Biodiscovery, USA) to calculate the Cy3 / Cy5 ratio of each point.
  • the above specific tissues are thymus, testis, muscle, spleen, lung, skin, thyroid, liver, PMA + Ecv304 cell line, PMA-Ecv304 cell line, non-starved L02 cell line, L02 cell line stimulated by arsenic for 1 hour, L02 cell line stimulated by arsenic for 6 hours prostate, heart, lung cancer, fetal bladder, fetal small intestine, fetal large intestine, fetal thymus, fetal muscle, fetal liver, fetus, fetal spleen, fetal brain, Fetal lung and fetal heart.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Engineering & Computer Science (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Genetics & Genomics (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

L'invention concerne un nouveau polypeptide, une dihydroorotase humaine 40, et un polynucléotide codant pour ce polypeptide ainsi qu'un procédé d'obtention de ce polypeptide par des techniques recombinantes d'ADN. L'invention concerne en outre les applications de ce polypeptide dans le traitement de maladies, notamment des tumeurs malignes, de l'hémopathie, de l'infection par VIH, de maladies immunitaires et de diverses inflammations. L'invention concerne aussi l'antagoniste agissant contre le polypeptide et son action thérapeutique ainsi que les applications de ce polynucléotide codant pour la dihydroorotase humaine 40.
PCT/CN2001/000414 2000-03-24 2001-03-23 Nouveau polypeptide, dihydroorotase humaine 40, et polynucleotide codant pour ce polypeptide WO2001075037A2 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU56063/01A AU5606301A (en) 2000-03-24 2001-03-23 A novel polypeptide, a human dihydroorotase 40 and the polynucleotide encoding the polypeptide

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN00115126.6 2000-03-24
CN00115126A CN1315576A (zh) 2000-03-24 2000-03-24 一种新的多肽——人二氢乳清酸酶40和编码这种多肽的多核苷酸

Publications (2)

Publication Number Publication Date
WO2001075037A2 true WO2001075037A2 (fr) 2001-10-11
WO2001075037A3 WO2001075037A3 (fr) 2002-02-21

Family

ID=4584595

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2001/000414 WO2001075037A2 (fr) 2000-03-24 2001-03-23 Nouveau polypeptide, dihydroorotase humaine 40, et polynucleotide codant pour ce polypeptide

Country Status (3)

Country Link
CN (1) CN1315576A (fr)
AU (1) AU5606301A (fr)
WO (1) WO2001075037A2 (fr)

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
DATABASE GENBANK [Online] ROSWELL PARK CANCER INSTITUTE HUMAN BAC LIBRARY 09 October 1999 MUZNY D. ET AL.: 'Homo sapiens 12p13 BAC RPCI11-388F6' Database accession no. AC008012 *
HUGHES L.E. ET AL. CURR. MICROBIOL. vol. 39, no. 4, October 1999, pages 175 - 179 *
IWAHANA H. ET AL. BIOCHEM. BIOPHYS. RES. COMMUN. vol. 219, no. 1, 06 February 1996, pages 249 - 255 *
LIN X. ET AL.: 'Sequence and analysis of chromosome 2 of the plant arabidopsis thaliana' NATURE vol. 402, no. 6763, 1999, pages 761 - 768 *

Also Published As

Publication number Publication date
WO2001075037A3 (fr) 2002-02-21
AU5606301A (en) 2001-10-15
CN1315576A (zh) 2001-10-03

Similar Documents

Publication Publication Date Title
WO2001090378A1 (fr) Nouveau polypeptide, proteine humaine hexokinase 11, et polynucleotide codant ce polypeptide
WO2001083538A1 (fr) Nouveau polypeptide, proteine humaine 36 du gene k-ras, et polynucleotide codant pour ce polypeptide
WO2001075037A2 (fr) Nouveau polypeptide, dihydroorotase humaine 40, et polynucleotide codant pour ce polypeptide
WO2001079432A2 (fr) Nouveau polypeptide, facteur humain de transcription de la differentiation cellulaire 58, et polynucleotide codant pour ce polypeptide
WO2001075048A2 (fr) Nouveau polypeptide, proteine ribosomale humaine s11 23, et polynucleotide codant pour ce polypeptide
WO2001072801A1 (fr) Nouveau polypeptide, proteine ribosomale humaine s11 12, et polynucleotide codant pour ce polypeptide
WO2001072793A1 (fr) Nouveau polypeptide, proteine humaine de regulation 12 de la proteine hydrolase, et polynucleotide codant pour ce polypeptide
WO2001047975A1 (fr) Nouveau polypeptide, proteine 10 contenant un domaine chromo, et polynucleotide codant pour ce polypeptide
WO2001094401A1 (fr) Nouveau polypeptide, proteine npat humaine 15, et polynucleotide codant pour ce polypeptide
WO2001090376A1 (fr) Nouveau polypeptide, triose phosphate isomerase humaine 11, et polynucleotide codant ce polypeptide
WO2001085776A1 (fr) Polypeptide humain dihydro-orotase 12 et polynucleotide codant pour ce polypeptide
WO2001083681A2 (fr) Nouveau polypeptide, dihydroorotase humaine 21, et polynucleotide codant pour ce polypeptide
WO2001075017A2 (fr) Nouveau polypeptide, dihydroorotase humaine 17, et polynucleotide codant pour ce polypeptide
WO2001083758A2 (fr) Nouveau polypeptide, dihydroorotase humaine 8, et polynucleotide codant pour ce polypeptide
WO2001090178A1 (fr) Nouveau polypeptide, dihydroorotase humaine 11, et polynucleotide codant ce polypeptide
WO2001083724A1 (fr) Nouveau polypeptide, dihydroorotase humaine 17, et polynucleotide codant pour ce polypeptide
WO2001073054A1 (fr) Nouveau polypeptide, dihydroorotase humaine 11, et polynucleotide codant pour ce polypeptide
WO2001090171A1 (fr) Nouveau polypeptide, proteine humaine ribosomale sii 12, et polynucleotide codant ce polypeptide
WO2001072979A1 (fr) Nouveau polypeptide, dihydroorotase humaine 15, et polynucleotide codant pour ce polypeptide
WO2001072810A1 (fr) Nouveau polypeptide, proteine humaine 12 de la famille des amidases, et polynucleotide codant pour ce polypeptide
WO2001047974A1 (fr) Nouveau polypeptide, dihydroorotase humaine 10, et polynucleotide codant pour ce polypeptide
WO2001048160A1 (fr) Nouveau polypeptide, proteine tyrosine phosphatase 12, et polynucleotide codant pour ce polypeptide
WO2001075079A1 (fr) Nouveau polypeptide, dihydroorotase humaine 13, et polynucleotide codant pour ce polypeptide
WO2002026795A1 (fr) Nouveau polypeptide, dihydrooratase humaine 15.29, et polynucleotide codant ce polypeptide
WO2001087966A1 (fr) Nouveau polypeptide, proteine pax humaine 22, et polynucleotide codant pour ce polypeptide

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
AK Designated states

Kind code of ref document: A3

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A3

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase in:

Ref country code: JP