WO2001092317A1 - Nouveau polypeptide, peroxydase 9, et polynucleotide codant ce polypeptide - Google Patents
Nouveau polypeptide, peroxydase 9, et polynucleotide codant ce polypeptide Download PDFInfo
- Publication number
- WO2001092317A1 WO2001092317A1 PCT/CN2001/000844 CN0100844W WO0192317A1 WO 2001092317 A1 WO2001092317 A1 WO 2001092317A1 CN 0100844 W CN0100844 W CN 0100844W WO 0192317 A1 WO0192317 A1 WO 0192317A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- polypeptide
- polynucleotide
- peroxidase
- sequence
- seq
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/0004—Oxidoreductases (1.)
- C12N9/0065—Oxidoreductases (1.) acting on hydrogen peroxide as acceptor (1.11)
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
Definitions
- the present invention belongs to the field of biotechnology. Specifically, the present invention describes a novel polypeptide, peroxidase 9, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and the polypeptide. Control field
- Peroxidase is a heme-binding enzyme that performs a series of biosynthesis and degradation by using hydrogen peroxide as an electron acceptor. Peroxidase is widely distributed in bacteria, fungi, plants and spinal impetus.
- Peroxidase is an enzyme that synthesizes all the atoms in an oxygen molecule into a substrate.
- One of the most important functions of peroxidase is to break the aromatic ring.
- Peroxidase can be divided into two types according to the way the aromatic ring substrate is broken. Common peroxidases break the aromatic ring between two hydroxyl groups, while a special peroxidase breaks the ring between one hydroxylated C atom and another adjacent non-hydroxylated C atom .
- Special peroxidases are usually poly-subunits. Each subunit binds a ferrous ion, and each subunit is about 33kd in size.
- the peroxidases now known are evolutionarily related and they belong to the same family.
- This family has a motif sequence containing 4 conserved residues.
- a glutamic acid in a conserved residue in this motif sequence may bind to a ferrous atom.
- This primitive sequence is: [GNTIV] -X-H-X (5, 7)-[LIVMF] -Y-X (2)-[DENTA]-P-X- [GP] -X (2, 3) -E.
- X represents any one amino acid
- E represents an iron ligand.
- MP0 Myeloperoxidase
- TP0 Peroxidase
- peroxidase 9 protein plays an important role in regulating cell division and embryonic development. Can play an important role, and it is believed that a large number of proteins are involved in these regulatory processes, so there has been a need in the art to identify more peroxidase 9 proteins involved in these processes, especially the amino acid sequence of this protein. Isolation of the gene encoding the new peroxidase 9 protein also provides a basis for research to determine the role of the protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so it is important to isolate its coding DNA. Object of the invention
- Another object of the invention is to provide a polynucleotide encoding the polypeptide.
- Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding a peroxidase 9.
- Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding peroxidase 9.
- Another object of the present invention is to provide a method for producing peroxidase 9.
- Another object of the present invention is to provide an antibody against the peroxidase 9 of the polypeptide of the present invention.
- Another object of the present invention is to provide mimic compounds, antagonists, agonists, and inhibitors against the polypeptide-peroxidase 9 of the present invention.
- Another object of the present invention is to provide a method for diagnosing and treating diseases related to peroxidase 9 abnormalities.
- the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
- the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
- the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
- the sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 504 to 749 in SEQ ID NO: 1; and (b) a sequence having 1-1675 in SEQ ID NO: 1 Sequence of bits.
- the invention further relates to a vector, in particular an expression vector, containing the polynucleotide of the invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; and a method comprising culturing said Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
- the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
- the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of peroxidase 9 protein, which comprises utilizing the polypeptide of the invention.
- the invention also relates to compounds obtained by this method.
- the invention also relates to a method for in vitro detection of a disease or susceptibility to a disease associated with abnormal expression of peroxidase 9 protein, which comprises detecting a mutation in the polypeptide or a coding polynucleotide sequence thereof in a biological sample, or detecting a biological sample The amount or biological activity of a polypeptide of the invention.
- the invention also relates to a pharmaceutical composition
- a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
- the present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention in the preparation of a medicament for treating cancer, developmental disease or immune disease or other diseases caused by abnormal expression of peroxidase 9.
- Fig. 1 is a comparison diagram of gene chip expression profiles of peroxidase 9 and peroxidase of the present invention.
- the upper graph is a graph of the peroxidase 9 expression profile, and the lower graph is the graph of the peroxidase expression profile.
- 1-bladder mucosa 2-PMA + Ecv304 cell line, 3-LPS + Ecv304 cell line thymus, 4-normal fibroblasts 1024NC, 5-Fibroblas t, growth factor stimulation, 1024NT, 6-scars into fc growth factor Stimulation, 1013HT, 7-scar scar into fc without stimulation with growth factors, 1013HC, 8-bladder cancer cell EJ, 9-bladder cancer, 10-bladder cancer, 11-liver cancer, 12-liver cancer cell line, 13-fetus Skin, 14-spleen, 15-prostate cancer, 16-jejunum adenocarcinoma, 17 cardia cancer.
