WO2001088158A1 - Nouveau polypeptide, triose phosphate isomerase humaine 10, et polynucleotide codant pour ce polypeptide - Google Patents

Nouveau polypeptide, triose phosphate isomerase humaine 10, et polynucleotide codant pour ce polypeptide Download PDF

Info

Publication number
WO2001088158A1
WO2001088158A1 PCT/CN2001/000721 CN0100721W WO0188158A1 WO 2001088158 A1 WO2001088158 A1 WO 2001088158A1 CN 0100721 W CN0100721 W CN 0100721W WO 0188158 A1 WO0188158 A1 WO 0188158A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
polynucleotide
phosphate isomerase
triose phosphate
human triose
Prior art date
Application number
PCT/CN2001/000721
Other languages
English (en)
Chinese (zh)
Inventor
Yumin Mao
Yi Xie
Original Assignee
Shanghai Biowindow Gene Development Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shanghai Biowindow Gene Development Inc. filed Critical Shanghai Biowindow Gene Development Inc.
Priority to AU72301/01A priority Critical patent/AU7230101A/en
Publication of WO2001088158A1 publication Critical patent/WO2001088158A1/fr

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/90Isomerases (5.)
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides

Definitions

  • the present invention belongs to the field of biotechnology. Specifically, the present invention describes a new polypeptide ⁇ ⁇ -triose phosphate isomerase 10, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and the polypeptide. , technical background
  • the catabolism of glucose is the main way for the organism to obtain energy.
  • Glycolysis is the main metabolic process of the organism to break down glucose to obtain energy and ATP. Whether it is an anaerobic or aerobic organism, almost every living cell can perform glycolysis.
  • the glycolysis process involves many different enzymes, such as phosphofructokinase, triose phosphate isomerase, glyceraldehyde-3-phosphate dehydrogenase, etc.
  • the abnormal expression of these enzymes will affect the normal glycolysis process Progress, resulting in abnormal energy metabolism pathways of the organism.
  • These intermediate regulators are usually closely related to the occurrence of some disorders of glucose metabolism and the metabolism of various substances in the organism.
  • Triose phosphate isomerase (TIM) enzyme is an important glycolytic enzyme that catalyzes the reversible conversion between glyceraldehyde 3-phosphate and dihydroxyacetone phosphate in the body. TIM plays a very important role in many metabolic pathways, which is necessary for the energy production of metabolic reactions in organisms.
  • triose phosphate isomerase active center fragments contain a consensus sequence fragment as shown below: [AV] -YEP- [LIVM] -W- [SA] -IGT- [GK] (where E Is the amino acid residue at the active site); this sequence motif is an important center of the triose phosphate isomerase catalyzing the glycolysis pathway, and mutations in this motif will directly affect the abnormality of the glycolysis process of the organism.
  • the overexpression of this enzyme will lead to the ineffective loss of energy in the living body; and its low expression level will affect the normal supply of energy in the organism, and thus affect various related metabolic pathways. Therefore, the enzyme reversibly maintains the balance of various energy metabolisms in the body by regulating the glycolysis process in the body.
  • the expression of this enzyme in the organism is usually closely related to the occurrence of various diseases such as glucose metabolism disorder and substance metabolism disorder in the organism.
  • the human triose phosphate isomerase 10 protein plays an important role in regulating important functions of the body such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes, so there has been a need to identify more participants in this field. These processes of the human triose phosphate isomerase 10 protein, in particular, identify the amino acid sequence of this protein. Isolation of the novel triose phosphate isomerase 10 protein encoding gene also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so it is important to isolate its coding for DM. Object of the invention
  • An object of the present invention is to provide an isolated novel polypeptide, human triose phosphate isomerase 10, and fragments, analogs and derivatives thereof.
  • Another object of the invention is to provide a polynucleotide encoding the polypeptide.
  • Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding human triose phosphate isomerase 10.
  • Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding human triose phosphate isomerase.10.
  • Another object of the present invention is to provide a method for producing human triose phosphate isomerase 10.
  • Another object of the present invention is to provide an antibody against the polypeptide of the present invention, human triose phosphate isomerase 10.
  • Another object of the present invention is to provide mimetic compounds, antagonists, agonists, and inhibitors directed to the polypeptide of the present invention, human triose phosphate isomerase 10.
  • Another object of the present invention is to provide a method for diagnosing and treating diseases associated with abnormalities of human triose phosphate isomerase 10. Summary of invention
  • the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
  • the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the present invention also relates to an isolated polynucleotide, which comprises a nucleotide sequence or a variant thereof selected from the group-.
  • sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 925 to 1177 in SEQ ID NO: 1; and (b) a sequence having 1-1577 in SEQ ID NO: 1 Sequence of bits.
  • the present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
  • the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
  • the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of human triose phosphate isomerase 10 protein, which comprises using the polypeptide of the invention.
  • the invention also relates to compounds obtained by this method.
  • the present invention also relates to a method for in vitro detection of a disease or susceptibility to disease associated with abnormal expression of human triose phosphate isomerase 10 protein, comprising detecting a mutation in the polypeptide or a sequence encoding a polynucleotide thereof in a biological sample, or Detection of the amount or biological activity of a polypeptide of the invention in a biological sample.
  • the invention also relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
  • the present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention in the preparation of a medicament for treating cancer, developmental disease or immune disease or other diseases caused by abnormal expression of human triose phosphate isomerase 10.
