WO2001090378A1 - Nouveau polypeptide, proteine humaine hexokinase 11, et polynucleotide codant ce polypeptide - Google Patents
Nouveau polypeptide, proteine humaine hexokinase 11, et polynucleotide codant ce polypeptide Download PDFInfo
- Publication number
- WO2001090378A1 WO2001090378A1 PCT/CN2001/000775 CN0100775W WO0190378A1 WO 2001090378 A1 WO2001090378 A1 WO 2001090378A1 CN 0100775 W CN0100775 W CN 0100775W WO 0190378 A1 WO0190378 A1 WO 0190378A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- polypeptide
- polynucleotide
- protein
- human hexokinase
- sequence
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
- C12N9/1205—Phosphotransferases with an alcohol group as acceptor (2.7.1), e.g. protein kinases
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y207/00—Transferases transferring phosphorus-containing groups (2.7)
- C12Y207/01—Phosphotransferases with an alcohol group as acceptor (2.7.1)
- C12Y207/01001—Hexokinase (2.7.1.1)
Definitions
- the present invention belongs to the field of biotechnology. Specifically, the present invention describes a novel polypeptide, human hexokinase protein 11, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and polypeptide.
- Hexokinase catalyzes the phosphorylation of glucose. This reversible reaction requires the participation of ATP. This reaction is the first step of the glycolysis reaction, and it is also the speed regulation step of the glycolysis reaction. It phosphorylates glucose, which is involved in glycolysis, to activate it.
- hexokinase There are four main types of hexokinase in vertebrates: I, I I, I I I, IV. Class IV hexokinase is only expressed in liver cells and spleen P cells, and plays an important role in insulin secretion with a molecular weight of approximately 50 Kd. Class I Hexokinase is the major form of hexokinase in skeletal muscle. The molecular weights of class I and I I hexokinase are about 10 OKd, and their Km value to glucose is slightly smaller. Structurally; the six contain a small N-terminal hydrophobic membrane-binding domain followed by two very similar structures of approximately 450 residues. The first structure has lost its catalytic activity and evolved into a regulatory structure.
- hexokinase PI hexokinase PI
- PI hexokinase PI
- glucokinase hexokinase PI
- Hexokinase I activity is only 25% of normal. In rapidly proliferating tumor tissues, the expression of hexokinase I I is higher than usual, to provide the tumor cells with extremely high requirements for the supply of carbon. Hexokinase ⁇ may be a causative gene for non-insulin-dependent diabetes.
- human hexokinase protein 11 protein regulates cell division and embryonic development. It plays an important role in important functions, and it is believed that a large number of proteins are involved in these regulatory processes. Therefore, there is a need in the art to identify more human hexokinase protein 11 proteins involved in these processes, especially the amino acid sequence of this protein. Isolation of the new human hexokinase protein 11 protein encoding gene also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so it is important to isolate its coding DNA. Object of the invention
- Another object of the invention is to provide a polynucleotide encoding the polypeptide.
- Another object of the present invention is to provide a method for producing human hexokinase protein 11.
- Another object of the present invention is to provide an antibody against the polypeptide of the present invention ⁇ Hexokinase protein 11.
- Another object of the present invention is to provide mimic compounds, antagonists, agonists, and inhibitors of the human hexokinase protein 11 of the polypeptide of the present invention.
- Another object of the present invention is to provide a method for diagnosing and treating a disease associated with an abnormality of human hexokinase protein 11. Summary of invention
- the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
- the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
- the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
- sequence of the polynucleotide is one selected from the group consisting of: (a) having SEQ ID NO: 1 A sequence of positions 709-1484; and (b) 'has a sequence of positions 1-1484 in SEQ ID NO: 1.
- the present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
- the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
- the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of human hexokinase protein 11 protein, which comprises utilizing the polypeptide of the invention.
- the invention also relates to compounds obtained by this method.
- the present invention also relates to a method for detecting a disease or disease susceptibility associated with abnormal expression of human hexokinase protein 11 protein in vitro, comprising detecting mutations in the polypeptide or a polynucleotide sequence encoding the same in a biological sample, or detecting The amount or biological activity of a polypeptide of the invention in a biological sample.
- the invention also relates to a pharmaceutical composition
- a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
- the present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention for the preparation of a medicament for treating cancer, developmental disease or immune disease or other diseases caused by abnormal expression of human hexokinase protein 11.
- FIG. 1 is a comparison diagram of gene chip expression profiles of human hexokinase protein 11 and human hexokinase protein 12 according to the present invention.
- the upper graph is a graph of the expression profile of human hexokinase protein 11, and the lower graph is the graph of the expression profile of human hexokinase protein 12.
- 1 indicates fetal kidney
- 2 indicates fetal large intestine
- 3 indicates fetal small intestine
- 4 indicates fetal muscle
- 5 indicates fetal brain
- 6 indicates fetal bladder
- 7 indicates non-starved L02
- 8 indicates L02 +, lhr, As 3+
- 9 indicates ECV304 PMA-
- 10 means ECV304 PMA +
- 11 means fetal liver
- 12 means normal liver
- 13 means thyroid
- 14 means skin
- 15 means fetal lung
- 16 means lung
- 17 means lung cancer
- 18 means fetal spleen
- 19 means spleen
- 20 Indicates prostate
- 21 indicates fetal heart
- 22 indicates heart
- 23 indicates muscle
- 24 indicates testis
- 25 indicates fetal thymus
- 26 indicates thymus.