- FIG. 2 is a polyacrylamide gel electrophoresis diagram (SDS-PAGE) of the isolated peroxidase 9. 9kDa is the molecular weight of the protein. The arrow indicates the isolated protein band. Summary of the invention
- Nucleic acid sequence refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DM or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
- amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
- amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
- a “variant" of a protein or polynucleotide refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it.
- the changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence.
- Variants can have "conservative" changes, in which the amino acid substituted has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine.
- Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
- “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
- Insertion means that a change in the amino acid sequence or nucleotide sequence results in an increase in one or more amino acids or nucleotides compared to a molecule that exists in nature.
- Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
- Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
- immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response and to bind specific antibodies in a suitable animal or cell.
- An "agonist” refers to a molecule that, when combined with peroxidase 9, causes a change in the protein to regulate the activity of the protein.
- An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that binds peroxidase 9.
- Antagonist refers to a molecule that, when combined with peroxidase 9, blocks or regulates the biological or immunological activity of peroxidase 9.
- Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates or any other molecule that can bind peroxidase 9.
- Regular refers to a change in the function of peroxidase 9, including an increase or decrease in protein activity, a change in binding properties, and any other biological, functional, or immune properties of peroxidase 9.
- substantially pure means substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated.
- Those skilled in the art can purify peroxidase 9 using standard protein purification techniques. Basically pure Peroxidase 9 produces a single main band on a non-reducing polyacrylamide gel. The purity of the peroxidase 9 polypeptide can be analyzed by amino acid sequence.
- Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
- sequence C-T-G-A
- complementary sequence G-A-C-T.
- the complementarity between two single-stranded molecules may be partial or complete.
- the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
- “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
- Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Southern imprinting or Northern blotting, etc.) under conditions of reduced stringency. Substantially homologous sequences or hybridization probes can compete and inhibit the binding of fully homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.
- Percent identity refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALIGN program (Lasergene sof tware package, DNASTAR, Inc., Madi son Wis.). The MEGALIGN program can compare two or more sequences according to different methods, such as the Clus ter method (Higgins, DG and PM Sharp (1988) Gene 73: 237-244). 0 The Clus ter method groups each group by checking the distance between all pairs. The sequences are arranged in clusters. The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula:
- the assay may be Jotun Hein percent identity between nucleic acid sequences Clus ter or a method well known in the art (Hein J., (1990) Methods in enzymology 183: 625-645) 0
- Similarity refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
- Amino acids used for conservative substitution for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
- Antisense refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence.
- Antisense strand refers to a nucleic acid strand that is complementary to a “sense strand.”
- Derivative refers to HFP or a chemical modification of its nucleic acid. This chemical modification can be Replace a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
- Antibody refers to a complete antibody molecule and its fragments, such as Fa,? ( ⁇ ') 2 and? It can specifically bind to the epitope of peroxidase 9.
- a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
- isolated refers to the removal of a substance from its original environment (for example, its natural environment if it is naturally occurring).
- a naturally-occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
- Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not part of its natural environment, they are still isolated.
- isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
- polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances in the natural state .
- isolated peroxidase 9 means that peroxidase 9 is substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated. Those skilled in the art can purify peroxidase 9 using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of the peroxidase 9 polypeptide can be analyzed by amino acid sequence.
- the present invention provides a new polypeptide, peroxidase 9, which basically consists of the amino acid sequence shown in SEQ ID NO: 2.
- the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
- the polypeptides of the present invention may be naturally purified products or chemically synthesized products, or produced using recombinant techniques from prokaryotic or eukaryotic hosts (e.g., bacteria, yeast, higher plants, insects, and mammalian cells). Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
- the invention also includes fragments, derivatives and analogs of peroxidase 9.
- fragment refers to a polypeptide that substantially maintains the same biological function or activity of the peroxidase 9 of the present invention.
- a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a type in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution
- the amino acid may or may not be encoded by the genetic codon; or ( ⁇ ) such a group in which one or more amino acid residues Substituting by other groups to include substituents; or (III) such that the mature polypeptide is fused with another compound (such as a compound that extends the half-life of the polypeptide, such as polyethylene glycol); or (IV) such a,
- a polypeptide sequence (such as a leader sequence or a secreted sequence or a sequence used to purify this polypeptide or a protease sequence) formed by fused additional amino acid sequences into a mature polypeptide.
- such fragments, derivatives and analogs are considered to be within the knowledge of those skilled in the art.
- the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
- the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
- the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a full-length polynucleotide sequence of 1675 bases and its open reading frame of 504-749 encodes 81 amino acids. According to the comparison of gene chip expression profiles, it was found that this polypeptide has a similar expression profile as peroxidase, and it can be deduced that peroxidase 9 has a similar function as peroxidase.
- the polynucleotide of the present invention may be in the form of DNA or RNA.
- DNA forms include cDNA, genomic DM, or synthetic DNA.
- DNA can be single-stranded or double-stranded.
- DNA can be coding or non-coding.
- the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
- a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
- the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
- polynucleotide encoding a polypeptide refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.
- the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
- Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
- an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
- the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity between the two sequences).
- the present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions.
- "strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 6 (TC; or (2) Cross When using a denaturant, such as 50 ° /. (V / v) formamide, 0.1% calf serum / 0.1 ° /.