  • FIG. 1 is a comparison diagram of gene chip expression profiles of human triose phosphate isomerase 10 and human triose phosphate isomerase 9 of the present invention.
  • the upper graph is a graph of the expression profile of human triose phosphate isomerase 10
  • the lower graph is the graph of the expression profile of human triose phosphate isomerase 9.
  • 1 indicates fetal kidney
  • 2 indicates fetal large intestine
  • 3 indicates fetal small intestine
  • 4 indicates fetal muscle
  • 5 indicates fetal brain
  • 6 indicates fetal bladder
  • 7 indicates unstarved L02
  • 8 indicates L02 +, lhr, As 3+ , 9 * ECV304 PMA-, 10 ECV304 PMA +, 11 fetal liver, 12 normal liver, 13 thyroid, 14 skin, 15 fetal lung, 16 lung, 17 lung cancer, 18 fetal spleen, 19 spleen
  • 20 is the prostate
  • 21 is the fetal heart
  • 22 is the heart
  • 23 is the muscle
  • 24 is the testis
  • 25 is the fetal thymus
  • 26 is the thymus.
  • FIG. 2 is a polyacrylamide gel electrophoresis diagram (SDS-PAGE) of isolated human triose phosphate isomerase 10.
  • OkDa is the molecular weight of the protein.
  • the arrow indicates the isolated protein band.
  • Nucleic acid sequence refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
  • amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
  • amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
  • a protein or polynucleotide “variant” refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it. The changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence. Variants can have "conservative" changes in which the substituted amino acid has a structural or chemical property similar to the original amino acid, such as the replacement of isoleucine with leucine. Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
  • “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
  • Insertion means that a change in the amino acid sequence or nucleotide sequence results in an increase in one or more amino acids or nucleotides compared to a molecule that exists in nature.
  • Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
  • Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
  • immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response and to bind specific antibodies in a suitable animal or cell.
  • An "agonist” refers to a molecule that, when combined with human triose phosphate isomerase 10, causes the protein to change, thereby regulating the activity of the protein.
  • An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that can bind human triose phosphate isomerase 10.
  • Antagonist refers to a molecule that, when combined with human triose phosphate isomerase 10, can block or regulate the biological or immunological activity of human triose phosphate isomerase 10.
  • Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates, or any other molecule that binds human triose phosphate isomerase 10.
  • Regular refers to a change in the function of human triose phosphate isomerase 10, including an increase or decrease in protein activity, a change in binding characteristics, and any other biological properties, functions, or immunity of human triose phosphate isomerase 10. Change of nature.
  • Substantially pure ' means substantially free of other proteins, lipids, carbohydrates, or other substances with which it is naturally associated.
  • Those skilled in the art can purify human triose phosphate isoxidase 10 using standard protein purification techniques.
  • Substantially pure human triose phosphate isomerase 10 produces a single main band on a non-reducing polyacrylamide gel.
  • the purity of human triose phosphate isomerase 10 polypeptide can be analyzed by amino acid sequence.
  • Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
  • sequence C-T-G-A
  • complementary sequence G-A-C-T
  • the complementarity between two single-stranded molecules can be partial or complete.
  • the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
  • “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
  • Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Southern or Northern blotting, etc.) under conditions of reduced stringency. Substantially homologous sequences or hybridization probes can compete and inhibit the binding of completely homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.
  • Percent identity refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALIGN program (Lasergene sof tware package, DNASTAR, Inc., Madison Wis.). The MEGALIGN program can compare two or more sequences according to different methods such as the Clus ter method (Higgins, DG and PM Sharp (1988) Gene 73: 237-244). 0 The Cluster method divides each group of sequences by checking the distance between all pairs. Arranged in clusters. The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula:
  • the number of residues in sequence ⁇ the number of spacer residues in sequence ⁇ -the number of spacer residues X 'in sequence S can also be determined by the Clus ter method or using methods known in the art such as Jotun Hein. Hein J., (1990) Methods in enzymology 183: 625-645).
  • Similarity refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
  • Amino acids used for conservative substitution for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
  • Antisense refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence.
  • the "antisense strand” refers to a nucleic acid strand that is complementary to the “sense strand”.
  • Derivative refers to HFP or a chemical modification of its nucleic acid. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
  • Antibody refers to a complete antibody molecule and its fragments, such as Fa, F (ab ') 2 and Fv, which are specific Epitope that binds human triose phosphate isomerase 10.
  • a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
  • isolated refers to the removal of matter from its original environment (for example, its natural environment if it is naturally occurring).
  • a naturally occurring polynucleotide or polypeptide is not isolated when it is present in a living animal, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist in the natural system.
  • Such a polynucleotide may be part of a vector, or such a polynucleotide or polypeptide may be part of a composition. Since the carrier or composition is not part of its natural environment, they are still isolated.
  • isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
  • polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances in the natural state .