- FIG. 2 is a polyacrylamide gel electrophoresis image (SDS-PAGE) of isolated human hexokinase protein 11. llkDa is the molecular weight of the protein. The arrow indicates the isolated protein band. Summary of the invention
- Nucleic acid sequence refers to oligonucleotides, nucleotides or polynucleotides and fragments or parts thereof, and may also refer to the genome or synthetic DNA or MA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
- amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
- amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
- a “variant" of a protein or polynucleotide refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it.
- the changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence.
- Variants can have "conservative" changes, in which the amino acid substituted has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine.
- Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
- “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
- Insertion means that a change in the amino acid sequence or nucleotide sequence results in an increase in one or more amino acids or nucleotides compared to a molecule that exists in nature.
- Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
- Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
- immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response and to bind specific antibodies in a suitable animal or cell.
- An "agonist” refers to a molecule that, when combined with human hexokinase protein 11, can cause the protein to change, thereby regulating the activity of the protein.
- An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that binds human hexokinase protein 11.
- Antagonist refers to a molecule that can block or regulate the biological or immunological activity of human hexokinase protein 11 when combined with human hexokinase protein 11.
- Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates, or any other molecule that binds human hexokinase protein 11.
- Regular refers to a change in the function of human hexokinase protein 11, including an increase or decrease in protein activity, a change in binding characteristics, and any other biological, functional, or immune properties of human hexokinase protein 11.
- Substantially pure means substantially free of other proteins, lipids, carbohydrates or other substances with which it is naturally associated. Matter. Those skilled in the art can purify human hexokinase protein 11 using standard protein purification techniques. Substantially pure human hexokinase protein 11 produces a single main band on a non-reducing polyacrylamide gel. The purity of human hexokinase 11 polypeptide can be analyzed by amino acid sequence.
- Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
- sequence C-T-G-A
- complementary sequence G-A-C-T.
- the complementarity between two single-stranded molecules may be partial or complete.
- the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
- “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
- Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Southern imprinting or Nor thern blotting, etc.) under conditions of reduced stringency.
- Substantially homologous sequences or hybridization probes can compete and inhibit the binding of fully homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.
- Percent identity refers to the percentage of sequences that are the same or similar in a comparison of two or more amino acid or nucleic acid sequences. Percent identity can be determined electronically, such as through the MEGALIGN program
- the MEGALIGN program can compare two or more sequences (Hi gg ins, D. G. and
- residues in the sequence ⁇ - ⁇ interval residues in the sequence - the sequence number of residues in the interval ⁇ X ... -.
- the percent identity between nucleic acid sequences can also be determined by the Clus ter method or by methods known in the art such as Jotun Hein (Hein J., (1990) Methods in enzymology 183: 625-645).
- Similarity refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
- Amino acids used for conservative substitution for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids can include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine .
- Antisense refers to a nucleotide sequence that is complementary to a particular D or RNA sequence.
- Antisense strand refers to a nucleic acid strand that is complementary to the “sense strand”.
- Derivative refers to HFP or a chemical modification of its nucleic acid. This chemical modification may be a substitution of a hydrogen atom with a fluorenyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
- Antibody refers to a complete antibody molecule and its fragments, such as Fa, F (ab ') 2 and Fv, which can specifically bind to the epitope of human hexokinase protein 11.
- a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
- isolated refers to the removal of a substance from its original environment (for example, its natural environment if it is naturally occurring).
- a naturally-occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
- Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not part of its natural environment, they are still isolated.
- isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
- polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances in the natural state .
- isolated human hexokinase protein 11 means that human hexokinase protein 11 is substantially free of other proteins, lipids, carbohydrates, or other substances with which it is naturally associated. Those skilled in the art can purify human hexokinase protein 11 using standard protein purification techniques. Substantially pure peptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of the human hexokinase 11 peptide can be analyzed by amino acid sequences.
- the present invention provides a new polypeptide ⁇ ⁇ -hexokinase protein 11, which is basically composed of the amino acid sequence shown in SEQ ID NO: 2.
- the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, a synthetic polypeptide, and preferably a recombinant polypeptide.
- the polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques. Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
- the invention also includes fragments, derivatives and analogs of human hexokinase protein 11.
- fragment refers to a polypeptide that substantially retains the same biological function or activity of the human hexokinase protein 11 of the present invention.
- a fragment, derivative or analog of the polypeptide of the present invention may be: U) a kind in which one or more amino acid residues are conserved or non-conserved Substitution of amino acid residues (preferably conservative amino acid residues), and the substituted amino acid may or may not be encoded by a genetic codon; or ( ⁇ ) such a type in which one or more of the amino acid residues A group is substituted by another group to include a substituent; or (II) a method in which the mature polypeptide is fused with another compound (such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol); or (IV) such a A polypeptide sequence in which an additional amino acid sequence is fused into a mature polypeptide (such as a leader sequence or a secreted sequence or a sequence used to purify this polypeptide or a proteinogen sequence).
