WO2001074880A1 - Nouveau polypeptide, peroxydase proteine humaine 10, et polynucleotide codant pour ce polypeptide - Google Patents
Nouveau polypeptide, peroxydase proteine humaine 10, et polynucleotide codant pour ce polypeptide Download PDFInfo
- Publication number
- WO2001074880A1 WO2001074880A1 PCT/CN2001/000411 CN0100411W WO0174880A1 WO 2001074880 A1 WO2001074880 A1 WO 2001074880A1 CN 0100411 W CN0100411 W CN 0100411W WO 0174880 A1 WO0174880 A1 WO 0174880A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- polypeptide
- polynucleotide
- peroxidase protein
- protein
- sequence
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/0004—Oxidoreductases (1.)
- C12N9/0065—Oxidoreductases (1.) acting on hydrogen peroxide as acceptor (1.11)
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
Definitions
- the present invention belongs to the field of biotechnology. Specifically, the present invention describes a novel polypeptide, human peroxidase protein 10, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and the polypeptide.
- Peroxidase is a heme-binding enzyme that performs a series of biosynthesis and degradation by using hydrogen peroxide as an electron acceptor. Peroxidase is widely distributed in bacteria, fungi, plants and spinal impetus. '' The heme prosthetic group of peroxidase is protoporphyrin IX, and the penta ligand of the heme iron atom is the imidazole group of the proximal histidine, and the distal histidine residue is used as the peroxidation reaction. Acid and base catalysts. In most peroxidases, the sequences of these two His and nearby residues are more or less conserved.
- the conserved sequence of peroxidase is: (DET)-(LIVMTA) -X (2)-(LIVM)-(LIVMSTAG)-(SAG)-(LIVMSTAG) -H- (STA)-(LIVMFY) (H is Proximal heme binding site), LPO and Lignin III of Phlebia radiata do not have this sequence; (SGATV) -X (3)-(LIVMA)-X- (FW) -HX- (SAC) (H is far Flanking active site), spinal impulse peroxidase (MP0, TP0, LP0 and EP0) does not have this sequence.
- MP0 Myeloperoxidase
- TP0 peroxidase-thyroid Peroxidase
- the human peroxidase protein 10 protein plays an important role in regulating important functions of the body such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes, so it has been necessary to identify more involved in these Process of human peroxidase protein 10 protein, especially The amino acid sequence of this protein was identified. Isolation of the new human peroxidase protein 10 protein encoding gene also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so it is important to isolate its coding DNA. Object of the invention
- Another object of the invention is to provide a polynucleotide encoding the polypeptide.
- Another object of the present invention is to provide a method for producing human peroxidase protein 10.
- Another object of the present invention is to provide an antibody against the polypeptide of the present invention, human peroxidase protein 10.
- Another object of the present invention is to provide mimetic compounds, antagonists, agonists, and inhibitors of the polypeptide of the present invention, human peroxidase protein 10.
- Another object of the present invention is to provide a method for diagnosing and treating diseases related to abnormalities of human peroxidase protein 10. Summary of invention
- the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
- the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
- the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
- sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 509 to 793 in SEQ ID NO: 1; and (b) having a sequence of 1-1556 in SEQ ID NO: 1 Sequence of bits.
- the invention further relates to a vector, in particular an expression vector, containing a polynucleotide of the invention;
- a host cell genetically engineered with the vector including a transformed, transduced or transfected host cell; a method for preparing a polypeptide of the present invention comprising culturing the host cell and recovering an expression product.
- the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
- the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of human peroxidase protein 10 protein, which comprises utilizing the polypeptide of the invention.
- the invention also relates to compounds obtained by this method.
- the invention also relates to a method for detecting a disease or disease susceptibility related to abnormal expression of human peroxidase protein 10 protein in vitro, which comprises detecting a mutation in the polypeptide or a polynucleotide sequence encoding the same in a biological sample, or detecting The amount or biological activity of a polypeptide of the invention in a biological sample.
- the invention also relates to a pharmaceutical composition
- a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
- the present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention for the preparation of a medicament for treating cancer, developmental disease or immune disease or other diseases caused by abnormal expression of human peroxidase protein 10.
- FIG. 1 is a comparison diagram of gene chip expression profiles of human peroxidase protein 10 and human peroxidase protein 11 of the present invention.
- the upper graph is a graph of the expression profile of human peroxidase protein 10, and the lower graph is the graph of the expression profile of human peroxidase protein 11.
- 1 indicates fetal kidney
- 2 indicates fetal large intestine
- 3 indicates fetal small intestine
- 4 indicates fetal muscle
- 5 indicates fetal brain
- 6 indicates fetal bladder
- 7 indicates unstarved L02
- 8 indicates L02 +
- lhr As 3 ⁇ , 9 indicates ECV304 PMA-
- 10 means ECV304 PMA +
- 11 means fetal liver
- 12 means normal liver
- 13 means thyroid
- 14 means skin
- 15 means fetal lung
- 16 means lung
- 17 means lung cancer
- 18 means fetal spleen
- 19 means spleen
- 20 Indicates prostate
- 21 indicates fetal heart
- 22 indicates heart
- 23 indicates muscle
- 24 indicates testis
- 25 indicates fetal thymus
- 26 indicates thymus.