  • isolated human triose phosphate isomerase 10 means that human triose phosphate isomerase 10 is substantially free of other proteins, lipids, sugars, or other substances with which it is naturally associated. Those skilled in the art can purify human triose phosphate isomerase 10 using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of the human triose phosphate isomerase 10 peptide can be analyzed by amino acid sequence.
  • the present invention provides a new polypeptide, human triose phosphate isomerase 10, which is basically composed of the amino acid sequence shown in SEQ ID NO: 2.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
  • the polypeptides of the invention can be naturally purified products, or chemically synthesized products, or produced using recombinant techniques from prokaryotic or eukaryotic hosts (e.g., bacteria, yeast, higher plants, insects, and mammalian cells). Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
  • the invention also includes fragments, derivatives and analogs of human triose phosphate isomerase 10.
  • fragment refers to a polypeptide that substantially maintains the same biological function or activity of the human triose phosphate isomerase 10 of the present invention.
  • a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution
  • the amino acid may or may not be encoded by a genetic codon; or ( ⁇ ) such a type in which one or more amino acid residues are substituted with other groups to include a substituent; or (III) such One, in which the mature polypeptide is fused to another compound (such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol); or (IV) such a polypeptide sequence in which the additional amino acid sequence is fused into the mature polypeptide ( Such as leader sequences or secreted sequences or sequences used to purify this polypeptide or protease sequences).
  • such fragments, derivatives and analogs are considered to be within the knowledge of those skilled in the art.
  • the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
  • the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a polynucleotide sequence of 1577 bases in length and its open reading frame 905-1177 encodes 90 amino acids.
  • this polypeptide has a similar expression profile to human triose phosphate isomerase 9, and it can be deduced that the human triose phosphate isomerase 10 has a similar function to human triose phosphate isomerase 9.
  • the polynucleotide of the present invention may be in the form of DNA or RM.
  • DM forms include cDNA, genomic DNA, or synthetic DNA.
  • DNA can be single-stranded or double-stranded.
  • DM can be coded or non-coded.
  • the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
  • a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
  • the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the mature polypeptide coding sequence; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences) and non-coding sequence.
  • polynucleotide encoding a polypeptide refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.
  • the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
  • Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
  • an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
  • the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity between the two sequences).
  • the invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the invention under stringent conditions.
  • "strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60 ° C; or (2) Add a denaturant such as 50y during hybridization. .
  • the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
  • the invention also relates to nucleic acid fragments that hybridize to the sequences described above.
  • nucleic acid fragment contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 cores. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques, such as PCR, to identify and / or isolate polynucleotides encoding human triose phosphate isomerase 10.
  • polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
  • the specific polynucleotide sequence encoding human triose phosphate isomerase 10 of the present invention can be obtained by various methods.
  • polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
  • the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the DM of the genome; 2) chemically synthesizing the MA sequence to obtain the double-stranded DM of the polypeptide.
  • genomic DM is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences.
  • the standard method for isolating the cDNA of interest is to isolate raRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDM library.
  • Various methods have been used to extract mRNA, and kits are also commercially available (Qiagene).
  • the construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manua, Cold Spruing Harbor Laboratory. New York, 1989).
  • Commercially available cDM libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
  • genes of the present invention can be screened from these cDM libraries by conventional methods. These methods include (but are not limited to): (l) DM-DNA or DNA-RNA hybridization; (2) the presence or absence of marker gene functions; (3) determining the level of human triose phosphate isomerase 10 transcripts; (4) Detecting the protein product of gene expression by immunological technology or measuring biological activity. The above methods can be used singly or in combination.
  • the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
  • the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
  • the probe used here is generally a DNA sequence chemically synthesized based on the gene sequence information of the present invention.
  • the genes or fragments of the present invention can of course be used as probes.
  • DM probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
  • immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) can be used to detect the protein product expressed by the human triose phosphate isomerase 10 gene.
  • ELISA enzyme-linked immunosorbent assay
  • a method for amplifying DNA / RNA by PCR is preferably used to obtain the gene of the present invention.
  • the RACE method RACE-cDM terminal rapid amplification method
  • the primers can be appropriately selected based on the polynucleotide sequence information of the present invention disclosed herein, and can be synthesized by conventional methods.
  • the amplified DM / RNA fragment can be isolated and purified by conventional methods such as by gel electrophoresis.
  • polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be measured by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, sequencing needs to be repeated. Sometimes it is necessary to determine the cDM sequence of multiple clones in order to splice into a full-length cDNA sequence.
  • the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using a human triose phosphate isomerase 10 coding sequence, and the recombinant technology to produce the polypeptide of the present invention Methods.