- the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
- nucleic acid fragments that hybridize to the sequences described above.
- a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 cores. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques, such as PCR, to identify and / or isolate polynucleotides encoding peroxidase 9.
- polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
- the specific polynucleotide sequence encoding peroxidase 9 of the present invention can be obtained by various methods.
- polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
- the MA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the DM of the genome; 2) chemically synthesizing the DM sequence to obtain the double-stranded DNA of the polypeptide.
- genomic DM is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences.
- the standard method for isolating the cDNA of interest is to isolate niRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library.
- mRM plasmid or phage cDNA library.
- kits are also commercially available (Qiagene).
- construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spiring Harbor Laboratory. New York, 1989).
- Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
- genes of the present invention can be screened from these cDM libraries by conventional methods. These methods include (but are not limited to): (1) DM-DM or DM-RNA hybridization; (2) the presence or absence of marker gene functions; (3) determination of the level of peroxidase 9 transcripts; (4) Detection of gene-expressed protein products by immunological techniques or determination of biological activity. The above methods can be used singly or in combination.
- the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides. In addition, the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
- the probe used here is generally a DM sequence chemically synthesized based on the gene sequence information of the present invention. The gene or fragment of the present invention may of course Used as a probe. DM probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
- the protein product of the peroxidase 9 gene expression can be detected by immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA).
- a method (Saiki, et al. Science 1985; 230: 1350-1354) using PCR technology to amplify DNA / RNA is preferably used to obtain the gene of the present invention.
- the RACE method RACE-rapid amplification of cDNA ends
- the primers used for PCR can be based on the polynucleotide sequence information of the present invention disclosed herein. It is appropriately selected and synthesized by a conventional method.
- the amplified DNA / RM fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
- polynucleotide sequence of the gene of the present invention or various DM fragments and the like obtained as described above can be measured by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, sequencing needs to be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDM sequence.
- the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell genetically engineered using the vector of the present invention or directly using a peroxidase 9 coding sequence, and a method for producing a polypeptide of the present invention by recombinant technology. .
- a polynucleotide sequence encoding peroxidase 9 may be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
- vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
- Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors expressed in bacteria (Rosenberg, et al.
- any plasmid and vector can be used to construct a recombinant expression vector.
- An important feature of expression vectors is that they usually contain origins of replication, promoters, marker genes, and translational regulatory elements.
- DM sequences encoding peroxidase 9 and appropriate transcriptional / translational regulatory elements can be used to construct expression vectors containing DM sequences encoding peroxidase 9 and appropriate transcriptional / translational regulatory elements. These methods include in vitro recombinant DM technology, DNA synthesis technology, and in vivo recombination technology (Sambroook, et al. Molecular Cloning, a Laboratory Manual, Cold Spiring Harbor Laboratory. New York, 1989).
- the DM sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis. Representative examples of these promoters are: the lac or trp promoter of E.
- the expression vector also includes a ribosome binding site and a transcription terminator for translation initiation. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers on the late side of the origin of replication, and adenoviral enhancers.
- the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
- selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
- GFP fluorescent protein
- tetracycline or ampicillin resistance for E. coli.
- a polynucleotide encoding peroxidase 9 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a genetically engineered host cell containing the polynucleotide or the recombinant vector.
- host cell refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell.
- Escherichia coli, Streptomyces bacterial cells such as Salmonella typhimurium
- fungal cells such as yeast
- plant cells insect cells
- fly S2 or Sf9 animal cells
- animal cells such as CH0, COS or Bowes melanoma cells.
- Transformation of a host cell with a D sequence according to the present invention or a recombinant vector containing the DM sequence can be performed using conventional techniques well known to those skilled in the art.
- the host is a prokaryote such as E. coli
- competent cells capable of absorbing DNA can be harvested after exponential growth and treated with CaCl. The steps used are well known in the art. Alternatively, MgCl 2 is used. If necessary, transformation can also be performed by electroporation.
- the host is a eukaryotic organism, the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
- polynucleotide sequence of the present invention can be used to express or produce recombinant peroxidase 9 (Science, 1984; 224: 1431). Generally there are the following steps:
- the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. When host cells grow to proper After inducing the cell density, the appropriate promoter (such as temperature conversion or chemical induction) is used to induce the selected promoter, and the cells are cultured for a period of time.
- the appropriate promoter such as temperature conversion or chemical induction
- the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If necessary, the recombinant protein can be isolated and purified by various separation methods using its physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
- conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid
- polypeptides of the present invention as well as antagonists, agonists and inhibitors of the polypeptides, can be directly used in the treatment of diseases, for example, they can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection, and immune diseases.
- Peroxidase is a heme-binding enzyme that performs a series of biosynthesis and degradation by using hydrogen peroxide as an electron acceptor. Peroxide and microperoxide contain a large amount of peroxidase. In some pathological processes of the human body, such as viral hepatitis, Borrelia infection, increased peroxisomes can occur. Studies have found that myeloperoxidase (MP0) is mainly present in granulocytes and monocytes, and MP0 plays an important role in neutrophil-dependent bactericidal systems. It has also been found that peroxidase-thyroid peroxidase (TP0) is involved in the biosynthesis of thyroid hormones.