- FIG. 2 is a polyacrylamide gel electrophoresis image (SDS-MGE) of the isolated human peroxidase protein 10.
- OkDa is the molecular weight of the protein.
- the arrow indicates the isolated protein band. . Summary of the invention
- Nucleic acid sequence is a oligonucleotide, nucleotide or polynucleotide and a fragment or part thereof, and may also refer to the genome or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
- amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
- a “variant" of a protein or polynucleotide refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it.
- the changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence.
- Variants can have "conservative" changes, in which the amino acid substituted has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine.
- Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
- “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
- Insertion means that a change in the amino acid sequence or nucleotide sequence results in an increase in one or more amino acids or nucleotides compared to a molecule that exists in nature.
- Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
- Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
- immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response and to bind specific antibodies in a suitable animal or cell.
- An "agonist” refers to a molecule that, when combined with human peroxidase protein 10, causes a change in the protein to regulate the activity of the protein.
- An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that can bind human peroxidase protein 10.
- Antagonist refers to a molecule that, when combined with human peroxidase protein 10, can block or regulate the biological or immunological activity of human peroxidase protein 10.
- Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates, or any other molecule that can bind human peroxidase protein 10.
- Regular refers to a change in the function of human peroxidase protein 10, including an increase or decrease in protein activity, a change in binding characteristics, and any other biological, functional, or immune properties of human peroxidase protein 10. change.
- substantially pure means substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated. Quality. Those skilled in the art can purify human peroxidase protein 10 using standard protein purification techniques. Substantially pure human peroxidase protein 10 produces a single main band on a non-reducing polyacrylamide gel. The purity of the human peroxidase protein 10 polypeptide can be analyzed by amino acid sequence.
- Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
- sequence C-T-G-A
- complementary sequence G-A-C-T.
- the complementarity between two single-stranded molecules may be partial or complete.
- the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
- “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
- Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Southern imprinting or Northern blotting, etc.) under conditions of reduced stringency. Substantially homologous sequences or hybridization probes can compete and inhibit the binding of fully homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.
- Percent identity refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALIGN program (Lasergene sof tware package, DNASTAR, Inc., Madi son Wis.). The MEGA1IGN program can compare two or more sequences based on different methods such as the Clus ter method (Hi ggins, DG and PM Sharp (1988) Gene 73: 237-244). 0 The Clus ter method compares each pair by checking the distance between all pairs. Group sequences are arranged in clusters. The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula:
- the percent identity between nucleic acid sequences can also be determined by the Clus ter method or by methods known in the art such as Jotun Hein (Hein J., (1990) Methods in enzymology 183: 625-645).
- Similarity refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
- Amino acids used for conservative substitution for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
- Antisense refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence.
- Antisense strand refers to a nucleic acid strand that is complementary to the “sense strand”.
- Derivative refers to HFP or a chemical modification of its nucleic acid. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
- Antibody refers to a complete antibody molecule and its fragments, such as Fa,? ( ⁇ ') 2 and? It can specifically bind to the epitope of human peroxidase protein 10.
- a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
- isolated refers to the removal of a substance from its original environment (for example, its natural environment if it is naturally occurring).
- a naturally-occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
- Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not part of its natural environment, they are still isolated.
- isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
- polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances in the natural state .
- isolated human peroxidase protein 10 means that human peroxidase protein 10 is substantially free of other proteins, lipids, carbohydrates, or other substances with which it is naturally associated. Those skilled in the art can purify human peroxidase protein 10 using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of the human peroxidase protein 10 peptide can be analyzed by amino acid sequence.
- the present invention provides a new polypeptide, human peroxidase protein 10, which basically consists of the amino acid sequence shown in SEQ ID NO: 2.
- the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
- the polypeptides of the invention can be naturally purified products, or chemically synthesized products, or produced using recombinant techniques from prokaryotic or eukaryotic hosts (e.g., bacteria, yeast, higher plants, insects, and mammalian cells). Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
- the invention also includes fragments, derivatives and analogs of human peroxidase protein 10.
- fragment refers to a polypeptide that substantially retains the same biological function or activity of the human peroxidase protein 10 of the present invention.
- a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are conserved or non- A conservative amino acid residue (preferably a conservative amino acid residue) substitution, and the substituted amino acid may or may not be encoded by a genetic codon; or ( ⁇ ) such a type in which one or more of the amino acid residues Each group is substituted by another group to include a substituent; or (I II) such that the mature polypeptide is fused to another compound (such as a compound that extends the half-life of the polypeptide, such as polyethylene glycol); or (IV) such A type of polypeptide sequence in which an additional amino acid sequence is fused into a mature polypeptide (such as a leader sequence or a secreted sequence or a sequence used to purify this polypeptide or a proteinogen sequence).
- an additional amino acid sequence is fused into a mature polypeptide (such as a leader sequence or a secreted sequence or a sequence used to purify
- the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
- the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
- the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a full-length polynucleotide sequence of 1556 bases, and its open reading frame 509-793 encodes 94 amino acids.
- this polypeptide has a similar expression profile to human peroxidase protein 11, and it can be deduced that the human peroxidase protein 10 has a similar function to human peroxidase protein 11.
