WO2001075034A2 - Nouveau polypeptide, peroxydase proteine humaine 15, et polynucleotide codant pour ce polypeptide - Google Patents

Nouveau polypeptide, peroxydase proteine humaine 15, et polynucleotide codant pour ce polypeptide Download PDF

Info

Publication number
WO2001075034A2
WO2001075034A2 PCT/CN2001/000408 CN0100408W WO0175034A2 WO 2001075034 A2 WO2001075034 A2 WO 2001075034A2 CN 0100408 W CN0100408 W CN 0100408W WO 0175034 A2 WO0175034 A2 WO 0175034A2
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
polynucleotide
protein
human peroxidase
peroxidase protein
Prior art date
Application number
PCT/CN2001/000408
Other languages
English (en)
Chinese (zh)
Other versions
WO2001075034A3 (fr
Inventor
Yumin Mao
Yi Xie
Original Assignee
Shanghai Biowindow Gene Development Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shanghai Biowindow Gene Development Inc. filed Critical Shanghai Biowindow Gene Development Inc.
Priority to AU58155/01A priority Critical patent/AU5815501A/en
Publication of WO2001075034A2 publication Critical patent/WO2001075034A2/fr
Publication of WO2001075034A3 publication Critical patent/WO2001075034A3/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/0065—Oxidoreductases (1.) acting on hydrogen peroxide as acceptor (1.11)