- U a kind in which one or more amino acid residues are conserved or non-conserved Substitution of amino acid residues (preferably
- the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
- the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
- the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a full-length polynucleotide sequence of 1484 bases, and its open reading frame 709-1484 encodes 109 amino acids.
- this polypeptide has a similar expression profile to human hexokinase protein 12, and it can be deduced that the human hexokinase protein 11 has a similar function to human hexokinase protein 12.
- the polynucleotide of the present invention may be in the form of DNA or RNA.
- DNA forms include cDNA, genomic DNA, or synthetic DNA.
- DNA can be single-stranded or double-stranded.
- DM can be coded or non-coded.
- the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
- a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
- the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
- polynucleotide encoding a polypeptide refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.
- the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
- Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
- an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
- the present invention also relates to a polynucleotide that hybridizes to a sequence described above 50% less, preferably 70% identity).
- the invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the invention under stringent conditions.
- "strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60 ° C; or (2) added during hybridization Use variable sex agents, such as 50.
- the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
- nucleic acid fragments that hybridize to the sequences described above.
- a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 cores. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques (such as PCR) to identify and / or isolate polynucleotides encoding human hexokinase protein 11.
- polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
- the specific polynucleotide sequence encoding the human hexokinase protein 11 of the present invention can be obtained by various methods.
- polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
- the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DM sequence from the DM of the genome; 2) chemically synthesizing the DM sequence to obtain the double-stranded DM of the polypeptide.
- genomic DM is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences.
- the standard method for isolating the cDNA of interest is to isolate niRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDM library.
- mRM plasmid or phage cDM library.
- kits are also commercially available (Qiagene).
- the construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989).
- Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
- genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DNA-RNA hybridization; (2) the presence or absence of marker gene functions; (3) measuring the level of transcripts of human hexokinase protein 11; (4) ) Detection of protein products expressed by genes through immunological techniques or determination of biological activity. The above methods can be used singly or in combination.
- the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 Nucleotides, preferably at least 100 nucleotides.
- the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
- the probe used herein is generally a DNA sequence chemically synthesized based on the gene sequence information of the present invention.
- the genes or fragments of the present invention can of course be used as probes.
- DM probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
- immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) can be used to detect the protein product expressed by the human hexokinase protein 11 gene.
- ELISA enzyme-linked immunosorbent assay
- a method (Saiki, et al. Science 1985; 230: 1350-1354) using PCR technology to amplify DNA / RNA is preferably used to obtain the gene of the present invention.
- the RACE method RACE-Rapid Amplification of cDNA Ends
- the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein Select and synthesize using conventional methods.
- the amplified DNA / RM fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
- polynucleotide sequence of the gene of the present invention or various DM fragments and the like obtained as described above can be measured by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, sequencing needs to be repeated. Sometimes it is necessary to determine the cDM sequence of multiple clones in order to splice into a full-length cDNA sequence.
- the present invention also relates to a vector comprising a polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using a human hexokinase protein 11 coding sequence, and a method for producing a polypeptide of the present invention by recombinant technology .
- a polynucleotide sequence encoding human hexokinase protein 11 can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
- vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
- Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al.
- any plasmid and vector can be used to construct a recombinant expression vector.
- An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
- Methods known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding human hexokinase protein 11 and appropriate transcription / translation regulatory elements. These methods include in vitro reconstitution DNA technology, DM synthesis technology, and in vivo recombination technology (Sambroook, et al. Molecular Cloning, a Laboratory Manua l, Cold Spring Harbor Laboratory. New York, 1989).
- the D sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis. Representative examples of these promoters are: E.
- the expression vector also includes a ribosome binding site and a transcription terminator for translation initiation. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers on the late side of the origin of replication, and adenoviral enhancers.
- the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
- selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
- GFP fluorescent protein
- tetracycline or ampicillin resistance for E. coli.
- a polynucleotide encoding human hexokinase protein 11 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a genetically engineered host cell containing the polynucleotide or the recombinant vector.
- the term "host cell” refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E.
- coli Streptomyces
- bacterial cells such as Salmonella typhimurium
- fungal cells such as yeast
- plant cells such as insect cells such as Fly S2 or Sf9
- animal cells such as CH0, COS or Bowes melanoma cells.
- polynucleotide sequence of the present invention can be used to express or produce recombinant human hexokinase protein 11 (Sc ience, 1984; 224: 1431). Generally there are the following steps:
- the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
- a suitable method such as temperature conversion or chemical induction
- the recombinant polypeptide can be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If necessary, the recombinant protein can be isolated and purified by various separation methods using its physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
- conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid
- polypeptides of the present invention as well as antagonists, agonists and inhibitors of the polypeptides, can be directly used in the treatment of diseases, for example, they can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection, and immune diseases.
- Hexokinase catalyzes the phosphorylation of glucose. This reversible reaction requires the participation of ATP. This reaction is the first step of the glycolysis reaction, and it is also the speed regulation step of the glycolysis reaction.
- hexokinase There are currently four types of hexokinase. Class IV hexokinase is only expressed in liver cells and spleen p cells and plays an important role in insulin secretion; class II hexokinase is the main form of hexokinase in skeletal muscle. Km values for glucose of type I and ⁇ hexokinase are slightly smaller. They all have specific conserved sequences to form their active raot if.