- the polynucleotide of the present invention may be in the form of DNA or RM.
- DNA forms include cDNA, genomic DNA, or synthetic DNA.
- DNA can be single-stranded or double-stranded.
- DNA can be coding or non-coding.
- the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
- a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
- the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
- polynucleotide encoding a polypeptide refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.
- the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
- Variants of this polynucleotide may be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
- an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
- the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity between the two sequences).
- the invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the invention under stringent conditions.
- “strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.11 ⁇ 2SDS, 6 (TC; or (2) when hybridizing Add a denaturant, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% Fi col 1, 42 'C, etc .; or (3) only the same between the two sequences Hybridization occurs when the sex is at least 95%, and more preferably 97%.
- the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
- nucleic acid fragments that hybridize to the sequences described above.
- a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 cores. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques such as PCR to identify and / or isolate polynucleotides encoding human peroxidase protein 10.
- polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
- the specific polynucleotide sequence encoding the human peroxidase protein 10 of the present invention can be obtained by various methods.
- polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or CDM libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
- the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic MA; 2) chemically synthesizing the DM sequence to obtain the double-stranded MA of the polypeptide.
- genomic DM is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences.
- the standard method for isolating the cDM of interest is to isolate mRM from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library.
- Various methods have been used to extract mRNA, and kits are also commercially available (Qiagene).
- the construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spiring Harbor Laboratory. New York, 1989).
- Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
- genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DNA-RNA hybridization; (2) the presence or absence of marker gene functions; (3) measuring the level of the transcript of human peroxidase protein 10; ( 4) Detecting gene-expressed protein products by immunological techniques or by measuring biological activity. The above methods can be used singly or in combination.
- the probe used for hybridization is any part of the polynucleotide of the present invention Homologous, at least ID nucleotides in length, preferably at least 30 nucleotides, more preferably at least 50 nucleotides, most preferably at least 100 nucleotides.
- the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
- the probe used herein is generally a DNA sequence chemically synthesized based on the gene sequence information of the present invention.
- the genes or fragments of the present invention can of course be used as probes.
- DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
- immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) can be used to detect protein products expressed by the human peroxidase protein 10 gene expression protein.
- ELISA enzyme-linked immunosorbent assay
- a method (Sa iki, et al. Science 1985; 230: 1350-1 354) using PCR technology to amplify DNA / RNA is preferably used to obtain the gene of the present invention.
- the RACE method RACE-Rapid Amplification of cDNA Ends
- the primers for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein Select and synthesize using conventional methods.
- the amplified DM / R fragment can be isolated and purified by conventional methods such as gel electrophoresis.
- polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be measured by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDM sequence, sequencing needs to be repeated. Sometimes it is necessary to determine the cDM sequence of multiple clones in order to splice into a full-length cDNA sequence.
- the present invention also relates to a vector comprising a polynucleotide of the present invention, and a host cell that is genetically engineered using the vector of the present invention or directly using a human peroxidase protein 10 coding sequence, and a recombinant technology for producing a polypeptide of the present invention. method.
- a polynucleotide sequence encoding the human peroxidase protein 10 may be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
- vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses or other vectors well known in the art.
- Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, eta l.
- any plasmid and vector can be used to construct a recombinant expression vector.
- An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
- DM sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis.
- promoters are: the lac or trp promoter of E.
- the expression vector also includes a ribosome binding site and a transcription terminator for translation initiation. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers on the late side of the origin of replication, and adenoviral enhancers.
- the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
- selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
- GFP fluorescent protein
- tetracycline or ampicillin resistance for E. coli.
- a polynucleotide encoding human peroxidase protein 10 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a genetically engineered host cell containing the polynucleotide or a recombinant vector.
- host cell refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell.
- Escherichia coli, Streptomyces bacterial cells such as Salmonella typhimurium
- fungal cells such as yeast
- plant cells insect cells
- fly S2 or Sf9 animal cells
- animal cells such as CH0, COS or Bowes melanoma cells.
- Transformation of a host cell with a DM sequence according to the present invention or a recombinant vector containing the DNA sequence can be performed by conventional techniques well known to those skilled in the art.
- the host is a prokaryote, such as E. coli
- competent cells capable of absorbing DNA can be harvested after the exponential growth phase and treated with the CaCl 2 method. The steps used are well known in the art. Alternatively, MgCl 2 is used. If necessary, the transformation can also be performed by electroporation.
- the host is a eukaryotic organism, the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
- the polynucleotide sequence of the present invention can be used to express or produce recombinant human peroxidase protein 10 by conventional recombinant DNA technology (Sc ience, 1984; 224: 1431). Generally there are the following steps: (1) using the polynucleotide (or variant) encoding human human peroxidase protein 10 of the present invention, or transforming or transducing a suitable host cell with a recombinant expression vector containing the polynucleotide;
- the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
- a suitable method such as temperature conversion or chemical induction
- the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If necessary, the recombinant protein can be isolated and purified by various separation methods using its physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
- conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid
- polypeptides of the present invention as well as antagonists, agonists and inhibitors of the polypeptides, can be directly used in the treatment of diseases, for example, they can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection, and immune diseases.