- MP0 myeloperoxidase
- TP0 peroxidase-thyroid peroxidase
- peroxidase 9 of the present invention will produce various diseases, especially various inflammations, immune system diseases, and thyroid diseases. These diseases include, but are not limited to:
- inflammatory abnormalities caused by various infections and traumas such as viral hepatitis, Borrelia infection, tuberculosis, HIV, syphilis, allergic reactions, bronchial asthma, sarcoidosis, rheumatoid arthritis, rheumatoid arthritis, Osteoarthritis, glomerulonephritis, immune complex glomerulonephritis, acute anterior uveitis, dermatomyositis, urticaria, atopic dermatitis, hemochromatosis, Addison's disease, Graves's Disease,-Chronic Active Hepatitis, Intestinal Emergency Syndrome, Atrophic Gastritis, Systemic Lupus Erythematosus, Cerebral Spinal Multiple Sclerosis, Guillain-Barre Syndrome, Intracranial Granuloma, Wegener Granulomatosis, Autoimmune Thyroiditis , Autoimmune interstitial nephritis,
- Immune system diseases antibody-based primary specific immunodeficiency disease, combined immunodeficiency disease, immunodeficiency disease lacking phagocytic cells, complement system deficiency disease, Down syndrome, biotin dependence Carboxylase deficiency, Dun Can syndrome, thymoma, chronic disease cutaneous mucosal candidiasis, aplastic anemia, Di George syndrome, Wiscot t-Aldr ich syndrome, immunodeficiency with ataxia capillary dilatation Disease, acquired immunodeficiency syndrome
- Thyroid disease toxic goiter, non-toxic goiter, cretinism, myxedema, thyroiditis
- the abnormal expression of the peroxidase 12 of the present invention will also produce certain hereditary, hematological and immune system diseases.
- the invention also provides methods for screening compounds to identify agents that increase (agonist) or inhibit (antagonist) peroxidase 9.
- Agonists enhance peroxidase 9 to stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
- mammalian cells or membrane preparations expressing peroxidase 9 can be cultured with labeled peroxidase 9 in the presence of drugs. The ability of the drug to increase or block this interaction is then determined.
- Antagonists of peroxidase 9 include antibodies, compounds, receptor deletions, and the like that have been screened.
- An antagonist of peroxidase 9 can bind to peroxidase 9 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot perform a biological function.
- peroxidase 9 When screening compounds as antagonists, peroxidase 9 can be added to a bioanalytical assay to determine whether a compound is an antagonist by measuring the effect of the compound on the interaction between peroxidase 9 and its receptor. Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds.
- Polypeptide molecules capable of binding to peroxidase 9 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. During screening, the peroxidase 9 molecule should generally be labeled.
- the present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies.
- the invention also provides antibodies directed against peroxidase 9 epitopes. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by Fab expression libraries.
- polyclonal antibodies can be obtained by direct injection of peroxidase 9 into immunized animals (such as rabbits, mice, rats, etc.).
- immunized animals such as rabbits, mice, rats, etc.
- adjuvants can be used to enhance the immune response, including but not limited to Freund's adjuvant.
- Techniques for preparing monoclonal antibodies to peroxidase 9 include, but are not limited to, hybridoma technology (Kohler and Mistein. Nature, 1975, 256: 495-497), triple tumor technology, human beta-cell hybridoma technology, EBV -Hybridoma technology, etc.
- the chimeric antibody variable region and a human constant region of non-human origin in combination produce the available prior art (Morri son et al, PNAS, 1985, 81: 6851) 0 Ersi some production techniques of single chain antibodies (US Pat No. 4946778) can also be used to produce single chain antibodies against peroxidase 9.
- Anti-peroxidase 9 antibodies can be used in immunohistochemistry to detect peroxidase 9 in biopsy specimens.
- Monoclonal antibodies that bind to peroxidase 9 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
- Antibodies can also be used to design immunotoxins that target a particular part of the body.
- peroxidase 9 high affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
- a common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
- This hybrid antibody can be used to kill peroxidase 9 positive cells.
- the antibodies of the present invention can be used to treat or prevent diseases related to peroxidase 9.
- Administration of an appropriate dose of antibody can stimulate or block the production or activity of peroxidase 9.
- the invention also relates to a diagnostic test method for quantitative and localized detection of peroxidase 9 levels.
- tests are well known in the art and include FISH assays and radioimmunoassays.
- the level of peroxidase 9 detected in the test can be used to explain the importance of peroxidase 9 in various diseases and to diagnose diseases in which peroxidase 9 plays a role.
- polypeptide of the present invention can also be used for peptide mapping analysis.
- the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
- the polynucleotide encoding peroxidase 9 can also be used for a variety of therapeutic purposes. Gene therapy techniques can be used to treat abnormalities in cell proliferation, development, or metabolism caused by peroxidase 9 expression or abnormal / inactive expression.
- Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated peroxidase 9 to inhibit endogenous peroxidase 9 activity.