Definitions

  • the present invention belongs to the field of biotechnology. Specifically, the present invention describes a novel polypeptide, human peroxidase protein 15, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and the polypeptide.
  • Peroxidase is a heme-binding enzyme that performs a series of biosynthesis and degradation by using hydrogen peroxide as an electron acceptor. Peroxidase is widely distributed in bacteria, fungi, plants and spinal impetus.
  • the heme prosthetic group of peroxidase is protoporphyrin IX
  • the fifth ligand of the heme iron atom is the imidazole group of the proximal histidine
  • the distal histidine residue is used as the acid for the peroxidation reaction.
  • Alkali catalyst In most peroxidases, the sequences of these two His and nearby residues are more or less conserved.
  • the conserved sequence of peroxidase is: (DET)-(LIVMTA) -X (2)-(LIVM)-(LIVMSTAG)-(SAG)-(LIVMSTAG) -H- (STA)-(LIVMFY) (H is Proximal heme binding site), LPO and ligase III of Phlebia radiata do not have this sequence; (SGATV) -X (3)-(LIVMA) -X- (FW) -HX- (SAC) (H is far Flanking active site), spinal impulse peroxidase (MP0, TP0, LP0 and EP0) does not have this sequence.
  • MP0 Myeloperoxidase
  • TP0 peroxidase-thyroid Peroxidase
  • the human peroxidase protein 15 protein plays an important role in regulating important functions of the body, such as cell division and embryo development, and it is believed that a large number of proteins are involved in these regulatory processes, so there has been a need in the art to identify more involved in these Process of human peroxidase protein 15 protein, especially The amino acid sequence of this protein was identified. Isolation of the new human peroxidase protein 1 5 protein encoding gene also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so it is important to isolate its coding DNA. Object of the invention
  • Another object of the invention is to provide a polynucleotide encoding the polypeptide.
  • Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding a human peroxidase protein 15.
  • Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding a human peroxidase protein 15.
  • Another object of the present invention is to provide a method for producing human peroxidase protein 15.
  • Another object of the present invention is to provide an antibody against the polypeptide of the present invention, human peroxidase protein 15.
  • Another object of the present invention is to provide mimetic compounds, antagonists, agonists, and inhibitors of the polypeptide of the present invention, human peroxidase protein 15.
  • Another object of the present invention is to provide a method for diagnosing and treating diseases related to abnormalities of human peroxidase protein 15. Summary of invention
  • the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
  • the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
  • sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 764-1171 in SEQ ID NO: 1; and (b) a sequence having 1-1859 in SEQ ID NO: 1 Sequence of bits.
  • the invention further relates to a vector, in particular an expression vector, containing a polynucleotide of the invention;
  • a host cell genetically engineered with the vector including a transformed, transduced or transfected host cell; a method for preparing a polypeptide of the present invention comprising culturing the host cell and recovering an expression product.
  • the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
  • the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of human peroxidase protein 15 protein, which comprises utilizing the polypeptide of the invention.
  • the invention also relates to compounds obtained by this method.
  • the invention also relates to a method for detecting a disease or disease susceptibility related to abnormal expression of human peroxidase protein 15 protein in vitro, which comprises detecting a mutation in the polypeptide or a polynucleotide sequence encoding the same in a biological sample, or detecting The amount or biological activity of a polypeptide of the invention in a biological sample.
  • the invention also relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
  • the present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention for the preparation of a medicament for treating cancer, developmental disease or immune disease or other diseases caused by abnormal expression of human peroxidase protein 15.
  • FIG. 1 is a comparison diagram of gene chip expression profiles of human peroxidase protein 15 and human peroxidase protein 11 of the present invention.
  • the upper graph is a graph of the expression profile of human peroxidase protein 15, and the lower graph is the graph of the expression profile of human peroxidase protein 11.
  • 1 indicates fetal kidney
  • 2 indicates fetal large intestine
  • 3 indicates fetal small intestine
  • 4 indicates fetal muscle
  • 5 indicates fetal brain
  • 6 indicates fetal bladder
  • 7 indicates unstarved L02
  • 8 indicates L02 +, lhr, As 3+
  • 9 indicates ECV304 PMA-
  • 10 means ECV304 PMA +
  • 11 means fetal liver
  • 12 means normal liver
  • 13 means thyroid
  • 14 means skin
  • 15 means fetal lung
  • 16 means lung
  • 17 means lung cancer
  • 18 means fetal spleen
  • 19 means spleen
  • 20 Indicates prostate
  • 21 indicates fetal heart
  • 22 indicates heart
  • 23 indicates muscle
  • 24 indicates testis
  • 25 indicates fetal thymus
  • 26 indicates thymus.
  • FIG. 2 is a polyacrylamide gel electrophoresis image (SDS-PAGE) of the isolated human peroxidase protein 15.
  • FIG. 15kDa is the molecular weight of the protein. The arrow indicates the isolated protein band. Summary of the invention
  • Nucleic acid sequence refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DNA or RM, they can be single-stranded or double-stranded, representing the sense or antisense strand.
  • amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
  • amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
  • a protein or polynucleotide “variant” refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it. The changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or the nucleotide sequence. Variants can have "conservative" changes in which the substituted amino acid has a structural or chemical property similar to the original amino acid, such as the replacement of isoleucine with leucine. Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
  • “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
  • Insertion means that a change in the amino acid sequence or nucleotide sequence results in an increase in one or more amino acids or nucleotides compared to a molecule that exists in nature.
  • Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
  • Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
  • immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response and to bind specific antibodies in a suitable animal or cell.
  • An "agonist” refers to a molecule that, when combined with human peroxidase protein 15, causes a change in the protein to regulate the activity of the protein.
  • An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that binds human peroxidase protein 15.