- Peroxidase is a heme-binding enzyme that performs a series of biosynthesis and degradation by using hydrogen peroxide as an electron acceptor. Peroxide and microperoxide contain a large amount of peroxidase. In some pathological processes of the human body, such as viral hepatitis, Borrelia infection, increased peroxisomes can occur. Studies have found that myeloperoxidase (MP0) is mainly present in granulocytes and monocytes, and MP0 plays an important role in neutrophil-dependent bactericidal systems. It has also been found that peroxidase-thyroid peroxidase (TP0) is involved in the biosynthesis of thyroid hormones.
- MP0 myeloperoxidase
- TP0 peroxidase-thyroid peroxidase
- the abnormal expression of the human peroxidase protein 10 of the present invention will produce various diseases, especially various inflammations, immune system diseases, and thyroid diseases. These diseases include, but are not limited to:
- inflammatory abnormalities caused by various infections and traumas such as viral hepatitis, Borrelia infection, tuberculosis, HIV, syphilis, allergic reactions, bronchial asthma, sarcoidosis, rheumatoid arthritis, rheumatoid arthritis, Osteoarthritis, glomerulonephritis, immune complex glomerulonephritis, acute anterior uveitis, dermatomyositis, urticaria, atopic dermatitis, hemochromatosis, Addison's disease, Grating Reeves's disease, chronic active hepatitis, intestinal emergency syndrome, atrophic gastritis, systemic lupus erythematosus, cerebral spinal multiple sclerosis, Guillain-Barre syndrome, intracranial granulomatosis, Wegener granulomatosis, autologous Immune thyroiditis, autoimmune interstitial nephritis, ulcerative
- Immune system diseases antibody-based primary specific immunodeficiency disease, combined immunodeficiency disease, immunodeficiency disease lacking phagocytic cells, complement system deficiency disease, Down syndrome, biotin-dependent carboxylase deficiency, Dim Can syndrome, thymoma, chronic cutaneous mucosal candidiasis, aplastic anemia, Di George syndrome, Wiscot t-Aldr ich syndrome, immunodeficiency disease with ataxia capillary dilatation, acquired immunodeficiency syndrome Disease
- Thyroid disease toxic goiter, non-toxic goiter, cretinism, myxedema, thyroiditis
- Abnormal expression of the human peroxidase protein 10 of the present invention will also cause certain hereditary, hematological and immune system diseases.
- the invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) human peroxidase protein 10.
- Agonists enhance human peroxidase protein 10 to stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
- mammalian cells or membrane preparations expressing human peroxidase protein 10 can be cultured with labeled human peroxidase protein 10 in the presence of a drug. The ability of the drug to increase or block this interaction is then determined.
- Antagonists of human peroxidase protein 10 include antibodies, compounds, receptor deletions, and the like that have been screened. Antagonists of human peroxidase protein 10 can bind to human peroxidase protein 10 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot exert its biology Features.
- human peroxidase protein 10 When screening compounds as antagonists, human peroxidase protein 10 can be added to bioanalytical assays to determine whether a compound is a compound by measuring its effect on the interaction between human peroxidase protein 10 and its receptor. Antagonist. Receptor deletions and analogs that act as antagonists can be screened in the same way as for screening compounds described above. Polypeptide molecules capable of binding to human peroxidase protein 10 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. When screening, generally 10 molecules of human peroxidase protein should be labeled.
- the present invention provides a method for producing an antibody using a polypeptide, a fragment, a derivative, an analog thereof, or a cell thereof as an antigen.
- These antibodies can be polyclonal or monoclonal antibodies.
- the invention also provides antibodies against human peroxidase protein 10 epitopes. These antibodies include (but are not limited to): Polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by Fab expression libraries.
- Polyclonal antibodies can be produced by injecting human peroxidase protein 10 directly into immunized animals (such as rabbits, mice, rats, etc.).
- immunized animals such as rabbits, mice, rats, etc.
- a variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's Agent.
- Techniques for preparing monoclonal antibodies to human peroxidase protein 10 include, but are not limited to, hybridoma technology (Kohler and Mistein. Nature, 1975, 256: 495-497), triple tumor technology, human beta-cell hybridoma technology , EBV-hybridoma technology, etc.
- Chimeric antibodies that bind human constant regions to non-human variable regions can be produced using existing techniques (Morrison et al, PMS, 1985, 81: 6851).
- the existing technology for producing single chain antibodies (U. S. Pat No. 4946778) can also be used to produce single chain antibodies against human peroxidase protein 10.
- Antibodies against human peroxidase protein 10 can be used in immunohistochemical techniques to detect human peroxidase protein 10 in biopsy specimens.
- Monoclonal antibodies that bind to human peroxidase protein 10 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
- Antibodies can also be used to design immunotoxins that target a particular part of the body.
- human peroxidase protein 10 high affinity monoclonal antibodies can covalently bind to bacterial or phytotoxins (such as diphtheria toxin, ricin, ormosine, etc.).
- a common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the disulfide exchange. This hybrid antibody can be used to kill human peroxidase protein 10 cell.