  • a polynucleotide sequence encoding human triose phosphate isomerase 10 can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
  • vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses or other vectors well known in the art.
  • Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors expressed in bacteria (Rosenberg, et al.
  • any plasmid and vector can be used to construct a recombinant expression vector.
  • An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
  • the expression vector also includes a ribosome binding site and a transcription terminator for translation initiation. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription.
  • Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers on the late side of the origin of replication, and adenoviral enhancers.
  • the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture. Fluorescent protein (GFP), or tetracycline or ampicillin resistance for E. coli.
  • a polynucleotide encoding human triose phosphate isomerase 10 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to form a genetically engineered host cell containing the polynucleotide or the recombinant vector.
  • the term "host cell” refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E.
  • coli Streptomyces
  • bacterial cells such as Salmonella typhimurium
  • fungal cells such as yeast
  • plant cells such as fly S2 or Sf 9
  • animal cells such as CH0, COS or Bowes melanoma cells.
  • Transformation of a host cell with a DM sequence according to the present invention or a recombinant vector containing the DNA sequence can be performed by conventional techniques well known to those skilled in the art.
  • the host is a prokaryote, such as E. coli
  • competent cells capable of absorbing D can be harvested after the exponential growth phase and treated with the CaCl 2 method. The steps used are well known in the art. Alternatively, MgCl 2 is used. If necessary, transformation can also be performed by electroporation.
  • the host is a eukaryotic organism, the following DNA transfection methods can be used: co-precipitation method of calcium phosphate, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
  • the polynucleotide sequence of the present invention can be used to express or produce recombinant human triose phosphate isomerase 10 (Science, 1984; 224: 1431). Generally, the following steps are taken:
  • the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
  • a suitable method such as temperature conversion or chemical induction
  • the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell.
  • recombinant proteins can be isolated and purified by various separation methods using their physical, chemical, and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
  • polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection and immune diseases.
  • Glycolysis is the main metabolic process by which an organism breaks down glucose to obtain energy ATP.
  • Many different enzymes are involved in the glycolysis process.
  • Triose phosphate isomerase is an important glycolytic enzyme that catalyzes the reversible conversion between glyceraldehyde-3-phosphate and dihydroxyacetone phosphate in the body. The overexpression of this enzyme will lead to the inefficient loss of energy in the body; while the expression level is too low, it will affect the normal supply of energy in the body, thus affecting various related metabolic pathways.
  • abnormal expression of the specific triose phosphate isomerase mot if will cause abnormal function of the polypeptide containing the triose phosphate isomerase mot if of the present invention, resulting in abnormal energy and material metabolism and related diseases.
  • energy and material metabolism disorders such as energy and material metabolism disorders, growth and development disorders, tumors, etc.
  • human triose phosphate isomerase 10 of the present invention will produce various diseases, especially diseases of energy and material metabolism disorders, growth and development disorders, and tumors. These diseases include, but are not limited to:
  • Energy and material metabolism disorders propionic acidemia, methylmalonic aciduria, isovalerate, combined carboxylase deficiency, glutaric acid type I, metabolic acidosis, metabolic alkalosis , Water poisoning, phenylketonuria, albinism, sulphur-containing amino acid metabolism deficiency, tryptophanemia, amino acid metabolism deficiency disease, glycineemia, glycineuria and glucoglycineuria, oxalateuria, glutamate metabolism Defective disease, metabolic deficiency disease of urea cycle, histidine metabolism deficiency disease, lysine metabolism deficiency disease, mucopolysaccharidosis type I to VII, mucolipid storage disease, Ray-ni syndrome, orotic aciduria, Hyperlipoproteinemia, familial hyperalpha-lipoproteinemia, congenital lactose intolerance, hereditary fructose intolerance, galactose, defective fructose metabolism
  • tumors gastric cancer, liver cancer, lung cancer, esophageal cancer, breast cancer, leukemia, lymphoma, thyroid tumor, uterine fibroids, ovarian tumor, neuroblastoma, astrocytoma, ependymoma, glioblastoma , Colon cancer, malignant histiocytosis, melanoma, sarcoma, adrenal cancer, bladder cancer, bone cancer, osteosarcoma, myeloma, bone marrow cancer, brain cancer, uterine cancer, endometrial cancer, thymic tumor, nasal cavity and sinus tumor , Nasopharyngeal carcinoma, laryngeal carcinoma, tracheal tumors, fibromas, fibrosarcomas, lipomas, liposarcomas, leiomyomas
  • the abnormal expression of human triose phosphate isomerase 10 of the present invention will also produce certain hereditary, hematological and immune system diseases.
  • the invention also provides a method for screening compounds to identify agents that increase (agonist) or suppress (antagonist J human triose phosphate isomerase 10).
  • Agonists enhance biological functions such as human triose phosphate isomerase 10 to stimulate cell proliferation
  • Antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
  • mammalian cells or membrane preparations expressing human triose phosphate isomerase 10 can be labeled with labeled human human C in the presence of drugs.
  • Glycophosphate isomerase 10 is cultured together. The ability of a drug to increase or suppress this interaction is then determined.
  • Antagonists of human triose phosphate isomerase 10 include selected antibodies, compounds, receptor deletions, and the like. Antagonists of human triose phosphate isomerase 10 can bind to human triose phosphate isomerase 10 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot function biological functions.