  • Antagonist refers to a molecule that can block or regulate the biological or immunological activity of human peroxidase protein 15 when combined with human peroxidase protein 15.
  • Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates, or any other molecule that can bind human peroxidase protein 15.
  • substantially pure ' means substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated. Quality. Those skilled in the art can purify human peroxidase protein 15 using standard protein purification techniques. Substantially pure human peroxidase protein 15 produces a single main band on a non-reducing polyacrylamide gel. The purity of human peroxidase protein 15 polypeptide can be analyzed by amino acid sequence.
  • Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
  • sequence C-T-G-A
  • complementary sequence G-A-C-T.
  • the complementarity between two single-stranded molecules may be partial or complete.
  • the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
  • the percent identity between nucleic acid sequences can also be determined by the Cluster method or by methods known in the art such as Jotun Hein (Hein J., (1990) Methods in enzymology 183: 625-645). 0
  • Antisense refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence.
  • Antisense strand refers to a nucleic acid strand that is complementary to the “sense strand”.
  • Derivative refers to HFP or a chemical modification of its nucleic acid. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
  • Antibody refers to a complete antibody molecule and its fragments, such as Fa,? ( ⁇ ') 2 and? ⁇ It can specifically bind to the epitope of human peroxidase protein 15.
  • a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
  • isolated refers to the removal of a substance from its original environment (for example, its natural environment if it is naturally occurring).
  • a naturally-occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
  • Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not part of its natural environment, they are still isolated.
  • isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
  • polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances in the natural state .
  • isolated human peroxidase protein 15 means that human peroxidase protein 15 is substantially free of other proteins, lipids, carbohydrates, or other substances with which it is naturally associated. Those skilled in the art can purify human peroxidase protein 15 using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of the human peroxidase protein 15 peptide can be analyzed by amino acid sequence.
  • the present invention provides a new polypeptide, human peroxidase protein 15, which basically consists of the amino acid sequence shown in SEQ ID NO: 2.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
  • the polypeptides of the invention may be naturally purified products, or chemically synthesized products, or produced using recombinant techniques from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells). Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
  • the invention also includes fragments, derivatives and analogs of human peroxidase protein 15.
  • fragment refers to a polypeptide that substantially retains the same biological function or activity of the human peroxidase protein 15 of the present invention.
  • a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are conserved or non- A conservative amino acid residue (preferably a conservative amino acid residue) substitution, and the substituted amino acid may or may not be encoded by a genetic codon; or ( ⁇ ) such a type in which one or more of the amino acid residues Each group is substituted by another group to include a substituent; or (II) a type in which the mature polypeptide is fused with another compound (such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol); or (IV) such A type of polypeptide sequence in which an additional amino acid sequence is fused into a mature polypeptide (such as a leader sequence or a secreted sequence or a sequence used to purify this polypeptide or a proteinogen sequence).
  • an additional amino acid sequence is fused into a mature polypeptide (such as a leader sequence or a secreted sequence or a sequence used
  • the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
  • the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a full-length polynucleotide sequence of 1859 bases, and its open reading frame 764-1 171 encodes 1 35 amino acids.
  • this polypeptide has a similar expression profile to human peroxidase protein 11, and it can be deduced that the human peroxidase protein 15 has a similar function to human peroxidase protein 11.
  • the polynucleotide of the present invention may be in the form of DNA or RNA.
  • DNA forms include cDNA, genomic DNA, or synthetic DM.
  • DNA can be single-stranded or double-stranded.
  • DNA can be coding or non-coding.
  • the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
  • a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
  • the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide. (And optional additional coding sequences); and Non-coding sequence.
  • polynucleotide encoding a polypeptide refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.
  • the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
  • Variants of this polynucleotide may be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
  • an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
  • the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity between the two sequences).
  • the invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the invention under stringent conditions.
  • “strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60 ° C; or (2) added during hybridization Use a denaturant, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% Ficoll, 42 ° C, etc .; or (3) the identity between the two sequences is at least 95% Above, more preferably 97% or more hybridization occurs.
  • the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
  • nucleic acid fragments that hybridize to the sequences described above.
  • a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 cores. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques, such as PCR, to identify and / or isolate polynucleotides encoding human peroxidase protein 15.
  • polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
  • the specific polynucleotide sequence encoding the human peroxidase protein 15 of the present invention can be obtained by various methods.
  • polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
  • the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.
  • genomic DM is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences.
  • the standard method for isolating the cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library.
  • Various methods have been used to extract mRNA, and kits are also commercially available (Qiagene).
  • the construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989).
  • Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