- the antibodies of the present invention can be used to treat or prevent diseases related to human peroxidase protein 10. Administration of an appropriate dose of the antibody can stimulate or block the production or activity of human peroxidase protein 10.
- the invention also relates to a diagnostic test method for quantitative and localized detection of human peroxidase protein 10 levels.
- tests are well known in the art and include FISH assays and radioimmunoassays.
- the level of human peroxidase protein 10 detected in the test can be used to explain the importance of human peroxidase protein 10 in various diseases and to diagnose diseases in which human peroxidase protein 10 plays a role.
- polypeptide of the present invention can also be used for peptide mapping analysis.
- the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
- human peroxidase protein 10 can also be used for a variety of therapeutic purposes. Gene therapy technology can be used to treat abnormal cell proliferation, development, or metabolism caused by the non-expression or abnormal / inactive expression of human peroxidase protein 10.
- Recombinant gene therapy vectors (such as viral vectors) can be designed for expression Up to variant human peroxidase protein 10 to inhibit endogenous human peroxidase protein 10 activity.
- a mutated human peroxidase protein 10 may be a shortened human peroxidase protein 10 lacking a signaling domain. Although it can bind to downstream substrates, it lacks signaling activity.
- recombinant gene therapy vectors can be used to treat diseases caused by abnormal expression or activity of human peroxidase protein 10.
- Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus and the like can be used to transfer a polynucleotide encoding human peroxidase protein 10 into a cell.
- Methods for constructing recombinant viral vectors carrying a polynucleotide encoding human peroxidase protein 10 can be found in the literature (Sambrook, et al.).
- Another recombinant polynucleotide encoding human peroxidase protein 10 can be packaged into liposomes and transferred into cells.
- Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
- a vector such as a virus, phage, or plasmid
- Oligonucleotides that inhibit human peroxidase protein 10 raRNA and ribozymes are also within the scope of the present invention.
- a ribozyme is an enzyme-like RM molecule that can specifically decompose a specific MA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA and performs endonucleation.
- Antisense RM, DNA, and ribozymes can be obtained using any existing RNA or DM synthesis techniques, such as solid-phase phosphoramidite chemical synthesis to synthesize oligonucleotides.
- Antisense RM molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA. This DNA sequence is integrated downstream of the vector's RNA polymerase promoter. In order to increase the stability of the nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the linkage between ribonucleosides using phosphorothioate or peptide bonds instead of phosphodiester bonds.
- the polynucleotide encoding human peroxidase protein 10 can be used for the diagnosis of diseases related to human peroxidase protein 10.
- the polynucleotide encoding human peroxidase protein 10 can be used to detect the expression of human peroxidase protein 10 or the abnormal expression of human peroxidase protein 10 in a disease state.
- the DM sequence encoding human peroxidase protein 10 can be used to hybridize biopsy specimens to determine the expression of human peroxidase protein 10.
- Hybridization techniques include Southern blotting, Northern blotting, in situ hybridization, and the like. These technical methods are all mature technologies that are publicly available, and related kits are commercially available.
- polynucleotides of the present invention can be used as probes to be fixed on a microarray or a DM chip (also known as a "gene chip") for differential expression analysis and gene diagnosis of genes in tissues.
- Human peroxidase protein 10 specific primers can also be used to detect human peroxidase protein 10 transcripts by performing in vitro amplification with RM-polymerase chain reaction (RT-PCR).
- Human peroxidase protein 10 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type human peroxidase protein 10 DNA sequence. Mutations can be detected using existing techniques such as Southern blotting, D-sequence analysis, PCR, and in situ hybridization. In addition, mutations may affect protein expression. Therefore, Northern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
- sequences of the invention are also valuable for chromosome identification. This sequence will specifically target a specific position on a human chromosome and can hybridize to it. Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for marking chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DM sequences on a chromosome.
- PCR primers (preferably 15-35bp) are prepared based on cMA, and the sequences can be located on chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
- PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
- oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
- Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.
- Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step.
- FISH Fluorescent in situ hybridization
- cDNA or genomic sequences between the affected and unaffected individuals need to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in the chromosome, such as deletions or translocations that are visible at the chromosomal level or detectable using cDNA sequence-based PCR. Based on the resolution capabilities of current physical mapping and gene mapping technologies, cDNAs that are accurately mapped to disease-related chromosomal regions can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping capability and every 20kb corresponds to a gene).
- the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
- suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
- the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
- the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
- a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
- these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell.
- the polypeptides of the invention can be used in combination with other therapeutic compounds.
- the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
- Human peroxidase protein 10 is administered in an amount effective to treat and / or prevent a specific indication.
- the amount and dose range of human peroxidase protein 10 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician. Examples
- Total human fetal brain RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform.
- Poly (A) mRNA was isolated from total RNA using Quik mRNA Isolat ion Kit (product of Qiegene). 2ug poly (A) mRNA forms CDM by reverse transcription.
- the Smart cDM cloning kit purchased from Clontech l ⁇ cDM fragment was inserted into the multicloning site of pBSK (+) vector (Clontech)) to transform DH5a to form a cDNA library.
- Dye terminate cycle react ion sequencing Kit Perkin-Elmer
- ABI 377 automatic sequencer Perkin-Elmer
- the determined cDNA sequence was compared with the existing public DNA sequence database (Genebank). The comparison revealed that the CDM sequence of one of the clones 0506g09 was new DNA.