- Hexokinase I is only 25% normal in red blood cells and platelets in patients with non-globular erythrocyte hemolytic anemia. In rapidly proliferating tumor tissues, the expression of hexokinase I I is unusually high in order to provide tumor cells with extremely high requirements for the supply of carbon. Hexokinase ⁇ may be a causative gene for non-insulin-dependent diabetes.
- abnormal expression of the specific hexokinase mot if will cause abnormal function of the polypeptide containing the mot if, resulting in abnormal glycolysis process, and further affect the metabolic process of substances and energy. It can also affect insulin Secretion produces information regulation, or plays a role in tumor growth and proliferation, and produces related diseases such as material and energy metabolic disorders, non-insulin-dependent diabetes mellitus, non-globular erythrocyte hemolytic anemia, tumors, and embryonic development disorders , Growth and development disorders.
- human hexokinase protein 11 of the present invention will produce various diseases, especially energy metabolic disorders, non-insulin-dependent diabetes mellitus, aspheric erythrocyte hemolytic anemia, tumors, embryonic developmental disorders, Growth and development disorders.
- disorders of substance and energy metabolism isovaleric acidemia, propionic acidemia, methylmalonic aciduria, combined carboxylase deficiency, glutaric acid type I, phenylketonuria, albinism, tryptophan Anemia, metabolic deficiency of the urea cycle, histidine deficiency, lysine deficiency, orotic aciduria, hyperlipoproteinemia, galactosemia, fructose metabolism deficiency, glycogen storage disease
- Tumors of various tissues gastric cancer, liver cancer, lung cancer, esophageal cancer, breast cancer, leukemia, lymphoma, thyroid tumor, uterine fibroids, neuroblastoma, astrocytoma, ependymoma, glioblastoma, Colon cancer, melanoma, adrenal cancer, bladder cancer, bone cancer, osteosarcoma, myeloma, bone marrow cancer, brain cancer, uterine cancer, endometrial cancer, gallbladder cancer, thymic tumor, nasal cavity and sinus cancer, nasopharyngeal cancer, Laryngeal cancer, tracheal tumor, fibroma, fibrosarcoma, lipoma, liposarcoma, leiomyoma
- Embryonic disorders congenital abortion, cleft palate, limb loss, limb differentiation disorder, hyaline membrane disease, atelectasis, polycystic kidney, double ureter, cryptorchidism, congenital inguinal hernia, double uterus, vaginal atresia, suburethral Fissure, hermaphroditism, atrial septal defect, ventricular septal defect, pulmonary stenosis, arterial duct occlusion, neural tube defect, congenital hydrocephalus, iris defect, congenital cataract, congenital glaucoma or cataract, congenital deafness
- Growth and development disorders mental retardation, cerebral palsy, brain development disorders, familial cerebral nucleus dysplasia syndrome, skin, fat and muscular dysplasias such as congenital skin relaxation, premature aging, congenital horn Malnutrition, stunting, dwarfism, sexual retardation
- the abnormal expression of the human hexokinase protein 11 of the present invention will also produce certain hereditary, hematological and immune system diseases and the like.
- the invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) human hexokinase protein 11.
- Agonists enhance human hexokinase protein 11 to stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
- mammalian cells or a membrane preparation expressing human hexokinase protein 11 can be cultured with labeled human hexokinase protein 11 in the presence of a drug. The ability of the drug to increase or block this interaction is then determined.
- Antagonists of human hexokinase protein 11 include antibodies, compounds, receptor deletions, and the like that have been screened. Antagonists of human hexokinase protein 11 can bind to human hexokinase protein 11 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot perform biological functions.
- human hexokinase protein 11 When screening compounds as antagonists, human hexokinase protein 11 can be added to bioanalytical assays to determine whether a compound is an antagonist by measuring the effect of the compound on the interaction between human hexokinase protein 11 and its receptor . Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds.
- a polypeptide molecule capable of binding to human hexokinase protein 11 may It is obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. In screening, the human hexokinase protein 11 molecule should generally be labeled.
- the present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies.
- the invention also provides antibodies directed against the human hexokinase protein 11 epitope. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments generated from Fab expression libraries.
- Polyclonal antibodies can be produced by injecting human hexokinase protein 11 directly into immunized animals (such as rabbits, mice, rats, etc.). Various adjuvants can be used to enhance the immune response, including but not limited to Freund's adjuvant. Wait. Techniques for preparing monoclonal antibodies to human hexokinase protein 11 include, but are not limited to, hybridoma technology (Kohler and Mistein. Nature, 1975, 256: 495-497), triple tumor technology, human beta cell hybridoma technology, EBV-hybridoma technology, etc.
- Chimeric antibodies that bind human constant regions to non-human variable regions can be produced using existing techniques (Morri son et al, PNAS, 1985, 81: 6851).
- the existing technology for producing single chain antibodies U.S. Pat No. 4946778, can also be used to produce single chain antibodies against human hexokinase 11.
- Antibodies against human hexokinase protein 11 can be used in immunohistochemical techniques to detect human hexokinase protein 11 in biopsy specimens.
- Monoclonal antibodies that bind to human hexokinase protein 11 can also be labeled with radioisotopes and injected into the body to track their location and distribution.