- a mutated peroxidase 9 may be a shortened peroxidase 9 that lacks a signaling domain. Although it can bind to a downstream substrate, it lacks signaling activity. Therefore, recombinant gene therapy vectors can be used to treat diseases caused by abnormal expression or activity of peroxidase.
- Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to transfer a polynucleotide encoding peroxidase 9 into a cell.
- Methods for constructing recombinant viral vectors carrying a polynucleotide encoding a peroxidase 9 can be found in the existing literature (Sarabrook, et al.).
- the recombinant polynucleotide encoding peroxidase 9 can be packaged into liposomes and transferred into cells.
- a method for introducing a polynucleotide into a tissue or a cell includes: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell through a vector (such as a virus, phage, or plasmid) in vitro, The cells are then transplanted into the body and the like.
- a vector such as a virus, phage, or plasmid
- Oligonucleotides including antisense RNA and DM
- ribozymes that inhibit peroxidase 9 mRNA are also within the scope of the present invention.
- a ribozyme is an enzyme-like RNA molecule that can specifically decompose a specific RM. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation.
- Antisense MA, DNA, and ribozymes can be obtained by any existing MA or DM synthesis technology, such as the solid-phase phosphate amide chemical synthesis method to synthesize oligonucleotides has been widely used.
- Antisense RM molecules can be obtained by transcription of the MA sequence encoding the RNA in vitro or in vivo. This DNA sequence has been integrated downstream of the MA polymerase promoter of the vector. In order to increase the stability of the nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the phosphorothioate or peptide bond instead of the phosphodiester bond is used for the ribonucleoside linkage.
- the polynucleotide encoding peroxidase 9 can be used for the diagnosis of diseases related to peroxidase 9.
- a polynucleotide encoding peroxidase 9 can be used to detect the expression of peroxidase 9 or the abnormal expression of peroxidase 9 in a disease state.
- the DNA sequence encoding peroxidase 9 can be used to hybridize biopsy specimens to determine the expression of peroxidase 9.
- Hybridization techniques include Southern blotting, Northern blotting, and in situ hybridization. These techniques and methods are all mature and open technologies, and related kits are commercially available.
- a part or all of the polynucleotide of the present invention can be used as a probe and fixed on a microarray or a DNA chip (also referred to as a "gene chip") for analyzing differential expression analysis of genes and genetic diagnosis in tissues.
- Peroxidase 9 specific primers can also be used to detect peroxidase 9 transcripts by in vitro amplification of RNA-polymerase chain reaction (RT-PCR).
- Peroxidase 9 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type peroxidase 9 DM sequence. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR, and in situ hybridization. In addition, mutations may affect protein expression. Therefore, the Nor thern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
- sequences of the invention are also valuable for chromosome identification. This sequence will specifically target a specific position on a human chromosome and can hybridize to it. Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for marking chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DNA sequences on a chromosome.
- PCR primers (preferably 15-35bp) are prepared according to cDM, and the sequences can be located on chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
- PCR localization of somatic hybrid cells is a quick way to localize MA to specific chromosomes.
- sublocalization can be achieved by a similar method using a set of fragments from a specific chromosome or a large number of genomic clones.
- Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and hybrid pre-selection to construct a chromosome-specific C library.
- Fluorescent in situ hybridization of cDM clones with metaphase chromosomes allows precise chromosomal localization in one step.
- FISH Fluorescent in situ hybridization
- the difference in cDNA or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the CDM that is accurately mapped to a disease-related chromosomal region can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution Capacity and one gene per 20kb).
- the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
- suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
- the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
- the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
- a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
- these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell.
- the polypeptides of the invention can be used in combination with other therapeutic compounds.
- the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
- Peroxidase 9 is administered in an amount effective to treat and / or prevent a specific indication.
- the amount and dose range of peroxidase 9 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician. Examples
- RNA Human fetal brain total RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform.
- Poly (A) mRNA was isolated from total UNA using Quik mRNA Isolat ion Kit (product of Qiegene). 2ug poly (A) mRNA is reverse transcribed to form cDNA.
- the Smart cDM cloning kit purchased from Clontech
- Dye terminate cycle react ion sequencing kit Perkin-Elmer
- ABI 377 automatic sequencer Perkin-Elraer
- the determined cDM sequence was compared with the existing sequence database (Genebank), and it was found that the cDNA sequence of one clone 0046f02 was new DNA.
- a series of primers were synthesized to perform bidirectional determination of the inserted cDM fragments contained in this clone.
- CDNA was synthesized using fetal brain cell total MA as a template and ol igo-dT as a primer for reverse transcription reaction. After purification using Q i agene's kit, the following primers were used for PCR amplification:
- Pr imer 1 5'- ATCCCTCTGCAACTTTACACATTC -3 '(SEQ ID NO: 3)
- Pr imer2 5'- AGACAGGGTCTTACTCTGTCGCCC-3, (SEQ ID NO: 4)
- Primerl is a forward sequence located at the 5th end of SEQ ID NO: 1, starting at lbp;
- Primer2 is the 3 'end reverse sequence in SEQ ID NO: 1.