- a series of primers were synthesized to determine the inserted CDM fragment in both directions.
- CD was synthesized by reverse transcription reaction using total RM of fetal brain cells as a template and ol igo-dT as a primer. After purification using Qiagene's kit, PCR was performed using the following primers:
- Primerl 5'- GTCTTAAGTAAGAAAATTGCCTGG -3 '(SEQ ID NO: 3)
- Primer2 5'- CACCAAATTTTACTAAGTTTACTA -3 '(SEQ ID NO: 4)
- Primerl is a forward sequence starting at , lbp at 5, end of SEQ ID NO: 1;
- Pr imer2 is the 3'-end reverse sequence in SEQ ID NO: 1.
- Amplification conditions 50 011 reaction volume containing 5 011111101/1 ⁇ KC1, 10 with ol / L Tris-HCl, pH 8. 5, 1. 5mmol / L MgCl 2 , 20 ( ⁇ mol / L dNTP, lOpmol primer, 1U Taq DNA polymerase (product of Clontech).
- the reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) under the following conditions for 25 cycles: 94 ° C 30sec; 55 ° C 30sec; 72 ° C 2min. Set p-act in as positive control and template blank as negative control at RT-PCR price.
- Amplification products were purified with QIAGEN kits and ligated to pCR vector with TA cloning kit. (Invi trogen company's product).
- the DNA sequence analysis results showed that the D sequence of the PCR product was exactly the same as l-1556bp shown in SEQ ID NO: 1.
- Example 3 Northern blot analysis of human peroxida
- a 32P-labeled probe (approximately 2 x 10 6 cpm / ml) was hybridized with a nitrocellulose membrane to which RNA was transferred in a solution at 42 ° C overnight.
- the solution contained 50% formamide-25mM KH 2 P0 4 (pH 7. 4) -5 ⁇ SSC- 5 ⁇ Denhardt's solution and 200 ⁇ 8 / ⁇ 1 salmon sperm DNA.
- the filter was placed at 1 x SSC- 0.1. / »Wash in SDS for 30 min at 55 ° C. Then, analyze and quantify using Phosphor Imager.
- Example 4 In vitro expression, isolation and purification of recombinant human peroxidase protein 10 According to the sequence of the coding region shown in SEQ ID NO: 1 and FIG. 1, a pair of specific amplification primers were designed, the sequence is as follows:
- Pr imer 3 5'- CCCCATATGATGAAAGCTCAAGAAGTGGAGCTG -3 '(Seq ID No: 5)
- Pr imer4 5'- CATGGATCCTCATGGAAAAAAAAAGTGCTTTAC -3, (Seq ID No: 6)
- the 5' ends of these two primers contain Ndel and BamHI digestion respectively Site, followed by the coding sequences of the 5 'and 3' ends of the gene of interest, respectively.
- the restriction sites for Mel and BamHI correspond to the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865. 3) Selective endonuclease site.
- PCR reaction was performed using pBS-0506g09 plasmid containing the full-length target gene as a template.
- PCR reaction conditions were: 1 in a total volume of 50 ⁇ plasmid pBS-0506g09 containing 10pg, primer Primer - 3 and Pr imer - 4 were lOpmol, Advantage polymerase Mix (Clontech Products) 1 ⁇ 1.
- Cycle parameters 94. C 20s, 60. C 30s, 68 ° C 2 min, 25 cycles in total.
- Ndel and BamHI were used to double digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase. The ligated product was transformed into E.
- coli DH5c by the calcium chloride method. After being cultured overnight on LB plates containing kanamycin (final concentration 3 ( ⁇ g / ml)), positive clones were selected by colony PCR method and sequenced. The positive clone with the correct sequence (pET-0506g09) was used to transform the recombinant plasmid into E. coli BL21 (DE3) plySs (product of Novagen) by calcium chloride method.
- the following peptides specific for human peroxidase protein 10 were synthesized using a peptide synthesizer (product of PE company): NH2-Me t-Lys-Ala-Gl nG 1 u-Va 1 -G 1 u-Leu-A la- Leu-Gl uG 1 u-Va 1 -G 1 u-Lys-COOH (SEQ ID NO: 7).
- the peptide was coupled to hemocyanin and bovine serum albumin to form a complex. For the method, see: Avraraeas, et al. Iramunochemi s try, 1969; 6: 43.
- Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
- the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
- the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
- the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by using a filter hybridization method.
- Filter hybridization methods include dot blotting, Southern imprinting, Northern blotting, and copying methods. They all use the same steps to immobilize the polynucleotide sample to be tested on the filter.
- the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer to saturate the non-specific binding site of the sample on the filter with the carrier and the synthesized polymer.
- the pre-hybridization solution is then replaced with a hybridization buffer containing labeled probes and incubated to hybridize the probes to the target nucleic acid.
- the unhybridized probes are removed by a series of membrane washing steps.
- This embodiment uses higher-intensity washing conditions (such as lower salt concentration and higher temperature), so that the hybridization background is reduced and only strong specific signals are retained.