- This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
- Antibodies can also be used to design immunotoxins that target a particular part of the body.
- human hexokinase protein 11 high affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
- a common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
- This hybrid antibody can be used to kill human hexokinase 11-positive cells .
- the antibodies of the present invention can be used to treat or prevent diseases related to human hexokinase protein 11.
- Administration of an appropriate dose of the antibody can stimulate or block the production or activity of human hexokinase protein 11.
- the invention also relates to a diagnostic test method for quantitative and localized detection of human hexokinase protein 11 levels. These tests are well known in the art and include FISH assays and radioimmunoassays. The level of human hexokinase protein 11 detected in the test can be used to explain the importance of human hexokinase protein 11 in various diseases and to diagnose diseases in which human hexokinase protein 11 functions.
- polypeptides of the present invention can also be used for peptide mapping, for example, the polypeptides can be physically, chemically or enzymatically Specific cleavage and one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, preferably mass spectrometry.
- Polynucleotides encoding human hexokinase protein 11 can also be used for a variety of therapeutic purposes. Gene therapy techniques can be used to treat abnormal cell proliferation, development, or metabolism caused by the non-expression or abnormal / inactive expression of human hexokinase protein 11.
- Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated human hexokinase protein 11 to inhibit endogenous human hexokinase protein 11 activity.
- a mutated human hexokinase protein 11 may be a shortened human hexokinase protein 11 that lacks a signaling domain. Although it can bind to downstream substrates, it lacks signaling activity.
- recombinant gene therapy vectors can be used to treat diseases caused by abnormal expression or activity of human hexokinase protein 11.
- Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to transfer a polynucleotide encoding human hexokinase protein 11 into a cell.
- Methods for constructing recombinant viral vectors carrying a polynucleotide encoding human hexokinase protein 11 can be found in the existing literature (Sambrook, et al.).
- a recombinant polynucleotide encoding human hexokinase protein 11 can be packaged into liposomes and transferred into cells.
- Methods for introducing a polynucleotide into a tissue or cell include: injecting the polynucleotide directly into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
- a vector such as a virus, phage, or plasmid
- Oligonucleotides including antisense RNA and DNA
- ribozymes that inhibit human hexokinase protein 11 mRNA are also within the scope of the present invention.
- a ribozyme is an enzyme-like RNA molecule that can specifically decompose specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation.
- Antisense RNA, DNA, and ribozymes can be obtained using any existing RNA or DNA synthesis technology, such as solid-phase phosphoramidite chemical synthesis to synthesize oligonucleotides.
- Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA. This DM sequence has been integrated downstream of the RM polymerase promoter of the vector. In order to increase the stability of the nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the linkage between ribonucleosides using phosphorothioate or peptide bonds instead of phosphodiester bonds.
- the polynucleotide encoding human hexokinase protein 11 can be used for the diagnosis of diseases related to human hexokinase protein 11.
- the polynucleotide encoding human hexokinase protein 11 can be used to detect the expression of human hexokinase protein 11 or the abnormal expression of human hexokinase protein 11 in a disease state.
- a DNA sequence encoding human hexokinase protein 11 can be used to hybridize biopsy specimens to determine the expression of human hexokinase protein 11.
- Hybridization techniques include Southern blotting, Northern blotting, and in situ hybridization. These techniques and methods are publicly available and mature, and related kits are commercially available.
- the hair Some or all of the polynucleotides can be used as probes to be fixed on a microarray or a DNA chip (also known as a "gene chip") to analyze differential expression analysis of genes and genetic diagnosis in tissues.
- Human hexokinase protein 11 specific primers can also be used to detect the transcription products of human hexokinase protein 11 by RNA-polymerase chain reaction (RT-PCR) in vitro amplification.
- RT-PCR RNA-polymerase chain reaction
- Detection of mutations in the human hexokinase protein 11 gene can also be used to diagnose human hexokinase protein 11-related diseases.
- Human hexokinase 11 mutant forms include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type human hexokinase 11 DM sequence. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression. Therefore, Northern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
- sequences of the invention are also valuable for chromosome identification. This sequence will specifically target a specific position on a human chromosome and can hybridize to it. Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for marking chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DNA sequences on a chromosome.
- PCR primers (preferably 15-35bp) are prepared based on cDNA, and the sequences can be located on chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
- PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
- oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
- Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.
- Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step.
- FISH Fluorescent in situ hybridization
- the differences in cDNA or genomic sequences between the affected and unaffected individuals need to be determined. If at A mutation is observed in some or all of the affected individuals, and the mutation is not observed in any normal individuals, then the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in the chromosome, such as deletions or translocations that are visible at the chromosomal level or detectable using cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).
- the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
- suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
- the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
- the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
- a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
- these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell.
- the polypeptides of the invention can be used in combination with other therapeutic compounds.
- the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
- Human hexokinase protein 11 is administered in an amount effective to treat and / or prevent a specific indication.
- the amount and dose range of human hexokinase protein 11 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician. Examples
- Total human fetal brain RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform.
- Poly (A) mRNA was isolated from total RNA using Quik mRNA Isolat ion Kit (product of Qiegene). 2ug poly (A) mRNA is reverse transcribed to form cDNA.