  • genes of the present invention can be screened from these cDM libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DNA-RNA hybridization; (2) the presence or absence of marker gene functions; (3) measuring the level of the transcript of human peroxidase protein 15; ( 4) Detecting gene-expressed protein products by immunological techniques or by measuring biological activity. The above methods can be used singly or in combination.
  • the probe used for hybridization is any part of the polynucleotide of the present invention Homologous, at least 10 nucleotides in length, preferably at least 30 nucleotides, more preferably at least 50 nucleotides, most preferably at least 100 nucleotides.
  • the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
  • the probe used here is usually a DNA sequence chemically synthesized based on the gene sequence information of the present invention.
  • the genes or fragments of the present invention can of course be used as probes.
  • DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
  • immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) can be used to detect the protein product expressed by the human peroxidase protein 15 gene.
  • ELISA enzyme-linked immunosorbent assay
  • a method for amplifying DM / RNA by PCR is preferably used to obtain the gene of the present invention.
  • the RACE method RACE-rapid cDNA end rapid amplification method
  • the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Select and synthesize using conventional methods.
  • the amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
  • polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be measured by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, sequencing needs to be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
  • the present invention also relates to a vector comprising a polynucleotide of the present invention, and a host cell that is genetically engineered using the vector of the present invention or directly using a human peroxidase protein 15 coding sequence, and a recombinant technology for producing a polypeptide of the present invention. method.
  • a polynucleotide sequence encoding the human peroxidase protein 15 can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
  • vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses or other vectors well known in the art.
  • Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors expressed in bacteria (Rosenberg, et al.
  • any plasmid and vector can be used to construct a recombinant expression vector.
  • An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
  • Methods known to those skilled in the art can be used to construct expression vectors containing DM sequences encoding human peroxidase protein 15 and appropriate transcription / translation regulatory elements. These methods include in vitro recombinant DM Technology, DNA synthesis technology, in vivo recombination technology, etc. (Sambroook, et al. Molecular Cloning, a Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989).
  • the DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis. Representative examples of these promoters are: the lac or trp promoter of E.
  • the expression vector also includes a ribosome binding site and a transcription terminator for translation initiation. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers from 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers on the late side of the origin of replication, and adenovirus enhancers.
  • the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • GFP fluorescent protein
  • tetracycline or ampicillin resistance for E. coli.
  • a polynucleotide encoding human peroxidase protein 15 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a genetically engineered host cell containing the polynucleotide or a recombinant vector.
  • host cell refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell.
  • Escherichia coli, Streptomyces bacterial cells such as Salmonella typhimurium
  • fungal cells such as yeast
  • plant cells insect cells
  • fly S2 or Sf9 animal cells
  • animal cells such as CH0, COS or Bowes melanoma cells.
  • Transformation of a host cell with a DNA sequence according to the present invention or a recombinant vector containing the DM sequence can be performed using conventional techniques well known to those skilled in the art.
  • the host is a prokaryote, such as E. coli
  • competent cells capable of absorbing DNA can be harvested after the exponential growth phase and treated with the CaCl 2 method. The steps used are well known in the art. Alternatively, MgCl 2 is used. If necessary, transformation can also be performed by electroporation.
  • the host is a eukaryote, the following DM transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
  • the polynucleotide sequence of the present invention can be used to express or produce recombinant human peroxidase protein 15 (Science, 1984; 224: 1431). Generally there are the following steps: (1) using the polynucleotide (or variant) encoding human human peroxidase protein 15 of the present invention, or transforming or transducing a suitable host cell with a recombinant expression vector containing the polynucleotide;
  • the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
  • a suitable method such as temperature conversion or chemical induction
  • the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If necessary, the recombinant protein can be isolated and purified by various separation methods using its physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
  • conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid
  • polypeptides of the present invention as well as antagonists, agonists and inhibitors of the polypeptides, can be directly used in the treatment of diseases, for example, they can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection, and immune diseases.
  • Peroxidase is a heme-binding enzyme that performs a series of biosynthesis and degradation by using hydrogen peroxide as an electron acceptor. Peroxide and microperoxide contain a large amount of peroxidase. In some pathological processes of the human body, such as viral hepatitis, Borrelia infection, increased peroxisomes can occur. Studies have found that myeloperoxidase (MP0) is mainly present in granulocytes and monocytes, and MP0 plays an important role in neutrophil-dependent bactericidal systems. It has also been found that peroxidase-thyroid peroxidase (TP0) is involved in the biosynthesis of thyroid hormones.
  • MP0 myeloperoxidase
  • TP0 peroxidase-thyroid peroxidase
  • human peroxidase protein 15 of the present invention will produce various diseases, especially various inflammations, immune system diseases, and thyroid diseases. These diseases include, but are not limited to:
  • inflammatory abnormalities caused by various infections and traumas such as viral hepatitis, Borrelia infection, tuberculosis, HIV, syphilis, allergic reactions, bronchial asthma, sarcoidosis, rheumatoid arthritis, rheumatoid arthritis, Osteoarthritis, glomerulonephritis, immune complex glomerulonephritis, acute anterior uveitis, dermatomyositis, urticaria, atopic dermatitis, hemochromatosis, Addison's disease, Grating Reeves's disease, chronic active hepatitis, intestinal emergency syndrome, atrophic gastritis, systemic lupus erythematosus, cerebral spinal multiple sclerosis, Guillain-Barre syndrome, intracranial granulomatosis, Wegener granulomatosis, autologous Immune thyroiditis, autoimmune interstitial nephritis, ulcerative