- the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
- the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
- the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
- oligonucleotide fragments for use as hybridization probes from the polynucleotide SEQ ID NO: 1 of the present invention should follow the following principles and several aspects to be considered:
- the preferred range of probe size is 18-50 nucleotides
- Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences
- the column and its complementary region are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, then the primary probe should not be used;
- Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
- Probe 1 which belongs to the second type of probe, is equivalent to the replacement mutant sequence of the gene fragment of SEQ ID NO: 1 or its complementary fragment (41Nt):
- PBS phosphate buffered saline
- step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
- NC membranes nitrocellulose membranes
- Two NC membranes are required for each probe, so that they can be used in the following experimental steps.
- the film was washed with high-strength conditions and strength conditions, respectively.
- the sample membrane was placed in a plastic bag, and 3 to 10 mg of prehybridization solution (10xDenhardt-s; 6xSSC, 0.1 mg / ral CT DNA (calf thymus DNA)) was added. After closing the bag, 68. C water bath for 2 hours.
- prehybridization solution 10xDenhardt-s; 6xSSC, 0.1 mg / ral CT DNA (calf thymus DNA)
- probe 1 can be used for qualitative and quantitative analysis.
- the presence and differential expression of the polynucleotide of the present invention in different tissues are analyzed.
- Gene microarray or DNA microarray is a new technology currently being developed by many national laboratories and large pharmaceutical companies. It refers to the orderly, high-density, and degree arrangement of a large number of target gene fragments on glass. , Silicon and other carriers, and then use fluorescence detection and computer software to compare and analyze the data, in order to achieve the purpose of rapid, efficient, high-throughput analysis of biological information.
- the polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research of new gene functions; search for and screen new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases . The specific method steps have been reported in the literature.
- a total of 4,000 polynucleotide sequences of various full-length cDNAs are used as target DNA, including the polynucleotide of the present invention. They were amplified by PCR respectively. After purification, the concentration of the amplified product was adjusted to about 500ng / ul. Cartesian 7500 spotting instrument (purchased from Cartesian Company, USA) was spotted on the glass medium, between the spots. The distance is 280 ⁇ . The spotted slides were hydrated and dried, cross-linked in a UV cross-linker, and dried after elution to fix the DM on the glass slide to prepare chips. The specific method steps have been reported in the literature. The sample post-processing steps in this embodiment are:
- Total mRNA was extracted from human mixed tissues and specific tissues (or stimulated cell lines) in one step, and the mRNA was purified with Ol igotex mRNA Midi Ki t (purchased from QiaGen).
- Reagent Cy3dUTP (5-Araino-propargyl-2--deoxyuridine 5--triphate coupled to Cy3 f luorescent dye, purchased from Amersham Phamacia Biotech)
- Cy5dUTP 5—Amino-propargyl-2'—deoxyuridine 5'-tr iphate coupled to Cy5 f luorescent dye, purchased from Amersham Phamacia Biotech Company
- Cell line mRM, probes were prepared after purification. For specific steps and methods, see:
- the probes from the above two tissues and the chip were respectively hybridized in a UniHyb TM Hybridization Solution (purchased from TeleChem) hybridization solution for 16 hours.
- the washing solution (1 ⁇ SSC, 0.2 ° / oSDS) )
- scan with a ScanArray 3000 scanner purchased from General Scanning, USA.
- the scanned images are analyzed by Imagene software (Biodiscovery, USA), and the Cy3 / Cy5 ratio of each point is calculated.
- the above specific tissues are thymus, testis, muscle, spleen, lung, skin, thyroid, liver, PMA + Ecv304 cell line, PMA-Ecv304 cell line, non-starved L02 cell line, L02 cell line stimulated by arsenic for 1 hour, L02 cell line stimulated by arsenic for 6 hours prostate, heart, lung cancer, fetal bladder, fetal small intestine, fetal large intestine, fetal thymus, fetal muscle, fetal liver, fetal kidney, fetal spleen, fetal brain, Fetal lung and fetal heart.