- a Smart cDNA cloning kit (purchased from Clontech) was used to insert the cDM fragment into the multicloning site of the pBSK (+) vector (Clontech) to transform DHS ct. The bacteria formed a cDNA library.
- Dye terminate cycle react ion sequencing kit Perkin-Elmer
- ABI 377 An automatic sequencer (Perkin-Elmer) determined the sequences at the 5 'and 3' ends of all clones. The determined cDNA sequence was compared with the existing public D sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 0322e01 was new DNA. A series of primers were synthesized to determine the inserted cDNA fragments of the clone in both directions.
- CDNA was synthesized using fetal brain cell total RNA as a template and ol igo-dT as a primer for reverse transcription reaction. After purification with Qiagene's kit, the following primers were used for PCR amplification:
- Primerl 5, — GGTGAGAAACCCTATGAATGTAAG -3, (SEQ ID NO: 3)
- Primer2 5'- TGTTGACAAGGGATATTTTAATAG -3 '(SEQ ID NO: 4)
- Primerl is a forward sequence located at the 5th end of SEQ ID NO: 1, starting at lbp;
- Primer2 is the 3, terminal reverse sequence of SEQ ID NO: 1.
- Conditions for the amplification reaction 50 mmol / L KCl, 10 mmol / L Tri s-HCl pH 8.5, 1. 5 ramol / L MgCl 2 , 200 mol / L dNTP, 1 Opmol primer, 1U Taq DM polymerase (Clontech).
- the reaction was performed on a PE9600 DM thermal cycler (Perkin-Elmer) for 25 cycles under the following conditions: 94. C 30sec; 55. C 30sec; 72 ° C 2min.
- ⁇ -act in was set as a positive control and template blank was set as a negative control.
- the amplified product was purified using a QIAGEN kit and ligated to a PCR vector (Invitrogen product) using a TA cloning kit.
- the DNA sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as 1-1484bp shown in SEQ ID NO: 1.
- RNA 20 ⁇ ⁇ RNA was performed on a 1.2% agarose gel containing 20 mM 3- (N-morpholino) propanesulfonic acid (pH 7.0 )-5 mM sodium acetate-lmM EDTA-2. 2 M formaldehyde Electrophoresis. It was then transferred to a nitrocellulose membrane. A- 32 P dATP was used to prepare a 32 P-labeled D probe by a random primer method. The D probe used is the sequence of the human hexokinase protein 11 coding region amplified by PCR shown in FIG. 1 (709bp to 1484bp).
- the 32P-labeled probe (about 2 x 10 s cpm / ml) was hybridized with a nitrocellulose membrane to which RNA was transferred at 42 ° C overnight in a solution containing 50% amidamide-25mM KH 2 P0 4 (pH7. 4) -5 x SSC- 5 x Denhardt's solution and 200 ⁇ ⁇ / ⁇ 1 salmon sperm DNA. After hybridization, the filter was washed in 1 x SSC-0.1% SDS at 55 ° C for 30 min. Then, Phosphor Imager was used for analysis and quantification.
- Example 4 In vitro expression, isolation and purification of recombinant human hexokinase protein 11
- Primer3 5'-CATGCTAGCATGCAGACTGTCATGGGTGGGGAA-3 '(Seq ID No: 5)
- Primer4 5' -CATGGATCCTCAACACATATAATCAAAGATAA-3 '(Seq ID No: 6)
- These two primers contain Nhel and BamHI restriction sites, respectively.
- the coding sequences of the 5 ,, and 3 'ends of the gene of interest are respectively followed by the Nhel and BamHI restriction sites corresponding to those on the expression vector plasmid pET- 2 8b (+) (Novagen, Cat. No. 69865. 3) Selective endonuclease site.
- the PCR reaction was performed using the pBS-0322e01 plasmid containing the full-length target gene as a template.
- the PCR reaction conditions were as follows: 10 pg of pBS-0322e01 plasmid was contained in a total volume of 50 ⁇ 1, and primers Primer-3 and Primer-4 were lOpmol and Advantage polymerase Mix (Clontech) 1 ⁇ 1, respectively. Cycle parameters: 94 ° C 20s, 60 ° C 30s, 68 ° C 2 min, a total of 25 cycles. Nhel and BamHI were used to double digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase.
- the ligation product was transformed into coliform bacteria DH5 cx by the calcium chloride method. After being cultured overnight on LB plates containing kanamycin (final concentration 3 ( ⁇ g / ml)), positive colonies were screened by colony PCR method and sequenced. Positive sequence correct clone (pET-0322e01) was used to transform the recombinant plasmid into E. coli BL21 (DE3) plySs (product of Novagen) by calcium chloride method.
- the following peptides specific for human hexokinase protein 11 were synthesized using a peptide synthesizer (product of PE Company): NH2-Met-Gln-Thr-Val-Met-Gl.y-Gly-Glu-Cys-Ser-Leu-Met -Leu-Asn-Ser-0H (SEQ ID NO: 7).
- the polypeptide is coupled with hemocyanin and bovine serum albumin to form a complex, respectively.
- Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
- the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
- the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
- the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method.
- Filter hybridization methods include dot blotting, Southern imprinting, Northern blotting, and copying methods. They all use the same steps to immobilize the polynucleotide sample to be tested on the filter.