  • Immune system diseases antibody-based primary specific immunodeficiency disease, combined immunodeficiency disease, immunodeficiency disease of phagocytic cells deficiency, complement system deficiency disease, Down syndrome, biotin-dependent carboxylase deficiency, Dun Can syndrome, thymoma, chronic cutaneous mucosal candidiasis, aplastic anemia, D i George syndrome, Wis cot tA l dr i ch syndrome, immunodeficiency disease with ataxia capillary dilatation, acquired Immunodeficiency syndrome
  • Thyroid disease toxic goiter, non-toxic goiter, cretinism, myxedema, thyroiditis
  • Abnormal expression of the human peroxidase protein 15 of the present invention will also cause certain hereditary, hematological and immune system diseases.
  • the invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) human peroxidase protein 15.
  • Agonists enhance biological functions such as human peroxidase protein 15 to stimulate cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
  • mammalian cells or membrane preparations expressing human peroxidase protein 15 can be cultured together with labeled human peroxidase protein 15 in the presence of drugs. The ability of the drug to increase or block this interaction is then determined.
  • Antagonists of human peroxidase protein 15 include selected antibodies, compounds, receptor deletions, and the like. Antagonists of human peroxidase protein 15 can bind to human peroxidase protein 15 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot function biologically. Learn function.
  • human peroxidase protein 15 can be added to bioanalytical assays to determine whether a compound is a compound by measuring its effect on the interaction between human peroxidase protein 15 and its receptor. Antagonist. Receptor deletions and analogs that act as antagonists can be screened in the same way as for screening compounds described above.
  • Polypeptide molecules capable of binding to human peroxidase protein 15 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. When screening, 15 molecules of human peroxidase protein should generally be labeled.
  • the present invention provides a method for producing an antibody using a polypeptide, a fragment, a derivative, an analog thereof, or a cell thereof as an antigen.
  • These antibodies can be polyclonal or monoclonal antibodies.
  • the invention also provides antibodies against human peroxidase protein 15 epitopes. These antibodies include (but are not limited to): Polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by Fab expression libraries.
  • Polyclonal antibodies can be produced by injecting human peroxidase protein 15 directly into immunized animals (such as rabbits, mice, rats, etc.).
  • immunized animals such as rabbits, mice, rats, etc.
  • a variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's Agent.
  • Techniques for preparing monoclonal antibodies to human peroxidase protein 15 include, but are not limited to, hybridoma technology (Kohler and Mistein. Nature, 1975, 256: 495-497), triple tumor technology, human beta- Cell hybridoma technology, EBV-hybridoma technology, etc.
  • Embedding antibodies that bind human constant regions and non-human variable regions can be produced using existing techniques (Morrison et al, PNAS, 1985, 81: 6851).
  • the existing technology for producing single chain antibodies (U.S. Pat No. 4946778) can also be used to produce single chain antibodies against human peroxidase protein 15.
  • Antibodies against human peroxidase protein 15 can be used in immunohistochemical techniques to detect human peroxidase protein 15 in biopsy specimens.
  • Monoclonal antibodies that bind to human peroxidase protein 15 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
  • Antibodies can also be used to design immunotoxins that target a particular part of the body.
  • human peroxidase protein 15 high affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
  • a common method is to attack the amino group of an antibody with a thiol crosslinker such as SPDP, and toxin is bound to the antibody through the exchange of disulfide bonds.
  • This hybrid antibody can be used to kill human peroxidase protein 15 Cell.
  • the antibodies of the present invention can be used to treat or prevent diseases related to human peroxidase protein 15.
  • Administration of an appropriate dose of antibody can stimulate or block the production or activity of human peroxidase protein 15.
  • the invention also relates to a diagnostic test method for quantitative and localized detection of human peroxidase protein 15 levels.
  • tests are well known in the art and include FISH assays and radioimmunoassays.
  • the level of human peroxidase protein 15 detected in the test can be used to explain the importance of human peroxidase protein 15 in various diseases and to diagnose diseases in which human peroxidase protein 15 plays a role.
  • polypeptide of the present invention can also be used for peptide mapping analysis.
  • the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
  • human peroxidase protein 15 can also be used for a variety of therapeutic purposes.
  • Gene therapy technology can be used to treat abnormal cell proliferation, development, or metabolism caused by the non-expression or abnormal / inactive expression of human peroxidase protein 15.
  • Recombinant gene therapy vectors (such as viral vectors) can be designed for expression Up to variant human peroxidase protein 15 to inhibit endogenous human peroxidase protein 15 activity.
  • a mutant human peroxidase protein 15 may be a shortened human peroxidase protein 15 lacking a signaling domain, and although it can bind to downstream substrates, it lacks signaling activity.
  • recombinant gene therapy vectors can be used to treat diseases caused by abnormal expression or activity of human peroxidase protein 15.
  • Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to transfer a polynucleotide encoding human peroxidase protein 15 into cells.
  • Methods for constructing recombinant viral vectors carrying a polynucleotide encoding human peroxidase protein 15 can be found in the existing literature (Sambrook, et al.).
  • the recombinant polynucleotide encoding human peroxidase protein 15 can be packaged into liposomes and transferred into cells.
  • Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
  • a vector such as a virus, phage, or plasmid
  • Oligonucleotides including antisense RM and DM
  • ribozymes that inhibit human peroxidase protein 15 mRNA are also within the scope of the present invention.
  • a ribozyme is an enzyme-like RNA molecule that can specifically decompose specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation.
  • Antisense RNA, DM, and ribozymes can be obtained using any existing RNA or DM synthesis techniques, such as solid-phase phosphoramidite chemical synthesis to synthesize oligonucleotides.
  • Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA. This DNA sequence has been integrated downstream of the RM polymerase promoter of the vector. In order to increase the stability of the nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the linkage between ribonucleosides using phosphorothioate or peptide bonds instead of phosphodiester bonds.
  • the polynucleotide encoding human peroxidase protein 15 can be used for the diagnosis of diseases related to human peroxidase protein 15.
  • the polynucleotide encoding human peroxidase protein 15 can be used to detect the expression of human peroxidase protein 15 or the abnormal expression of human peroxidase protein 15 in a disease state.
  • the DNA sequence encoding human peroxidase protein 15 can be used to hybridize biopsy specimens to determine the expression of human peroxidase protein 15.
  • Hybridization techniques include Southern blotting, Northern blotting, in situ hybridization, and the like. These technical methods are all mature technologies that are publicly available, and related kits are commercially available.
  • polynucleotides of the present invention can be used as probes to be fixed on a microarray or a DNA chip (also referred to as a "gene chip") for differential expression analysis and gene diagnosis of genes in tissues.
  • Human peroxidase protein 15 specific primers can also be used to detect human peroxidase protein 15 transcription products by in vitro amplification of RNA-polymerase chain reaction (RT-PCR).
  • Human peroxidase protein 15 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type human peroxidase protein 15 DNA sequence. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression. Therefore, Nor thern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
  • sequences of the invention are also valuable for chromosome identification. This sequence will specifically target a specific position on a human chromosome and can hybridize to it. Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for marking chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DNA sequences on a chromosome.
  • PCR primers (preferably 15-35bp) are prepared based on cDNA, and the sequences can be located on chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
  • PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
  • oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
  • Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.
  • Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step.
  • FISH Fluorescent in situ hybridization
  • cDNA or genomic sequences between the affected and unaffected individuals need to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in the chromosome, such as deletions or translocations that are visible at the chromosomal level or detectable using cDNA sequence-based PCR. Based on the resolution capabilities of current physical mapping and gene mapping technologies, cDNAs that are accurately mapped to disease-related chromosomal regions can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping capability and every 20kb corresponds to a gene).
  • the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
  • suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
  • the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
  • the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell.
  • the polypeptides of the invention can be used in combination with other therapeutic compounds.
  • the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
  • Human peroxidase protein 15 is administered in an amount effective to treat and / or prevent a specific indication.
  • the amount and range of human peroxidase protein 15 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician. Examples
  • Total human fetal brain RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform.
  • Poly (A) mRNA was isolated from total RNA by Quik m NA I solat ion Kit (product of Qiegene). 2ug poly (A) mRNA is reverse transcribed to form cDNA.
  • the Smart cDNA cloning kit purchased from Clontech was used to insert the cDNA fragments into the multiple cloning site of pBSK (+) vector (Clontech) to transform DH5a. The bacteria formed a cDNA library.
  • the sequences at the 5 'and 3' ends of all clones were determined using Dye terminate cyc le react ion sequencing kit (Perkin-Elmer) and ABI 377 automatic sequencer (Perkin-Elmer).
  • the determined cDNA sequence was compared with the existing public DM sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 0877h08 was new DNA.
  • a series of primers were synthesized to determine the inserted cDNA fragments of the clone in both directions.
  • CDNA was synthesized using fetal brain cell total RNA as a template and oligo-dT as a primer for reverse transcription. After purification with Qiagene's kit, PCR was performed using the following primers:
  • Primer2 5,-TTTTTATAACAACTGAATTTATTA -3, (SEQ ID NO: 4)
  • Primerl is a forward sequence starting at lbp of the 5th end of SEQ ID NO: 1;
  • Primer2 is the 3 'end reverse sequence in SEQ ID NO: 1.
  • Amplification conditions 50 ⁇ l of KC1, 10 mmol / L Tris-HCl, pH 8.5, 1.5 ramol / L MgCl 2 , 20 ( ⁇ mol / L dNTP, lOpraol primers in a 50 ⁇ 1 reaction volume 1U of Taq DNA polymerase (Clontech).
  • the reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) for 25 cycles under the following conditions: 94 ° C 30sec; 55 ° C 30sec; 72 ° C 2min.
  • ⁇ -actin was used as a positive control and template blank was used as a negative control.
  • the amplified products were purified using a QIAGEN kit and ligated to a pCR vector using a TA cloning kit (Invitrogen). DNA sequence analysis The results showed that the DNA sequence of the PCR product was identical to that of 1 to 1859bp shown in SEQ ID NO: 1.
  • Example 3 Northern blot analysis of human peroxidase protein 15 gene expression
  • 32P-labeled probe (about 2 x 10 6 cpm / ml) was hybridized with a nitrocellulose membrane to which RNA was transferred at 42 ° C overnight in a solution containing 50% formamide-25raM KH 2 P0 4 (pH7.4) -5 ⁇ SSC-5 ⁇ Denhardt's solution and 20 ⁇ g / ml salmon sperm DNA. After hybridization, the filter was washed in 1 x SSC-0, 1% SDS at 55 ° C for 30 tnin. Then , Phosphor Imager was used for analysis and quantification.
  • Example 4 In vitro expression, isolation and purification of recombinant human peroxidase protein 15 According to the sequence of the coding region shown in SEQ ID NO: 1 and FIG. 1, a pair of specific amplification primers were designed, the sequence is as follows:
  • Primer 3 5'- CCCCATATGATGTCAGTCGAAAAAATCTCCCTG -3, (Seq ID No: 5)
  • Priraer4 5'- CATGGATCCCTAACACAGTGAAACCCCGTCTCT -3, (Seq ID No: 6)
  • the 5 'ends of these two primers contain Ndel and BamHI restriction sites, respectively , followeded by the coding sequences of the 5 'and 3' ends of the target gene, respectively, and the Ndel and BamHI restriction sites correspond to the selectivity on the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865.3) Endonuclease site.
  • PCR was performed using the pBS-0877h08 plasmid containing the full-length target gene as a template.
  • PCR reaction conditions were: 1 in a total volume of 50 ⁇ plasmid pBS-0877h08 containing 10pg, primers Pr imer-3 and Primer- 4 are lOpmol, Advantage polymerase Mix (Clontech Products) 1 ⁇ 1.