  • human triose phosphate isomerase 10 When screening compounds as antagonists, human triose phosphate isomerase 10 can be added to the bioanalytical assay, and the compound can be determined by measuring the effect of the compound on the interaction between human triose phosphate isomerase 10 and its receptor Whether it is an antagonist. Receptor deletions and analogs that act as antagonists can be screened in the same way as for screening compounds described above. Polypeptide molecules capable of binding to human triose phosphate isomerase 10 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. When screening, 10 molecules of human triose phosphate isomerase should generally be labeled.
  • the present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies.
  • the invention also provides antibodies against human triose phosphate isomerase 10 epitopes. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments generated from Fab expression libraries.
  • Polyclonal antibodies can be produced by injecting human triose phosphate isomerase 10 directly into immunized animals (such as rabbits, mice, rats, etc.).
  • immunized animals such as rabbits, mice, rats, etc.
  • adjuvants can be used to enhance the immune response, including but not limited to Freund's Adjuvant, etc.
  • Techniques for preparing monoclonal antibodies to human triose phosphate isomerase 10 include, but are not limited to, hybridoma technology (Kohler and Mistein. Nature, 1975, 256: 495-497), triple tumor technology, human beta-cell hybridoma Technology, EBV-hybridoma technology, etc.
  • Embedding antibodies that bind human constant regions to non-human-derived variable regions can be produced using existing techniques (Morri son et al, PNAS, 1985, 81: 6851).
  • the existing technology for producing single chain antibodies U. S. Pat No. 4946778, can also be used to produce single chain antibodies against human triose phosphate isomerase 10.
  • Antibodies to human triose phosphate isomerase 10 can be used in immunohistochemistry to detect human triose phosphate isomerase 10 in biopsy specimens.
  • Monoclonal antibodies that bind to human triose phosphate isomerase 10 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis. . Antibodies can also be used to design immunotoxins that target a particular part of the body. For example, human triose phosphate isomerase 10 high affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
  • a common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
  • This hybrid antibody can be used to kill human triose phosphate isomerase 10 positive Cell.
  • the antibodies of the present invention can be used to treat or prevent diseases related to human triose phosphate isomerase 10. Administration of an appropriate dose of the antibody can stimulate or block the production or activity of human triose phosphate isomerase 10.
  • the invention also relates to a diagnostic test method for quantitative and localized detection of human triose phosphate isomerase 10 levels. These tests are well known in the art and include FISH assays and radioimmunoassays. The level of human triose phosphate isomerase 10 detected in the test can be used to explain the importance of human triose phosphate isomerase 10 in various diseases and to diagnose the role of human triose phosphate isomerase 10 disease.
  • polypeptide of the present invention can also be used for peptide mapping analysis.
  • the polypeptide can be specifically cleaved by physical, chemical or enzyme, and one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis .
  • the polynucleotide encoding human triose phosphate isomerase 10 can also be used for a variety of therapeutic purposes. Gene therapy technology can be used to treat abnormal cell proliferation, development or metabolism caused by the non-expression or abnormal / inactive expression of human triose phosphate isomerase 10.
  • Recombinant gene therapy vectors (such as viral vectors) can be designed to express variant human triose phosphate isomerase 10 to inhibit endogenous human triose phosphate isomerase 10 activity.
  • a mutated human triose phosphate isomerase 10 may be a shortened human triose phosphate isomerase 10 lacking a signaling domain, and although it can bind to downstream substrates, it lacks signaling activity.
  • the recombinant gene therapy vector can be used for treating diseases caused by abnormal expression or activity of human triose phosphate isomerase 10.
  • Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus and the like can be used to transfer a polynucleotide encoding human triose phosphate isomerase 10 into a cell.
  • Methods for constructing recombinant viral vectors carrying a polynucleotide encoding human triose phosphate isomerase 10 can be found in the existing literature (Sarabrook, et al.).
  • a recombinant polynucleotide encoding human triose phosphate isomerase 10 can be packaged into liposomes and transferred into cells.
  • Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
  • a vector such as a virus, phage, or plasmid
  • Oligonucleotides including antisense RM and DM
  • ribozymes that inhibit human triose phosphate isomerase 10 mRNA are also within the scope of the present invention.
  • a ribozyme is an enzyme-like RNA molecule that can specifically decompose specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RM to perform endonucleation.
  • Antisense MA, DNA, and ribozymes can be obtained using any existing RNA or DM synthesis techniques, such as solid-phase phosphate amide chemical synthesis to synthesize oligonucleotides.
  • Antisense RNA molecule The DM sequence was obtained by in vitro or in vivo transcription.
  • This DM sequence has been integrated downstream of the RNA polymerase promoter of the vector.
  • it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the ribonucleoside linkages should use phosphate thioester or peptide bonds instead of phosphodiester bonds.
  • the polynucleotide encoding human triose phosphate isomerase 10 is useful for the diagnosis of diseases related to human triose phosphate isomerase 10.
  • a polynucleotide encoding human triose phosphate isomerase 10 can be used to detect the expression of human triose phosphate isomerase 10 or the abnormal expression of human triose phosphate isomerase 10 in a disease state.
  • the DM sequence encoding human triose phosphate isomerase 10 can be used to hybridize biopsy specimens to determine the expression of human triose phosphate isomerase 10.
  • Hybridization techniques include Southern blotting, Northern blotting, in situ hybridization, and the like.
  • polynucleotides of the present invention can be used as probes to be fixed on a microarray or a DM chip (also known as a "gene chip") for differential expression analysis and gene diagnosis of genes in tissues.
  • a DM chip also known as a "gene chip”