- the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer to saturate the non-specific binding site of the sample on the filter with the carrier and the synthesized polymer.
- the pre-hybridization solution is then replaced with a hybridization buffer containing labeled probes and incubated to hybridize the probes to the target nucleic acid.
- the unhybridized probes are removed by a series of membrane washing steps.
- This embodiment uses higher-intensity washing conditions (such as lower salt concentration and higher temperature), so that the hybridization background is reduced and only strong specific signals are retained.
- the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
- the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
- the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
- oligonucleotide fragments from the polynucleotide SEQ ID NO: 1 of the present invention for use as hybridization probes should follow the following principles and several aspects to be considered:
- the preferred size of the probe ranges from 18 to 50 nucleotides; 2, GC content is 30% -70%, non-specific hybridization increases when it exceeds;
- Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements For homology comparison of the regions, if the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, the primary probe should not be used generally;
- Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
- Probe 2 which belongs to the second type of probe, is equivalent to the replacement mutation sequence (face) of the gene fragment or its complementary fragment of SEQ ID NO: 1:
- PBS phosphate buffered saline
- step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
- NC membranes nitrocellulose membranes
- Two NC membranes are required for each probe, so as to be used in the following experimental steps.
- the film was washed with high-strength conditions and strength conditions, respectively.
- the sample membrane was placed in a plastic bag, and 3-10fflg of prehybridization solution (lOxDenhardt's; 6xSSC, 0.1 mg / ml CT DM (calf thymus DNA)) was added. After closing the bag, 68. C. Water shake for 2 hours.
- prehybridization solution lOxDenhardt's; 6xSSC, 0.1 mg / ml CT DM (calf thymus DNA)
- Gene chip or gene microarray is a new technology currently being developed by many national laboratories and large pharmaceutical companies. It refers to the orderly and high-density arrangement of a large number of target gene fragments on glass, The data is compared and analyzed on a carrier such as silicon by fluorescence, detection, and computer software, so as to achieve the purpose of analyzing biological information quickly, efficiently, and high-throughput.
- the polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research of new gene functions; search for and screen new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases . The specific method steps have been reported in the literature.
- a total of 4,000 polynucleotide sequences of various full-length cDNAs are used as the target DM, including the polynucleotide of the present invention. They were respectively amplified by PCR. After purification, the concentration of the amplified product was adjusted to about 500 ng / ul, and spotted on a glass medium with a Cartesian 7500 spotter (purchased from Cartesian Company, USA). The distance is 280pm. The spotted slides were hydrated, dried, and cross-linked in a UV cross-linker. After elution, the slides were fixed to prepare DNA on a glass slide to prepare a chip. The specific method steps have been reported in the literature. The sample post-processing steps in this embodiment are:
- the probes from the above two tissues and the chip were respectively hybridized in a UniHyb TM Hybridizat ion Solut ion (purchased from TeleChem) hybridization solution for 16 hours, and washed with a washing solution (lx SSC, 0.2% SDS) at room temperature Scanning was performed with a ScanArray 3000 scanner (purchased from General Scanning, USA), and the scanned images were analyzed by Lnagene software (Biodi scovery, USA) to calculate the Cy3 / Cy5 ratio of each point.
- the above specific tissues are thymus, testis, muscle, spleen, lung, skin, thyroid, liver, PMA + Ecv304 cell line, PMA-Ecv304 cell line, non-starved L02 cell line, L02 cell line stimulated by arsenic for 1 hour, L02 cell line stimulated by arsenic for 6 hours prostate, heart, lung cancer, fetal bladder, fetal small intestine, fetal large intestine, fetal thymus, fetal muscle, fetal liver, fetal kidney, fetal spleen, fetal brain, Fetal lung and fetal heart.