  • Cycle parameters 94. C 20s, 60. C 30s, 68 ° C 2 min , 25 cycles total.
  • Nde I and BamHI were used to double digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase. The ligated product was transformed into E.
  • Polypeptide synthesizer (product of PE company) was used to synthesize the following human peroxidase protein 15-specific peptides: Ile-Leu-Asn-C00H (SEQ ID NO: 7).
  • the polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex, respectively.
  • Rabbits were immunized with 4 mg of the above-mentioned jk cyanin polypeptide complex plus complete Freund's adjuvant, and 15 days later the hemocyanin polypeptide complex plus incomplete Freund's adjuvant was used to boost the immunity once.
  • a titer plate coated with a 15 g / ral bovine serum albumin peptide complex was used as an ELISA to determine antibody titers in rabbit serum.
  • Use protein A-Sepharose from antibody-positive Total I gG was isolated from rabbit serum.
  • the peptide was bound to a cyanogen bromide-activated Se P harose 4B column, and the anti-peptide antibody was separated from the total I gG by affinity chromatography.
  • the immunoprecipitation method proved that the purified antibody could specifically bind to human peroxidase protein 15.
  • Example 6 Application of the polynucleotide fragment of the present invention as a hybridization probe
  • Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
  • the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
  • the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
  • the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method.
  • Filter hybridization methods include dot blotting, Southern imprinting, Northern blotting, and copying methods. They all use the same steps to immobilize the polynucleotide sample to be tested on the filter.
  • the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer to saturate the non-specific binding site of the sample on the filter with the carrier and the synthesized polymer.
  • the pre-hybridization solution is then replaced with a hybridization buffer containing labeled probes and incubated to hybridize the probes to the target nucleic acid.
  • the unhybridized probes are removed by a series of membrane washing steps. In this embodiment, higher-intensity washing conditions (such as lower salt concentration and higher temperature) are used to reduce the hybridization background and retain only strong specific signals.
  • the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
  • the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
  • the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
  • oligonucleotide fragments for use as hybridization probes from the polynucleotide SEQ ID NO: 1 of the present invention should follow the following principles and several aspects to be considered:
  • the preferred range of probe size is 18-50 nucleotides
  • the GC content is 30% -70%, and the non-specific hybridization increases when it exceeds;
  • Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences
  • the column and its complementary region are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, then the primary probe should not be used;
  • Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
  • Probe 2 which belongs to the second type of probe, is equivalent to the replacement mutant sequence of the gene fragment of SEQ ID NO: 1 or its complementary fragment (41Nt):
  • PBS phosphate buffered saline
  • NC membrane nitrocellulose membrane
  • the 32 P-Probe (the second peak is free ⁇ - 32 P-dATP) is prepared.
  • the sample membrane was placed in a plastic bag, and 3 to 10 mg of prehybridization solution (10xDenhardfs; 6xSSC, 0.1 mg / ml CT DM (calf thymus DM)) was added. After sealing the mouth of the bag, shake at 68 ° C for 2 hours.
  • prehybridization solution 10xDenhardfs; 6xSSC, 0.1 mg / ml CT DM (calf thymus DM)
  • probe 1 can be used for qualitative and quantitative analysis.
  • the presence and differential expression of the polynucleotide of the present invention in different tissues are analyzed.
  • Gene chip or gene microarray is a new technology currently being developed by many national laboratories and large pharmaceutical companies.
  • the data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software to achieve the purpose of rapid, efficient, and high-throughput analysis of biological information.
  • the polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research of new gene functions; search for and screen new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases .
  • the specific method steps have been reported in the literature. For example, refer to the literature DeRi si, JL, Lyer, V. & Brown, P. 0. (1997) Sc ience 278, 680-686. And the literature Hel le, RA, Schema, M., Cha i, A., Sha lom, D., (1997) PNAS 94: 2150-2155.
  • a total of 4,000 polynucleotide sequences of various full-length cDNAs are used as target DNA, including the polynucleotide of the present invention. They were respectively amplified by PCR. After purification, the concentration of the amplified product was adjusted to about 500 ng / ul, and spotted on a glass medium with a Cartesian 7500 spotter (purchased from Cartesian Company, USA). The distance between them is 280 ⁇ . The spotted slides were hydrated and dried, cross-linked in a UV cross-linker, and dried after elution to fix the DNA on the glass slides to prepare chips. The specific method steps have been reported in the literature. The post-spotting processing steps of this embodiment are.-
  • Total mRM was extracted from human mixed tissues and specific tissues (or stimulated cell lines) in one step, and mRNA was purified with Ol igotex mRNA Midi Kit (purchased from QiaGen), and separated by reverse transcription! ] Fluorescent reagent Cy3dUTP (5-Amino-propargyl-2--deoxyur idine 5 '-tr iphate coupled to Cy3 f luorescent dye, purchased from Amersham Phamacia Biotech) The mRNA of human mixed tissues was labeled with Cy5dUTP (5-Amino-propargyl-2'-deoxyuridine 5'-tr iphate coupled to Cy5 fluorescent dye, purchased from Amershara Phamacia Biotech) as a fluorescent reagent. ) MRNA, probes were prepared after purification. For specific steps and methods, see:
  • the probes from the two types of tissues and the chips were hybridized in a UniHyb TM Hybridization Solution (purchased from TeleChem) hybridization solution for 16 hours, washed with a washing solution (1 x SSC, 0.2% SDS) at room temperature, and then scanned with ScanArray 3000.
  • the scanner purchased from General Scanning Company, USA
  • the scanned images were analyzed and processed with Imagene software (Biodiscovery, USA) to calculate the Cy3 / Cy5 ratio of each point.
  • the above specific tissues are thymus, testis, muscle, spleen, lung, skin, thyroid, liver, PMA + Ecv304 cell line, PMA-Ecv304 cell line, non-starved L02 cell line, L02 cell line stimulated by arsenic for 1 hour, L02 cell line stimulated by arsenic for 6 hours prostate, heart, lung cancer, fetal bladder, fetal small intestine, fetal large intestine, fetal thymus, fetal muscle, fetal liver, fetal kidney, fetal spleen, fetal brain, Fetal lung and fetal heart.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Enzymes And Modification Thereof (AREA)