  • Human triose phosphate isomerase 10 specific primers for RNA-polymerase chain reaction (RT-PCR) in vitro amplification can also detect human triose phosphate isomerase 10 transcripts.
  • Detection of mutations in the triose phosphate isomerase 10 gene can also be used to diagnose human triose phosphate isomerase 10-related diseases.
  • Human triose phosphate isomerase 10 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type human triose phosphate isomerase 10 DNA sequence. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect the expression of proteins. Therefore, Nor thern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
  • sequences of the invention are also valuable for chromosome identification. This sequence will specifically target a specific position on a human chromosome and can hybridize to it. Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for marking chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DM sequences on a chromosome.
  • a PCR primer (preferably 15-35bp) is prepared from the cDNA, and the sequence can be located on the chromosome. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
  • PCR localization of somatic hybrid cells is a quick way to localize DM to specific chromosomes.
  • oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
  • Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and hybrid pre-selection to construct chromosome-specific cDM libraries.
  • Fluorescent in situ hybridization (FISH) of cDNA clones with metaphase chromosomes can be refined in one step Perform chromosomal mapping accurately.
  • FISH Fluorescent in situ hybridization
  • the difference in cDNA or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).
  • the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
  • suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
  • the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
  • the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell.
  • the polypeptides of the invention can be used in combination with other therapeutic compounds.
  • the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
  • Human triose phosphate isomerase 10 is administered in an amount effective to treat and / or prevent a specific indication.
  • the amount and range of human triose phosphate isomerase 10 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician. Examples
  • RNA Human fetal brain total RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform.
  • Poly (A) mRNA was isolated from total RM using Quik mRNA Isolat ion Kit (product of Qiegene). 2ug poly (A) mRM forms cDM by reverse transcription.
  • a Smart cDNA cloning kit purchased from Clontech was used to insert the cDNA fragments into the multiple cloning site of the pBSK (+) vector (Clontech) to transform DH5a. The bacteria formed a cMA library.
  • Dye terminate cycle react ion sequencing kit Perkin-Elmer
  • ABI 377 automatic sequencer Perkin-Elmer
  • the determined cDM sequence was compared with the existing public DNA sequence database (Genebank), and it was found that the cDM sequence of one of the clones 0295e01 was a new DM.
  • the inserted cDNA fragments contained in this clone were determined in both directions by synthesizing a series of primers.
  • the results show that the full-length cDM contained in the 0295e01 clone is 1577 ⁇ (as shown by Seq ID N0: l), and there is a 272 from d to 77 ⁇ .
  • the open reading frame (0RF) encodes a new protein (as shown in Seq ID NO: 2).
  • This clone pBS-0295e01 and the protein encoded was human triose phosphate isomerase 10.
  • Example 2 Cloning of a gene encoding human triose phosphate isomerase 10 by RT-PCR
  • CDNA was synthesized using fetal brain total RNA as a template and ol igo-dT as a primer for reverse transcription reaction. After purification with Qiagene's kit, the following primers were used for PCR amplification:
  • Pr imerl 5'- TTGGAGAGAAGAATTTAGGGAGTG -3 '(SEQ ID NO: 3)
  • Pr imer2 5'-GCACGGCTGCGAGAAGACGAAGCT -3 '(SEQ ID NO: 4)
  • Primerl is a forward sequence located at the 5th end of SEQ ID NO: 1, starting at lbp;
  • Pr imer 2 is the 3 'end reverse sequence in SEQ ID NO: 1.
  • Amplification reaction conditions 50 ⁇ l reaction volume containing 50 mraol / L KCl, 10 mmol / L Tri s-HCl pH 8. 5, 1. 5 ramol / L MgCl 2 , 20 ( ⁇ mol / L dNTP, lOpmol primer, 1U Taq DNA polymerase (Clontech).
  • the reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) for 25 cycles under the following conditions: 94.C 30sec; 55 ° C 30sec; 72 ° C 2min.
  • ⁇ -act in was used as a positive control and template blank was used as a negative control.
  • Amplification products were purified using a QIAGEN kit, and TA cloning kit was used to connect to a pCR vector (Invitrogen). DM sequence analysis results It was shown that the DNA sequence of the PCR product was exactly the same as 1-157 7 bp shown in SEQ ID NO: 1.
  • Example 3 Northern blot analysis of human triose phosphate isomerase 10 gene expression
  • RNA extraction in one step [Anal. Biochera 1987, 162, 156-159].
  • This method involves acid guanidinium thiocyanate phenol-chloroform extraction. That is, the tissue is homogenized with 4M guanidine isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1), centrifuge after mixing. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. Will The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water.
  • a 32P-labeled probe (approximately 2 ⁇ 10 6 cpm / ral) and RNA-transferred nitrocellulose membrane were placed in a solution at 42 ° C. C hybridization overnight, the solution contains 50% formamide-25mM KH 2 P0 4 (pH 7.4)-5 x SSC-5 x Denhardt's solution and 20 ( ⁇ g / ml salmon sperm DM. After hybridization, the filter is at 1 x SSC- 0.1 ° / »SDS was washed at 55 ° C for 30 min. Then, Phosphor Imager was used for analysis and quantification.
  • Example 4 In vitro expression, isolation and purification of recombinant human triose phosphate isomerase 10
  • Pr imer 3 5 '-CCCCATATGATGTATAAAG AGTATTTTAAAAGT- 3' (Seq ID No: 5)
  • Primer4 5'-CATGGATCCTCAACATGATTCCATTTGTATAAA-3 '(Seq ID No: 6)
  • the 5' ends of these two primers contain Ndel and BamHI digestion respectively Sites, followed by the coding sequences of the 5 'and 3' ends of the gene of interest, respectively, and the Ndel and BamHI restriction sites correspond to the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865. 3) Selective endonuclease site.
  • the PCR reaction was performed using pBS-0295e01 plasmid containing the full-length target gene as a template.
  • the PCR reaction conditions were as follows: 10 pg of pBS-0295e01 plasmid in a total volume of 50 ⁇ 1, Primer-3 and Primer-4 were lpmol, Advantage polymerase Mix (Clontech) 1 ⁇ 1, respectively. Cycle parameters: 94 ° C 20s, 60 ° C 30s, 68 ° C 2 min, a total of 25 cycles.