- Amplification reaction conditions containing 50mmol / L KCl in a reaction volume of 50 ⁇ 1, 10mmol / L Tris-HCl P H8 5, 1. 5mmol / L MgCl 2, 2 (mol / L dNTP, l Opmol primer. . 1U of Taq the DM polymerase (Clontech Co.) in DM type PE9600 thermal cycler (Perkin-Elmer Co.) by 25 cycles of the following reaction conditions: 94 Q C 30sec; 55 ° C 30sec; 72 ° C 2min 0 in During RT-PCR, ⁇ -act in was used as a positive control and template blank was used as a negative control.
- Amplification products were purified using a QIAGEN kit and TA The cloning kit was ligated to a pCR vector (Invitrogen). The DNA sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as 1-1675bp shown in SEQ ID NO: 1.
- This method involves acid guanidinium thiocyanate phenol-chloroform extraction. That is, the tissue is homogenized with 4M guanidine isothiocyanate-25 ⁇ M sodium citrate, 0.23 ⁇ 41 sodium acetate (114..0), and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1), centrifuge after mixing. The aqueous layer was aspirated, isopropanol (0.8 vol) was added and the mixture was centrifuged to obtain RNA precipitate. The obtained A precipitate was washed with 70% ethanol, dried and dissolved in water.
- Electrophoresis was performed on a 1.2% agarose gel containing 2 g of RNA on 20 mM 3- (N-morpholino) propanesulfonic acid (pH 7.0)-5 mM sodium acetate-1 mM EDTA-2.2M formaldehyde. Then transferred to nitrocellulose by o -. 32 P dATP Preparation DM 32 P- labeled probes by random priming SYSTEM DNA probes used for PCR amplification shown in FIG. 9 peroxidase coding region. Sequence (504bp to 749bp).
- 32P-labeled probe (about 2 x 10 6 cpm / ml) was hybridized with a nitrocellulose membrane to which RNA was transferred at 42 ° C overnight in a solution containing 50% formazan Amide-25mM H 2 P0 4 (pH7.4)-5 x SSC-5 x Denhardt, s solution and 200 ⁇ ⁇ / ⁇ 1 salmon sperm DM. After hybridization, the filter was placed in 1 x SSC-0.1% SDS at 55 ° C. Wash for 30 min. Then, use Phosphor Imager for analysis and quantification.
- Example 4 In vitro expression, isolation and purification of recombinant peroxidase 9
- Priraer3 5'-CCCCATATGATGATTTGCAACAACAAATTACAA-3 '(Seq ID No: 5)
- Primer4 5' -CCCAAGCTTTCATAATTGGTTGTAGTCAATTCT- 3 '(Seq ID No: 6)
- the 5' ends of these two primers contain Ndel and Hindlll restriction sites, respectively.
- the coding sequences of the 5 ,, and 3 'ends of the gene of interest are followed, respectively.
- the Ndel and Hindlll restriction sites correspond to the selectivity within the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865.3). Digestion site.
- PCR reaction was performed using the pBS-0046f02 plasmid containing the full-length target gene as a template.
- PCR reaction conditions were: 1 in a total volume of 50 ⁇ plasmid pBS-0046f02 containing 10pg, primers Pr imer-3 and Primer-4, respectively lOpmol, Advantage polymerase Mix (Clontech Products) 1 ⁇ 1.
- Cycle parameters 94. C 20s, 60 ° C 30s, 68. C 2 min, a total of 25 cycles.
- Ndel and Hindlll were used to double-digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase.
- the ligation product was transformed into E. coli DH5a by the calcium chloride method. After culturing overnight on LB plates containing kanamycin (final concentration 3 ( ⁇ g / ml)), the positive clones were screened by colony PCR method and sequenced. The correct positive clone (pET-0046f02) was recombined by the calcium chloride method The plasmid was transformed into E. coli BL21 (DE3) plySs (product of Novagen).
- the host bacteria BL21 (pET-0046f 02) was cultured at 37 ° C to the logarithmic growth phase, and IPTG was added to a final concentration of 1 mmol / L Continue to cultivate for 5 hours.
- the bacteria were collected by centrifugation, and the supernatant was collected by centrifugation.
- the supernatant was subjected to centrifugation, and chromatography was performed using an affinity chromatography column His s.
- Bind Quick Cartridge product of Novagen capable of binding 6 histidines (6His-Tag).
- the purified protein peroxidase 9 was obtained.
- the suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in various aspects.
- the probes can be used to hybridize to the genome or CDM library of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
- the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
- the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by using a filter hybridization method.
- Filter hybridization methods include dot blotting, Southern blotting, Northern blotting, and copying methods. They all use the same steps of hybridization after fixing the polynucleotide sample to be tested on the filter.
- the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer so that the non-specific binding site of the sample on the filter is loaded And synthetic polymers.
- the pre-hybridization solution is then replaced with a hybridization buffer containing the labeled probe and incubated to hybridize the probe to the target nucleic acid.
- the unhybridized probes are removed by a series of membrane washing steps.
- This embodiment utilizes higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals.