Abstract

L'invention concerne un nouveau polypeptide, une peroxydase protéine humaine 15, et un polynucléotide codant pour ce polypeptide ainsi qu'un procédé d'obtention de ce polypeptide par des techniques recombinantes d'ADN. L'invention concerne en outre les applications de ce polypeptide dans le traitement de maladies, notamment des tumeurs malignes, de l'hémopathie, de l'infection par VIH, de maladies immunitaires et de diverses inflammations. L'invention concerne aussi l'antagoniste agissant contre le polypeptide et son action thérapeutique ainsi que les applications de ce polynucléotide codant pour la peroxydase protéine humaine 15.
PCT/CN2001/000408 2000-03-24 2001-03-23 Nouveau polypeptide, peroxydase proteine humaine 15, et polynucleotide codant pour ce polypeptide WO2001075034A2 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU58155/01A AU5815501A (en) 2000-03-24 2001-03-23 A novel polypeptide, human peroxydase protein 15 and the polynucleotide encodingthe polypeptide

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN 00115116 CN1315357A (zh) 2000-03-24 2000-03-24 一种新的多肽——人过氧化物酶蛋白15和编码这种多肽的多核苷酸

Publications (2)

Publication Number Publication Date
WO2001075034A2 true WO2001075034A2 (fr) 2001-10-11
WO2001075034A3 WO2001075034A3 (fr) 2004-04-08

Family

ID=4584585

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2001/000408 WO2001075034A2 (fr) 2000-03-24 2001-03-23 Nouveau polypeptide, peroxydase proteine humaine 15, et polynucleotide codant pour ce polypeptide

Country Status (3)

Country Link
CN (1) CN1315357A (fr)
AU (1) AU5815501A (fr)
WO (1) WO2001075034A2 (fr)

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
DATABASE GENBANK [Online] 14 December 1999 CLARK, G. Retrieved from embl Database accession no. Z99716 *
DATABASE GENBANK [Online] 21 December 1999 SULSTON, J. E. ET AL Database accession no. AC007243 *
DATABASE GENBANK [Online] 23 November 1999 GRAFHAM, D. Retrieved from EMBL Database accession no. AL031074 *
GUO J ET AL ENDOCRINOLOGY vol. 139, no. 3, March 1998, pages 999 - 1005 *
SILVA RC ET AL BRAZ J MED BIOL RES vol. 31, no. 9, September 1998, pages 1141 - 1148 *

Also Published As

Publication number Publication date
WO2001075034A3 (fr) 2004-04-08
AU5815501A (en) 2001-10-15
CN1315357A (zh) 2001-10-03

Similar Documents

Publication Publication Date Title
WO2001068689A1 (fr) Nouveau polypeptide, 1alpha sous-unite 13 humaine du facteur adaptatif de l'hypoxie, et polynucleotide codant pour ce polypeptide
WO2001072815A1 (fr) Nouveau polypeptide, ferredoxine humaine 12, et polynucleotide codant pour ce polypeptide
WO2001075034A2 (fr) Nouveau polypeptide, peroxydase proteine humaine 15, et polynucleotide codant pour ce polypeptide
WO2001046430A1 (fr) Nouveau polypeptide, peroxydase 12, et polynucleotide codant pour ce polypeptide
WO2001046240A1 (fr) Nouveau polypeptide, mariner transposase 19 humaine, et polynucleotide codant pour ce polypeptide
WO2001055431A1 (fr) Nouveau polypeptide, glucosamine-6-phosphate-isomerase 12, et polynucleotide codant pour ce polypeptide
WO2001072980A1 (fr) Nouveau polypeptide, peroxydase humaine 18, et polynucleotide codant pour ce polypeptide
WO2001075016A2 (fr) Nouveau polypeptide, tyrosinase humaine 16, et polynucleotide codant pour ce polypeptide
WO2001074880A1 (fr) Nouveau polypeptide, peroxydase proteine humaine 10, et polynucleotide codant pour ce polypeptide
WO2001087943A1 (fr) Protease a serine 13 atp-dependante, polypeptide humain, et polynucleotide le codant
WO2001072983A1 (fr) Nouveau polypeptide, peroxydase humaine 11, et polynucleotide codant pour ce polypeptide
WO2001075011A2 (fr) Nouveau polypeptide, proteine humaine de constitution 10 de cytochromes, et polynucleotide codant pour ce polypeptide
WO2001068873A1 (fr) Nouveau polypeptide, molecule humaine d'adhesion intercellulaire 12, et polynucleotide codant pour ce polypeptide
WO2001075035A2 (fr) Nouveau polypeptide, peroxydase proteine humaine 9, et polynucleotide codant pour ce polypeptide
WO2001048213A1 (fr) Nouveau polypeptide, peroxydase 11, et polynucleotide codant pour ce polypeptide
WO2001092317A1 (fr) Nouveau polypeptide, peroxydase 9, et polynucleotide codant ce polypeptide
WO2001070795A1 (fr) Nouveau polypeptide, glycinamide ribonucleotide synthetase humaine 13, et polynucleotide codant pour ce polypeptide
WO2001094590A1 (fr) Nouveau polypeptide, arn helicase humaine 10, et polynucleotide codant ce polypeptide
WO2001070960A1 (fr) Nouveau polypeptide, proteine humaine de reparation 13 du mesappariement de l'adn, et polynucleotide codant pour ce polypeptide
WO2001066701A1 (fr) Nouveau polypeptide, nadh-deshydrogenase humaine 13, et polynucleotide codant pour ce polypeptide
WO2001075030A2 (fr) Nouveau polypeptide, tyrosinase humaine 11, et polynucleotide codant pour ce polypeptide
WO2001068874A1 (fr) Nouveau polypeptide, polypeptide humain d'activation endotheliale ii-62, et polynucleotide codant pour ce polypeptide
WO2001087974A1 (fr) Nouveau polypeptide, serine hydrolase humaine atp-dependante 35, et polynucleotide codant pour ce polypeptide
WO2001072803A1 (fr) Nouveau polypeptide, proteine humaine a doigt de zinc 15, et polynucleotide codant pour ce polypeptide
WO2001075038A2 (fr) Nouveau polypeptide, serine hydrolase humaine 9 atp-dependante, et polynucleotide codant pour ce polypeptide

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase in:

Ref country code: JP