  • the amplified product and plasmid pET-28 (+) were double digested with Mel and BamHI, respectively, and large fragments were recovered and ligated with T4 ligase.
  • the ligation product was transformed into the colibacillus DH5 CC using the calcium chloride method. After being cultured overnight on LB plates containing kanamycin (final concentration 30 ⁇ / ⁇ 1), positive clones were selected by colony PCR method and sequenced. A positive clone (pET-0295e01) with the correct sequence was selected, and the recombinant plasmid was transformed into E. coli BL 2 l (DE3) plySs (product of Novagen) using the calcium chloride method. In containing kanamycin (final concentration of 30 ⁇ ⁇ / ⁇ 1) in LB liquid medium, host strain BUI (ET-0295e01) at 37. C.
  • the following peptides specific for human triose phosphate isomerase 10 were synthesized using a peptide synthesizer (product of PE Company): NH2-Met-Tyr-Lys-Glu-Tyr-Phe-Lys-Ser-Glu-His-Pro-Cys -Asn-His-His-C00H (SEQ ID NO: 7).
  • the peptide was coupled with hemocyanin and bovine serum albumin to form a complex. For the method, see: Avrameas, et al.
  • Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
  • the probes can be used to hybridize to the genome or cD library of normal tissues or pathological tissues from different sources to It is identified whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
  • the probe may be used to detect the polynucleotide sequence of the present invention or a homologous polynucleotide thereof listed in normal tissue or pathology Whether the expression in tissue cells is abnormal.
  • the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by using a filter hybridization method.
  • Filter hybridization methods include dot blotting, Southern imprinting, Northern blotting, and copying methods. They all use the same steps to immobilize the polynucleotide sample to be tested on the filter.
  • the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer to saturate the non-specific binding site of the sample on the filter with the carrier and the synthesized polymer.
  • the pre-hybridization solution is then replaced with a hybridization buffer containing labeled probes and incubated to hybridize the probes to the target nucleic acid.
  • the unhybridized probes are removed by a series of membrane washing steps.
  • higher-intensity washing conditions such as lower salt concentration and higher temperature) are used to reduce the background of hybridization and retain only strong specific signals.
  • the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
  • the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
  • the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
  • oligonucleotide fragment selected from the polynucleotide SEQ ID NO: 1 of the present invention for use as a hybridization probe shall be Following the following principles and several aspects to consider:
  • the preferred range of probe size is 18-50 nucleotides
  • GC content is 30% -70%, if it exceeds, non-specific hybridization increases
  • Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements For homology comparison of the regions, if the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, the primary probe should not be used generally;
  • Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
  • Probe 2 which belongs to the second type of probe, is equivalent to the replacement mutation sequence (fiber) of the gene fragment of SEQ ID NO: 1 or its complementary fragment:
  • PBS phosphate buffered saline
  • step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
  • NC membrane nitrocellulose membrane
  • Probes 1 3 ⁇ 1 Probe (0.1OD / ⁇ ), add 2 ⁇ 1 Kinase buffer, 8-10 uCi ⁇ - 32 P-dATP + 2U Kinase to make up to a final volume of 20 ⁇ 1.
  • the sample membrane was placed in a plastic bag, and 3-1 Omg pre-hybridization solution (lOxDenhardt's; 6xSSC, 0.1 mg / ml CT DNA (calf thymus DNA)) was added. After sealing the mouth of the bag, shake at 68 ° C for 2 hours.
  • 3-1 Omg pre-hybridization solution (lOxDenhardt's; 6xSSC, 0.1 mg / ml CT DNA (calf thymus DNA)
  • probe 1 can be used for qualitative and quantitative analysis.
  • the presence and differential expression of the polynucleotide of the present invention in different tissues are analyzed.
  • Gene chip or DNA microarray is a new technology that many national laboratories and large pharmaceutical companies are currently developing and developing. It refers to the orderly and high-density arrangement of a large number of target gene fragments on glass, The data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software to achieve the purpose of fast, efficient, and high-throughput analysis of biological information.
  • the polynucleotide of the present invention can be used as a target DM for gene chip technology for high-throughput research of new gene functions; searching for and screening new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases .
  • the specific method steps have been reported in the literature.
  • a total of 4,000 polynucleotide sequences of various full-length cDNAs are used as target DNA, including the polynucleotide of the present invention. They were respectively amplified by PCR, and the concentration of the amplified product was adjusted to about 500 ng / ul after purification, and spotted on a glass medium with a Cartesian 7500 spotter (purchased from Cartesian Company, USA). The distance between them is 280 ⁇ . The spotted slides were hydrated and dried, cross-linked in a UV cross-linker, and dried after elution to fix the DM on the glass slide to prepare chips. The specific method steps have been reported in the literature. The sample post-processing steps in this embodiment are: '
  • the probes from the above two tissues and the chip were respectively hybridized in a UniHyb TM Hybridizat ion Solut ion (purchased from TeleChem) hybridization solution for 16 hours, and washed with a washing solution (lx SSC, 0.2% SDS) at room temperature. Scanning was performed with a ScanArray 3000 scanner (purchased from General Scanning, USA), and the scanned images were analyzed and processed with Imagene software (Biodiscovery, USA) to calculate the Cy3 / Cy5 ratio of each point.
  • the above specific tissues are thymus, testis, muscle, spleen, lung, skin, thyroid, liver, PMA + Ecv304 cell line, PMA-Ecv304 cell line, non-starved L02 cell line, L02 cell line stimulated by arsenic for 1 hour, L02 cell line stimulated by arsenic for 6 hours prostate, heart, lung cancer, fetal bladder, fetal small intestine, fetal large intestine, fetal thymus, fetal muscle, fetal liver, fetal kidney, fetal spleen, fetal brain, Fetal lung and fetal heart.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