- the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
- the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
- the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
- oligonucleotide fragments from the polynucleotide SEQ ID NO: 1 of the present invention for use as hybridization probes should follow the following principles and several aspects to be considered:
- the preferred range of probe size is 18-50 nucleotides
- Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements The regions are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, then the primary probe should not be used;
- Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
- Probe 2 which belongs to the second type of probe, is equivalent to the replacement mutation sequence (41Nt) of the gene fragment of SEQ ID NO: 1 or its complementary fragment:
- PBS phosphate buffered saline
- step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
- NC membranes nitrocellulose membranes
- Two NC membranes are required for each probe, so that they can be used in the following experimental steps.
- the film was washed with high-strength conditions and strength conditions, respectively.
- the sample membrane was placed in a plastic bag, and 3-10 tng of pre-hybridization solution (10 x Denhardt's; 6 x SSC, 0.1 mg / ml CT DNA (calf thymus DM)) was added. After sealing the bag, 68. C water bath for 2 hours.
- pre-hybridization solution 10 x Denhardt's; 6 x SSC, 0.1 mg / ml CT DNA (calf thymus DM)
- Gene chip or gene microarray is a new technology currently being developed by many national laboratories and large pharmaceutical companies.
- the data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software to achieve the purpose of rapid, efficient, and high-throughput analysis of biological information.
- the polynucleotide of the present invention can be used as a target DM for gene chip technology for high-throughput research of new gene functions; search for and screen new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases, such as genetic diseases .
- the specific method steps have been reported in the literature. For example, see the documents DeRis i, JL, Lyer, V. & Brown, PO (1997) Science 278, 680-686. And the documents Helle, RA, Schema, M. , Chai, A., Shalom, D., (1997) PNAS 94: 2150-2155.
- a total of 4,000 polynucleotide sequences of various full-length cDM are used as target DM, including the polynucleotide of the present invention. They were respectively amplified by PCR. After the purified amplified product was purified, the concentration was adjusted to about 500 ng / ul, and spotted on a glass medium with a Cartesian 7500 spotter (purchased from Cartesian Company, USA). The distance between them is 280 ⁇ m. The spotted slides were hydrated, dried, and placed in UV Cross-link in the cross-linker, and then dry after elution to fix D on a glass slide to prepare a chip. The specific method steps have been reported in the literature. The sample post-processing steps in this embodiment are:
- the total mRNA was extracted from the human mixed tissue and the specific tissue (or stimulated cell line) of the body in one step, and the mRNA was purified by Ol igotex mRNA Midi Kit (purchased from QiaGen), and separated by reverse transcription!
- the fluorescent reagent Cy3dUTP (5-Amino-propargyl-2'-deoxyuridine 5'-triphate coupled to Cy3 fluorescent dye, purchased from Amersham Phamacia Biotech) was used to label the mRNA of human mixed tissues
- Cy5dUTP (5-Amino -propargyl-2'-deoxyur idine 5'-triphate coupled to Cy5 fluorescent dye, purchased from Amersham Phamacia Biotech Company, labeled a specific tissue (or stimulated cell line) m A of the body, and the probe was prepared after purification.
- the probes from the above two tissues were hybridized with the chip in UniHyb TM Hybridization Solution (purchased from TeleChem) hybridization solution for 16 hours, and washed with a washing solution (lx SSC, 0.2% SDS) at room temperature. Scanning was then performed with a ScanArray 3000 scanner (purchased from General Scanning, USA). The scanned images were analyzed and processed with Imagene software (Biodiscovery, USA) to calculate the Cy3 / Cy5 ratio of each point.
- the above specific tissues are bladder mucosa, PMA + Ecv304 cell line, LPS + Ecv304 cell line thymus, normal fibroblasts 1024NC, Fibroblast, growth factor stimulation, 1024NT, scar-like fc growth factor stimulation 1013HT, scar into fc to stimulate with growth factors, G13fiC, bladder cancer cell EJ, bladder cancer, bladder cancer, liver cancer, liver cancer cell line, fetal skin, spleen, prostate cancer, jejunum adenocarcinoma, cardia cancer. Based on these 17 Cy3 / Cy5 ratios, a histogram is drawn (Figure 1). It can be seen from the figure that the expression profile of peroxidase 9 and peroxidase according to the present invention are very similar.
Abstract
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
AU89491/01A AU8949101A (en) | 2000-05-24 | 2001-05-21 | A novel polypeptide homo peroxidase 9 and polynucleotide encoding said polypept ide |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN 00115848 CN1324939A (zh) | 2000-05-24 | 2000-05-24 | 一种新的多肽——过氧化物酶9和编码这种多肽的多核苷酸 |
CN00115848.1 | 2000-05-24 |
Publications (1)
Publication Number | Publication Date |
---|---|
WO2001092317A1 true WO2001092317A1 (fr) | 2001-12-06 |
Family
ID=4585290
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/CN2001/000844 WO2001092317A1 (fr) | 2000-05-24 | 2001-05-21 | Nouveau polypeptide, peroxydase 9, et polynucleotide codant ce polypeptide |
Country Status (3)
Country | Link |
---|---|
CN (1) | CN1324939A (fr) |
AU (1) | AU8949101A (fr) |
WO (1) | WO2001092317A1 (fr) |
Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN1133062A (zh) * | 1993-10-13 | 1996-10-09 | 诺沃挪第克公司 | 对过氧化氢稳定的过氧化物酶变体 |
-
2000
- 2000-05-24 CN CN 00115848 patent/CN1324939A/zh active Pending
-
2001
- 2001-05-21 WO PCT/CN2001/000844 patent/WO2001092317A1/fr active Application Filing
- 2001-05-21 AU AU89491/01A patent/AU8949101A/en not_active Abandoned
Patent Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN1133062A (zh) * | 1993-10-13 | 1996-10-09 | 诺沃挪第克公司 | 对过氧化氢稳定的过氧化物酶变体 |
Non-Patent Citations (2)
Title |
---|
CHEN JIANBO ET AL.: "Catalytic reaction mechanism of peroxidase and dynamics research thereof", JOURNAL OF MOLECULAR CATALYSIS, vol. 13, no. 4, 1999, pages 312 - 320, XP002905555 * |
LIU ZHIMING: "Determination of serum peroxidase activity and its value in the diagnosis of hepatocellular carcinoma", ACTA ACADEMIAE MEDICINAE GUANGXI, vol. 13, no. 3, 1996, pages 31 - 33 * |
Also Published As
Publication number | Publication date |
---|---|
CN1324939A (zh) | 2001-12-05 |
AU8949101A (en) | 2001-12-11 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
WO2001079490A1 (fr) | Nouveau polypeptide, proteine antigene prostatique specifique membranaire 16, et polynucleotide codant pour ce polypeptide | |
WO2001092317A1 (fr) | Nouveau polypeptide, peroxydase 9, et polynucleotide codant ce polypeptide | |
WO2001094406A1 (fr) | Nouveau polypeptide, dihydropyridine-acide dicarboxylique deshydrogenase 21, et polynucleotide codant ce polypeptide | |
WO2001072815A1 (fr) | Nouveau polypeptide, ferredoxine humaine 12, et polynucleotide codant pour ce polypeptide | |
WO2001046430A1 (fr) | Nouveau polypeptide, peroxydase 12, et polynucleotide codant pour ce polypeptide | |
WO2001092541A1 (fr) | Nouveau polypeptide, catalase 12, et polynucleotide codant ce polypeptide | |
WO2001075125A1 (fr) | Nouveau polypeptide, serine hydrolase humaine atp-dependante 31, et polynucleotide codant pour ce polypeptide | |
WO2001064734A1 (fr) | Nouveau polypeptide, cathepsine humaine 18, et polynucleotide codant pour ce polypeptide | |
WO2001088158A1 (fr) | Nouveau polypeptide, triose phosphate isomerase humaine 10, et polynucleotide codant pour ce polypeptide | |
WO2001072983A1 (fr) | Nouveau polypeptide, peroxydase humaine 11, et polynucleotide codant pour ce polypeptide | |
WO2001053492A1 (fr) | Nouveau polypeptide, s-adenosylmethionine synthetase 31, et polynucleotide codant pour ce polypeptide | |
WO2001072803A1 (fr) | Nouveau polypeptide, proteine humaine a doigt de zinc 15, et polynucleotide codant pour ce polypeptide | |
WO2001046253A1 (fr) | Nouveau polypeptide, calcitonine 11, et polynucleotide codant pour ce polypeptide | |
WO2001047993A1 (fr) | Nouveau polypeptide, proteine d'echange anionique 9, et polynucleotide codant pour ce polypeptide | |
WO2001075034A2 (fr) | Nouveau polypeptide, peroxydase proteine humaine 15, et polynucleotide codant pour ce polypeptide | |
WO2001075005A2 (fr) | Nouveau polypeptide, sous-unite c de l'atpase pompe a protons vacuolaire (v-atpase) 12, et polynucleotide codant pour ce polypeptide | |
WO2001074880A1 (fr) | Nouveau polypeptide, peroxydase proteine humaine 10, et polynucleotide codant pour ce polypeptide | |
WO2002026971A1 (fr) | Nouveau polypeptide, facteur de transcription humain lcr-f112.1, et polynucleotide codant ce polypeptide | |
WO2001075035A2 (fr) | Nouveau polypeptide, peroxydase proteine humaine 9, et polynucleotide codant pour ce polypeptide | |
WO2001083676A2 (fr) | Nouveau polypeptide, phosphatase humaine 10 fortement striee, et polynucleotide codant pour ce polypeptide | |
WO2001090131A1 (fr) | Nouveau polypeptide, proteine humaine 10.56 du gene cancerigene tre, et polynucleotide codant ce polypeptide | |
WO2002020583A1 (fr) | Nouveau polypeptide, facteur humain de transcription lcr-f19.02, et polynucleotide codant ce polypeptide | |
WO2001072805A1 (fr) | Nouveau polypeptide, sous-unite humaine 14.19 de flavoproteine, et polynucleotide codant pour ce polypeptide | |
WO2002020575A1 (fr) | Nouveau polypeptide, proteine humaine 10 associee aux maladies auto-immunes, et polynucleotide codant ce polypeptide | |
WO2001070792A1 (fr) | Nouveau polypeptide, tyrosinase humaine 12, et polynucleotide codant pour ce polypeptide |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A1 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
122 | Ep: pct application non-entry in european phase | ||
NENP | Non-entry into the national phase |
Ref country code: JP |