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Biotechnology (AREA)
- Biomedical Technology (AREA)
- Medicinal Chemistry (AREA)
- Peptides Or Proteins (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
AU76241/01A AU7624101A (en) | 2000-05-16 | 2001-05-14 | Novel polypeptide--- a human hexokinase protein and polynucleotide encoding it |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN 00115734 CN1323837A (zh) | 2000-05-16 | 2000-05-16 | 一种新的多肽——人已糖激酶蛋白11和编码这种多肽的多核苷酸 |
CN00115734.5 | 2000-05-16 |
Publications (1)
Publication Number | Publication Date |
---|---|
WO2001090378A1 true WO2001090378A1 (fr) | 2001-11-29 |
Family
ID=4585178
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/CN2001/000775 WO2001090378A1 (fr) | 2000-05-16 | 2001-05-14 | Nouveau polypeptide, proteine humaine hexokinase 11, et polynucleotide codant ce polypeptide |
Country Status (3)
Country | Link |
---|---|
CN (1) | CN1323837A (fr) |
AU (1) | AU7624101A (fr) |
WO (1) | WO2001090378A1 (fr) |
Cited By (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US7153666B2 (en) | 2003-07-17 | 2006-12-26 | General Atomics | Methods and compositions for determination of glycated proteins |
US7855079B2 (en) | 2006-07-25 | 2010-12-21 | General Atomics | Methods for assaying percentage of glycated hemoglobin |
US7943385B2 (en) | 2006-07-25 | 2011-05-17 | General Atomics | Methods for assaying percentage of glycated hemoglobin |
Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
JPH10215878A (ja) * | 1997-02-07 | 1998-08-18 | Toyobo Co Ltd | 新規なヘキソキナーゼ |
-
2000
- 2000-05-16 CN CN 00115734 patent/CN1323837A/zh active Pending
-
2001
- 2001-05-14 WO PCT/CN2001/000775 patent/WO2001090378A1/fr active Application Filing
- 2001-05-14 AU AU76241/01A patent/AU7624101A/en not_active Abandoned
Patent Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
JPH10215878A (ja) * | 1997-02-07 | 1998-08-18 | Toyobo Co Ltd | 新規なヘキソキナーゼ |
Cited By (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US7153666B2 (en) | 2003-07-17 | 2006-12-26 | General Atomics | Methods and compositions for determination of glycated proteins |
US7855079B2 (en) | 2006-07-25 | 2010-12-21 | General Atomics | Methods for assaying percentage of glycated hemoglobin |
US7943385B2 (en) | 2006-07-25 | 2011-05-17 | General Atomics | Methods for assaying percentage of glycated hemoglobin |
Also Published As
Publication number | Publication date |
---|---|
CN1323837A (zh) | 2001-11-28 |
AU7624101A (en) | 2001-12-03 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
WO2001090378A1 (fr) | Nouveau polypeptide, proteine humaine hexokinase 11, et polynucleotide codant ce polypeptide | |
WO2002020795A1 (fr) | Nouveau polypeptide, hexokinase proteine 9.68, et polynucleotide codant ce polypeptide | |
WO2001068694A1 (fr) | Nouveau polypeptide, proteine humaine d'hexokinase 10, et polynucleotide codant pour ce polypeptide | |
WO2001094529A2 (fr) | Nouveau polypeptide, serine hydrolase humaine atp-dependante 21, et polynucleotide codant pour ce polypeptide | |
WO2001090376A1 (fr) | Nouveau polypeptide, triose phosphate isomerase humaine 11, et polynucleotide codant ce polypeptide | |
WO2001092541A1 (fr) | Nouveau polypeptide, catalase 12, et polynucleotide codant ce polypeptide | |
WO2001074876A1 (fr) | Nouveau polypeptide, phosphatidylinositol-3 kinase humaine 14, et polynucleotide codant pour ce polypeptide | |
WO2001088158A1 (fr) | Nouveau polypeptide, triose phosphate isomerase humaine 10, et polynucleotide codant pour ce polypeptide | |
WO2001072793A1 (fr) | Nouveau polypeptide, proteine humaine de regulation 12 de la proteine hydrolase, et polynucleotide codant pour ce polypeptide | |
WO2001075085A1 (fr) | Nouveau polypeptide, serine hydrolase humaine atp-dependante 11.3, et polynucleotide codant pour ce polypeptide | |
WO2001087943A1 (fr) | Protease a serine 13 atp-dependante, polypeptide humain, et polynucleotide le codant | |
WO2001072791A1 (fr) | Nouveau polypeptide, triose phosphate isomerase humaine 11, et polynucleotide codant pour ce polypeptide | |
WO2001085923A1 (fr) | Nouveau polypeptide, serine hydrolase humaine atp-dependante 9.2, et polynucleotide codant pour ce polypeptide | |
WO2001094371A1 (fr) | Nouveau polypeptide, proteine ribosomale humaine s4-10, et polynucleotide codant ce polypeptide | |
WO2001073063A1 (fr) | Nouveau polypeptide, proteine humaine hexokinase 13, et polynucleotide codant pour ce polypeptide | |
WO2001072810A1 (fr) | Nouveau polypeptide, proteine humaine 12 de la famille des amidases, et polynucleotide codant pour ce polypeptide | |
WO2001083681A2 (fr) | Nouveau polypeptide, dihydroorotase humaine 21, et polynucleotide codant pour ce polypeptide | |
WO2001075037A2 (fr) | Nouveau polypeptide, dihydroorotase humaine 40, et polynucleotide codant pour ce polypeptide | |
WO2001073065A1 (fr) | Nouveau polypeptide, glycinamide ribonucleotide synthetase humaine 12, et polynucleotide codant pour ce polypeptide | |
WO2001090171A1 (fr) | Nouveau polypeptide, proteine humaine ribosomale sii 12, et polynucleotide codant ce polypeptide | |
WO2001073054A1 (fr) | Nouveau polypeptide, dihydroorotase humaine 11, et polynucleotide codant pour ce polypeptide | |
WO2001079508A1 (fr) | Nouveau polypeptide, proteine porteuse mitochondriale humaine 18, et polynucleotide codant pour ce polypeptide | |
WO2001047994A1 (fr) | Nouveau polypeptide, proteine 10 utilisant pep, et polynucleotide codant pour ce polypeptide | |
WO2001047984A1 (fr) | Nouveau polypeptide, proteine 10 de la famille des amidases, et polynucleotide codant pour ce polypeptide | |
WO2001047998A1 (fr) | Nouveau polypeptide, proteine activant la ras gtpase 12, et polynucleotide codant pour ce polypeptide |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A1 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
122 | Ep: pct application non-entry in european phase | ||
NENP | Non-entry into the national phase |
Ref country code: JP |