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- Microbiology (AREA)
- Biotechnology (AREA)
- Biomedical Technology (AREA)
- Molecular Biology (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Enzymes And Modification Thereof (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
AU50268/01A AU5026801A (en) | 2000-03-24 | 2001-03-23 | A novel polypeptide - homo peroxidase protein 10 and polynucleotide encoding said polypeptide |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN00115119.3 | 2000-03-24 | ||
CN 00115119 CN1315360A (zh) | 2000-03-24 | 2000-03-24 | 一种新的多肽——人过氧化物酶蛋白10和编码这种多肽的多核苷酸 |
Publications (1)
Publication Number | Publication Date |
---|---|
WO2001074880A1 true WO2001074880A1 (fr) | 2001-10-11 |
Family
ID=4584588
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/CN2001/000411 WO2001074880A1 (fr) | 2000-03-24 | 2001-03-23 | Nouveau polypeptide, peroxydase proteine humaine 10, et polynucleotide codant pour ce polypeptide |
Country Status (3)
Country | Link |
---|---|
CN (1) | CN1315360A (fr) |
AU (1) | AU5026801A (fr) |
WO (1) | WO2001074880A1 (fr) |
Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN1133062A (zh) * | 1993-10-13 | 1996-10-09 | 诺沃挪第克公司 | 对过氧化氢稳定的过氧化物酶变体 |
-
2000
- 2000-03-24 CN CN 00115119 patent/CN1315360A/zh active Pending
-
2001
- 2001-03-23 WO PCT/CN2001/000411 patent/WO2001074880A1/fr active Application Filing
- 2001-03-23 AU AU50268/01A patent/AU5026801A/en not_active Abandoned
Patent Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN1133062A (zh) * | 1993-10-13 | 1996-10-09 | 诺沃挪第克公司 | 对过氧化氢稳定的过氧化物酶变体 |
Non-Patent Citations (2)
Title |
---|
CHEN JIANBO ET AL.: "Catalytic reaction mechanism of peroxidase and dynamics research thereof", JOURNAL OF MOLECULAR CATALYSIS, vol. 13, no. 4, 1999, CHINA, pages 312 - 320 * |
LIU ZHIMING: "Determination of serum peroxidase activity and its value in the diagnosis of hepatocellular carcinoma", ACTA ACADEMIAE MEDICINAE GUANGXI, vol. 13, no. 3, 1996, pages 31 - 33 * |
Also Published As
Publication number | Publication date |
---|---|
AU5026801A (en) | 2001-10-15 |
CN1315360A (zh) | 2001-10-03 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
WO2001072786A1 (fr) | Nouveau polypeptide, facteur d'inhibition tumorale 63, et polynucleotide codant pour ce polypeptide | |
WO2001079490A1 (fr) | Nouveau polypeptide, proteine antigene prostatique specifique membranaire 16, et polynucleotide codant pour ce polypeptide | |
WO2001090378A1 (fr) | Nouveau polypeptide, proteine humaine hexokinase 11, et polynucleotide codant ce polypeptide | |
WO2001068694A1 (fr) | Nouveau polypeptide, proteine humaine d'hexokinase 10, et polynucleotide codant pour ce polypeptide | |
WO2001046240A1 (fr) | Nouveau polypeptide, mariner transposase 19 humaine, et polynucleotide codant pour ce polypeptide | |
WO2001074880A1 (fr) | Nouveau polypeptide, peroxydase proteine humaine 10, et polynucleotide codant pour ce polypeptide | |
WO2001088084A2 (fr) | Nouveau polypeptide, superoxyde dismutase 11, et polynucleotide codant pour ce polypeptide | |
WO2001072815A1 (fr) | Nouveau polypeptide, ferredoxine humaine 12, et polynucleotide codant pour ce polypeptide | |
WO2001046430A1 (fr) | Nouveau polypeptide, peroxydase 12, et polynucleotide codant pour ce polypeptide | |
WO2001092541A1 (fr) | Nouveau polypeptide, catalase 12, et polynucleotide codant ce polypeptide | |
WO2001088158A1 (fr) | Nouveau polypeptide, triose phosphate isomerase humaine 10, et polynucleotide codant pour ce polypeptide | |
WO2001075016A2 (fr) | Nouveau polypeptide, tyrosinase humaine 16, et polynucleotide codant pour ce polypeptide | |
WO2001072980A1 (fr) | Nouveau polypeptide, peroxydase humaine 18, et polynucleotide codant pour ce polypeptide | |
WO2001068873A1 (fr) | Nouveau polypeptide, molecule humaine d'adhesion intercellulaire 12, et polynucleotide codant pour ce polypeptide | |
WO2001094593A1 (fr) | Nouveau polypeptide, glycero-3-phosphate deshydrogenase humaine 11, et polynucleotide codant ce polypeptide | |
WO2001046238A1 (fr) | Nouveau polypeptide, alpha-1b-glycoproteine humaine 12, et polynucleotide codant pour ce polypeptide | |
WO2001083540A1 (fr) | Nouveau polypeptide, kiaa0883-44, et polynucleotide codant pour ce polypeptide | |
WO2001075035A2 (fr) | Nouveau polypeptide, peroxydase proteine humaine 9, et polynucleotide codant pour ce polypeptide | |
WO2001090376A1 (fr) | Nouveau polypeptide, triose phosphate isomerase humaine 11, et polynucleotide codant ce polypeptide | |
WO2001075034A2 (fr) | Nouveau polypeptide, peroxydase proteine humaine 15, et polynucleotide codant pour ce polypeptide | |
WO2001092317A1 (fr) | Nouveau polypeptide, peroxydase 9, et polynucleotide codant ce polypeptide | |
WO2001094590A1 (fr) | Nouveau polypeptide, arn helicase humaine 10, et polynucleotide codant ce polypeptide | |
WO2001083509A1 (fr) | Nouveau polypeptide, peroxydase humaine 25, et polynucleotide codant pour ce polypeptide | |
WO2001072805A1 (fr) | Nouveau polypeptide, sous-unite humaine 14.19 de flavoproteine, et polynucleotide codant pour ce polypeptide | |
WO2001070795A1 (fr) | Nouveau polypeptide, glycinamide ribonucleotide synthetase humaine 13, et polynucleotide codant pour ce polypeptide |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A1 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
122 | Ep: pct application non-entry in european phase | ||
NENP | Non-entry into the national phase |
Ref country code: JP |