L'invention concerne un nouveau polypeptide, une triose phosphate isomérase humaine 10, et un polynucléotide codant pour ce polypeptide ainsi qu'un procédé d'obtention de ce polypeptide par des techniques recombinantes d'ADN. L'invention concerne en outre les applications de ce polypeptide dans le traitement de maladies, notamment des tumeurs malignes, de l'hémopathie, de l'infection par VIH, de maladies immunitaires et de diverses inflammations. L'invention concerne aussi l'antagoniste agissant contre le polypeptide et son action thérapeutique ainsi que les applications de ce polynucléotide codant pour la triose phosphate isomérase humaine 10.
PCT/CN2001/000721 2000-05-09 2001-05-08 Nouveau polypeptide, triose phosphate isomerase humaine 10, et polynucleotide codant pour ce polypeptide WO2001088158A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU72301/01A AU7230101A (en) 2000-05-09 2001-05-08 A novel polypeptide- human triose-phosphate isomerase 10 and the polynucleotide encoding said polypeptide

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN00115647.0 2000-05-09
CN 00115647 CN1322839A (zh) 2000-05-09 2000-05-09 一种新的多肽——人丙糖磷酸异构酶10和编码这种多肽的多核苷酸

Publications (1)

Publication Number Publication Date
WO2001088158A1 true WO2001088158A1 (fr) 2001-11-22

Family

ID=4585092

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2001/000721 WO2001088158A1 (fr) 2000-05-09 2001-05-08 Nouveau polypeptide, triose phosphate isomerase humaine 10, et polynucleotide codant pour ce polypeptide

Country Status (3)

Country Link
CN (1) CN1322839A (fr)
AU (1) AU7230101A (fr)
WO (1) WO2001088158A1 (fr)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7759068B2 (en) 2002-04-15 2010-07-20 Proteosys Ag Use of substances for treating tumors

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
DATABASE PROTEIN [online] 20 April 2000 (2000-04-20), CHENG J. ET AL., XP002905502, retrieved from GI:68423 accession no. NCBI Database accession no. ISMST *
DATABASE PROTEIN [online] 20 April 2000 (2000-04-20), LU H.S. ET AL., XP002905501, retrieved from GI:2144541 accession no. NCBI Database accession no. ISHUT *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7759068B2 (en) 2002-04-15 2010-07-20 Proteosys Ag Use of substances for treating tumors

Also Published As

Publication number Publication date
CN1322839A (zh) 2001-11-21
AU7230101A (en) 2001-11-26

Similar Documents

Publication Publication Date Title
WO2001072786A1 (fr) Nouveau polypeptide, facteur d'inhibition tumorale 63, et polynucleotide codant pour ce polypeptide
WO2001090378A1 (fr) Nouveau polypeptide, proteine humaine hexokinase 11, et polynucleotide codant ce polypeptide
WO2001068694A1 (fr) Nouveau polypeptide, proteine humaine d'hexokinase 10, et polynucleotide codant pour ce polypeptide
WO2001068689A1 (fr) Nouveau polypeptide, 1alpha sous-unite 13 humaine du facteur adaptatif de l'hypoxie, et polynucleotide codant pour ce polypeptide
WO2001088158A1 (fr) Nouveau polypeptide, triose phosphate isomerase humaine 10, et polynucleotide codant pour ce polypeptide
WO2001083538A1 (fr) Nouveau polypeptide, proteine humaine 36 du gene k-ras, et polynucleotide codant pour ce polypeptide
WO2001088084A2 (fr) Nouveau polypeptide, superoxyde dismutase 11, et polynucleotide codant pour ce polypeptide
WO2001090376A1 (fr) Nouveau polypeptide, triose phosphate isomerase humaine 11, et polynucleotide codant ce polypeptide
WO2001072791A1 (fr) Nouveau polypeptide, triose phosphate isomerase humaine 11, et polynucleotide codant pour ce polypeptide
WO2001092541A1 (fr) Nouveau polypeptide, catalase 12, et polynucleotide codant ce polypeptide
WO2001074870A1 (fr) Nouveau polypeptide, alpha-galactosidase humaine a-11, et polynucleotide codant pour ce polypeptide
WO2001075117A1 (fr) Nouveau polypeptide, tyrosinase humaine 12, et polynucleotide codant pour ce polypeptide
WO2001072980A1 (fr) Nouveau polypeptide, peroxydase humaine 18, et polynucleotide codant pour ce polypeptide
WO2001094401A1 (fr) Nouveau polypeptide, proteine npat humaine 15, et polynucleotide codant pour ce polypeptide
WO2001092326A1 (fr) Nouveau polypeptide, phosphatase acide 13, et polynucleotide codant ce polypeptide
WO2001083676A2 (fr) Nouveau polypeptide, phosphatase humaine 10 fortement striee, et polynucleotide codant pour ce polypeptide
WO2001074880A1 (fr) Nouveau polypeptide, peroxydase proteine humaine 10, et polynucleotide codant pour ce polypeptide
WO2001071001A1 (fr) Nouveau polypeptide, tyrosinase humaine 15, et polynucleotide codant pour ce polypeptide
WO2001072810A1 (fr) Nouveau polypeptide, proteine humaine 12 de la famille des amidases, et polynucleotide codant pour ce polypeptide
WO2001075007A2 (fr) Nouveau polypeptide, tyrosinase 15, et polynucléotide codant pour ce polypeptide
WO2002006473A1 (fr) Nouveau polypeptide, proteine humaine 10.01 associee au recepteur d'oestrogene, et polynucleotide codant ce polypeptide
WO2001049732A1 (fr) Nouveau polypeptide, transglutaminase 10, et polynucleotide codant pour ce polypeptide
WO2001087970A1 (fr) Polypeptide de tyrosinase 12 humaine, et polynucleotide le codant
WO2001087950A1 (fr) Nouveau polypeptide, recepteur cannabinoide humain 11, et polynucleotide codant pour ce polypeptide
WO2001083542A1 (fr) Nouveau polypeptide, proteine humaine p18 21, et polynucleotide codant pour ce polypeptide

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP