WO2001072805A1 - Nouveau polypeptide, sous-unite humaine 14.19 de flavoproteine, et polynucleotide codant pour ce polypeptide - Google Patents

Nouveau polypeptide, sous-unite humaine 14.19 de flavoproteine, et polynucleotide codant pour ce polypeptide Download PDF

Info

Publication number
WO2001072805A1
WO2001072805A1 PCT/CN2001/000455 CN0100455W WO0172805A1 WO 2001072805 A1 WO2001072805 A1 WO 2001072805A1 CN 0100455 W CN0100455 W CN 0100455W WO 0172805 A1 WO0172805 A1 WO 0172805A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
polynucleotide
human
flavin protein
human flavin
Prior art date
Application number
PCT/CN2001/000455
Other languages
English (en)
Chinese (zh)
Inventor
Yumin Mao
Yi Xie
Original Assignee
Shanghai Biowindow Gene Development Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shanghai Biowindow Gene Development Inc. filed Critical Shanghai Biowindow Gene Development Inc.
Priority to AU58161/01A priority Critical patent/AU5816101A/en
Publication of WO2001072805A1 publication Critical patent/WO2001072805A1/fr

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides

Definitions

  • the present invention belongs to the field of biotechnology. Specifically, the present invention describes a novel polypeptide—human flavin protein subunit 1 4.19, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and the polypeptide.
  • fumarate reductase which requires an anaerobic environment
  • succinate dehydrogenase which requires an aerobic environment.
  • Both enzymes are composed of two parts, an outer membrane part including a flavin protein that binds FAD and an iron sulfur protein, and a hydrophobic part consisting of a membrane fixation protein and / or a cytochrome B.
  • Eukaryotic mitochondrial succinate dehydrogenase (coenzyme Q) consists of two subunits, a flavin protein and an iron sulfur protein.
  • Flavin protein subunit 9 is a polypeptide with a molecular weight of about 60-70KD.
  • the N-terminus has a conserved sequence: R- (ST) -H- (ST) -X (2) -AXGG, H is the FAD binding site, The 8a-CH2 group on the isofrazine of flavin is bound to the N-3 of histidine through a covalent bond.
  • Flavin protein subunit 9 also has some highly conserved sequences. Four hydrophobic residues near the N-terminus form a P ⁇ ⁇ structure, followed by a side chain formed by an a-helix and a hydrophobic fold. These sequences bind to the AMP portion of the FAD molecule through non-covalent bonds. In addition, another AMP-binding domain is formed at about 300-400 residues downstream of the N-terminus.
  • FAD binding is affected by changes in redox potential.
  • the human lutein protein subunit 14.19 protein plays an important role in regulating important functions of the body, such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes, so it has been necessary to identify more proteins in the art. Many human flavin protein subunit 14.19 proteins involved in these processes, especially the amino acid sequence of this protein is identified. Isolation of the new human flavin protein subunit 14.19 protein encoding gene also provides a basis for the study to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so it is important to isolate its coding DNA. Object of the invention
  • Another object of the invention is to provide a polynucleotide encoding the polypeptide.
  • Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding a human flavin protein subunit 14.19.
  • Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding a human flavin protein subunit 14.19.
  • Another object of the present invention is to provide a method for producing human flavin protein subunit 14.1.
  • Another object of the present invention is to provide antibodies against the human flavin protein subunits 14. 19 of the polypeptide of the present invention.
  • Another object of the present invention is to provide mimic compounds, antagonists, agonists, and inhibitors directed to the polypeptide of the present invention, human flavin protein subunits 14.19.
  • Another object of the present invention is to provide a method for diagnosing and treating diseases associated with abnormalities in human flavin protein subunits 14.19. Summary of invention
  • the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
  • the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
  • sequence of the polynucleotide is one selected from: (a) a sequence having positions 154-543 in SEQ ID NO: 1; and (b) having a sequence of 1-1237 in SEQ ID NO: 1 Sequence of bits.
  • the present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
  • the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
  • the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit human flavin protein subunit 14.19 protein activity, which comprises utilizing the polypeptide of the invention.
  • the invention also relates to compounds obtained by this method.
  • the invention also relates to an in vitro detection of diseases associated with abnormal expression of human flavin protein subunit 14.19 protein.
  • a method for susceptibility to a disease or disease comprising detecting mutations in the polypeptide or a sequence encoding a polynucleotide thereof in a biological sample, or detecting the amount or biological activity of the polypeptide of the present invention in a biological sample.
  • the invention also relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
  • the present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention in the manufacture of a medicament for treating cancer, developmental disease or immune disease or other diseases caused by abnormal expression of human flavin protein subunit 14.19.
  • Fig. 1 is a comparison diagram of gene chip expression profiles of human flavin protein subunit 14.19 and human flavin protein subunit 9 of the present invention.
  • the upper graph is a graph of the expression profile of the human flavin protein subunit 14. 19, and the lower graph is the graph of the expression profile of the human flavin protein subunit 9.
  • 1 indicates fetal kidney
  • 2 indicates fetal large intestine
  • 3 indicates fetal small intestine
  • 4 indicates fetal muscle
  • 5 indicates fetal brain
  • 6 indicates fetal bladder
  • 7 indicates non-starved L02
  • 8 indicates L02 +, l hr, As 3+
  • 9 ECV304 PMA-, 10 ECV304 PMA +, 11 fetal liver, 12 normal liver, 13 thyroid, 14 skin, 15 fetal lung, 16 lung, 17 lung cancer, 18 fetal spleen, 19
  • the spleen, 20 indicates the prostate
  • 21 indicates the fetal heart
  • 22 indicates the heart
  • 23 indicates muscle
  • 24 indicates the testis
  • 25 indicates the fetal thymus
  • 26 indicates the thymus.
  • Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of the isolated human flavin protein subunits 14.19. 14kDa is the molecular weight of the protein. The arrow indicates the isolated protein band.
  • Nucleic acid sequence refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
  • amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
  • amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
  • a protein or polynucleotide “variant” refers to an amino acid sequence having one or more amino acids or nucleotide changes, or a polynucleotide sequence encoding it.
  • the changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence.
  • Variants can have "conservative" changes, which The amino acid substituted in the amino acid has a structural or chemical property similar to that of the original amino acid, such as replacing isoleucine with leucine.
  • Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
  • “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
  • Insertion means that a change in the amino acid sequence or nucleotide sequence results in an increase in one or more amino acids or nucleotides compared to a molecule that exists in nature.
  • Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
  • Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
  • immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response and to bind specific antibodies in a suitable animal or cell.
  • An "agonist” refers to a molecule that, when combined with the human flavin protein subunits 14. 19, causes a change in the protein to regulate the activity of the protein.
  • An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that binds the human flavin protein subunit 14.19.
  • Antagonist refers to a molecule that can block or regulate the biological or immunological activity of human flavin protein subunit 14.19 when combined with human flavin protein subunit 14.19.
  • Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates or any other molecule that can bind to human flavin protein subunits 14.19.
  • Regular refers to a change in the function of human flavin protein subunit 14.19, including an increase or decrease in protein activity, a change in binding characteristics, and any other biological properties and functions of human flavin protein subunit 14.19. Or changes in immune properties.
  • Substantially pure means substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated.
  • Those skilled in the art can purify human flavin protein subunits using standard protein purification techniques 14.19.
  • Substantially pure human flavin protein subunits 14. 19 produce a single main band on a non-reducing polyacrylamide gel.
  • Human Flavin Protein Subunits 14.19 The purity of the polypeptide can be analyzed by amino acid sequence.
  • Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
  • sequence C-T-G-A
  • complementary sequence G-A-C-T.
  • the complementarity between two single-stranded molecules may be partial or complete.
  • the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
  • “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
  • Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. The inhibition of such hybridization can be detected by performing hybridization (Southern blotting or Nor thern blotting, etc.) under conditions of reduced stringency.
  • Substantially homologous sequences or hybridization probes can compete and inhibit the binding of completely homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.
  • Percent identity refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALIGN program (Lasergene sof tware package, DNASTAR, Inc., Madi son Wis.). The MEGALIGN program can compare two or more sequences according to different methods such as the Clus ter method (Hi gg ins, DG and PM Sharp (1988) Gene 73: 237-244). 0 The Clus ter method will check the distance between all pairs by Groups of sequences are arranged in clusters. The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula:
  • the percent identity between nucleic acid sequences can also be determined by the Cluster method or by methods known in the art such as Jotun He in (He in J., (1990) Methods in enzymology 183: 625-645).
  • Similarity refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
  • Amino acids used for conservative substitution for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
  • Antisense refers to a nucleotide sequence that is complementary to a particular DM or RNA sequence.
  • Antisense strand refers to a nucleic acid strand that is complementary to a “sense strand.”
  • Derivative refers to HFP or a chemical modification of its nucleic acid. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
  • Antibody refers to a complete antibody molecule and its fragments, such as Fa,? ( ⁇ ,) 2 and? It can specifically bind to the epitope of human flavin protein subunit 14.19.
  • a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
  • isolated refers to the removal of a substance from its original environment (for example, its natural environment if it is naturally occurring).
  • a naturally-occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
  • Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not part of its natural environment, they are still isolated.
  • isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
  • polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances existing in the natural state.
  • isolated human flavin protein subunit 14.19 means that human flavin protein subunit 14.19 is substantially free of other proteins, lipids, sugars, or other substances with which it is naturally associated. Those skilled in the art can purify the human flavin protein subunit 14.19 using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. Human Flavin Protein Subunit 14. 19 The purity of the polypeptide can be analyzed by amino acid sequence.
  • the present invention provides a new polypeptide, human flavin protein subunit 14.19, which is basically composed of the amino acid sequence shown in SEQ ID NO: 2.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
  • the polypeptides of the invention can be naturally purified products, or chemically synthesized products, or produced using recombinant techniques from prokaryotic or eukaryotic hosts (e.g., bacteria, yeast, higher plants, insects, and mammalian cells). Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
  • the invention also includes fragments, derivatives and analogs of human flavin protein subunits 14.19.
  • fragment refers to a polypeptide that substantially retains the same biological function or activity of the human flavin protein subunits 14.19 of the present invention.
  • a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution
  • the amino acid may or may not be encoded by a genetic codon; or ( ⁇ ) a type in which a group on one or more amino acid residues is replaced by another group to include a substituent; or ( ⁇ ⁇ )
  • Such a polypeptide sequence in which the mature polypeptide is fused with another compound such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol
  • a polypeptide sequence in which an additional amino acid sequence is fused into the mature polypeptide (Such as the leader or secretory sequence or the sequence used to purify the polypeptide or protease sequence).
  • such fragments, derivatives and analogs are considered to be within the knowledge of those skilled in the art.
  • the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
  • the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a polynucleotide sequence of 1,237 bases in length, and its open reading frames 154-543 encode 129 amino acids. According to the comparison of gene chip expression profiles, it was found that this peptide has a similar expression profile to human flavin protein subunit 9, and it can be deduced that the human flavin protein subunit 14.19 has similar functions to human flavin protein subunit 9.
  • the polynucleotide of the present invention may be in the form of DNA or RNA.
  • the DNA form includes cDM, genomic DNA, or synthetic DNA.
  • DNA can be single-stranded or double-stranded.
  • DNA can be coding or non-coding.
  • the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
  • a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
  • the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
  • polynucleotide encoding a polypeptide refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.
  • the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
  • Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
  • an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
  • the present invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity, between the two sequences).
  • the present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions.
  • “strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60 ° C; or (2) Add a denaturant during hybridization, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% F i co ll, 42 ° C, etc .; or (3) only between the two sequences Crosses occur at least 95% or more, and more preferably 97% or more.
  • the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
  • nucleic acid fragments that hybridize to the sequences described above.
  • a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, most preferably at least 100 nucleotides. Nucleotides or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques (such as PCR) to identify and / or isolate polynucleotides encoding human flavin protein subunits 14.19.
  • polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
  • the specific polynucleotide sequence encoding the human flavin protein subunit 14.19 of the present invention can be obtained by various methods.
  • polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
  • the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.
  • genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences.
  • the standard method for isolating the cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library. There are many mature techniques for extracting mRNA, and kits are also commercially available (Q i agene).
  • the construction of cDNA libraries is also a common method (Sambrook, eta l., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989).
  • Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
  • the genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DM-RNA hybridization; (2) the presence or absence of a marker gene function; (3) determining the level of the transcript of the human flavin protein subunit 14.19; ( 4) Detecting gene-expressed protein products by immunological techniques or by measuring biological activity. The above methods can be used singly or in combination.
  • the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
  • the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
  • the probe used here is usually a DM sequence chemically synthesized based on the gene sequence information of the present invention.
  • the genes or fragments of the present invention can of course be used as probes.
  • DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
  • immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) can be used to detect the protein product of the human flavin protein subunit 14.19 gene expression.
  • ELISA enzyme-linked immunosorbent assay
  • a method using PCR technology to amplify DM / RNA is preferably used to obtain the gene of the present invention.
  • the RACE method RACE-rapid cDNA end rapid amplification method
  • the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Select and synthesize using conventional methods.
  • the amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
  • polynucleotide sequence of the gene of the present invention or various D fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, sequencing needs to be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
  • the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell that is genetically engineered using the vector of the present invention or directly using the human flavin protein subunit 14.19 coding sequence, and a recombinant technology for producing the polypeptide of the present invention.
  • a polynucleotide sequence encoding human flavin protein subunit 14.19 can be inserted into a vector to form a recombinant vector containing the polynucleotide of the present invention.
  • vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
  • Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors expressed in bacteria (Rosenberg, et al.
  • any plasmid and vector can be used to construct recombinant expression vectors.
  • An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
  • Methods well known to those skilled in the art can be used to construct expression vectors containing DNA sequences encoding human flavin protein subunits 14. 19 and appropriate transcription / translation regulatory elements. These methods include in vitro recombinant DNA technology, DM synthesis technology, in vivo recombination technology, etc. (Sambroook, et al. Mo l ecu lar Cloning, a Labora tory Manua l, Co d Spring Harbor Labora tory. New York, 1989).
  • the DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis. Representative examples of these promoters are: l ac or trp promoter of E.
  • the expression vector also includes a ribosome binding site for translation initiation, a transcription terminator, and the like. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers from 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers and adenovirus enhancers on the late side of the origin of replication.
  • the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • GFP fluorescent protein
  • tetracycline or ampicillin resistance for E. coli.
  • a polynucleotide encoding a human flavin protein subunit 14.19 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to form a genetically engineered host containing the polynucleotide or the recombinant vector.
  • the term "host cell” refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E.
  • coli Streptomyces
  • bacterial cells such as Salmonella typhimurium
  • fungal cells such as yeast
  • plant cells such as fly S2 or Sf 9
  • animal cells such as CH0, COS or Bowes melanoma cells.
  • Transformation of a host cell with a DM sequence according to the present invention or a recombinant vector containing the DNA sequence can be performed by conventional techniques well known to those skilled in the art.
  • the host is a prokaryote such as E. coli
  • competent cells capable of DNA uptake can be in the exponential growth phase were harvested, treated with CaC l 2 method used in steps well known in the art. Alternatively, MgCl 2 is used.
  • transformation can also be performed by electroporation.
  • the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
  • the polynucleotide sequence of the present invention can be used for expression or production Recombinant human flavin protein subunit 14. 19 (Scence, 1984; 224: 1431). Generally there are the following steps:
  • the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
  • a suitable method such as temperature conversion or chemical induction
  • the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If necessary, the recombinant protein can be isolated and purified by various separation methods using its physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
  • conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid
  • polypeptides of the present invention as well as antagonists, agonists and inhibitors of the polypeptides, can be directly used in the treatment of diseases, for example, they can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection, and immune diseases.
  • Eukaryotic mitochondrial succinate dehydrogenase (coenzyme Q) consists of two subunits, flavin protein and iron sulfur protein.
  • succinic acid is converted to fumaric acid by catalysis of dehydrogenase catalyzed by succinate dehydrogenase.
  • fumaric acid can be converted to succinate by hydrogenation of fumarate reductase.
  • They all have specific FAD binding sites.
  • the polypeptide containing the specific FAD binding site of the present invention plays an important role in material and energy metabolism, and its abnormal expression can lead to diseases related to material and energy metabolism disorders, embryonic development disorders, growth and development disorders, and the like.
  • the abnormal expression of the human flavin protein subunit 14.19 of the present invention will produce various diseases, especially material and energy metabolism disorders, embryonic developmental disorders, growth and development disorders, and certain various tumors. These diseases include but not limited to:
  • Organic acidemia isovalerate, propionate, methylmalonic aciduria, combined carboxylase deficiency, glutarate type I
  • Diabetes-related diseases diabetic ketoacidosis, hypertonic non-ketogenic diabetic coma
  • Amino acid metabolism defects phenylketonuria, albinism, sulfur-containing amino acid metabolism defects, tryptophan metabolism defects such as tryptophanemia, branch amino acid metabolism defects, glycineemia, hypersarcosineemia, proline Acid and Hydroxyproline Metabolism Defects, Glutamate Metabolism Defects, Urea Cycle Metabolism Defects, Histidine Metabolism Defects, Lysine Metabolism Defects, and Other Amino Acid Metabolism Defects.
  • Mucopolysaccharidosis and other marginal diseases Mucopolysaccharidosis types I-VII, Mucopolysaccharidosis marginal diseases such as rheumatoid mucopolysaccharidosis, and mucolipid storage disease.
  • Purine and Pyrimidine Metabolism Defects Abnormal purine metabolism, such as Ray-niney syndrome, xanthineuria, abnormal pyrimidine metabolism, such as orotic aciduria, and adenosine deaminase deficiency.
  • Abnormal lipid metabolism hyperlipoproteinemia, familial hyper- ⁇ -lipoproteinemia, familial non- ⁇ -lipoproteinemia, familial hypo-p-lipoproteinemia, familial lecithin-cholesterol acetyltransferase Deficiency.
  • Glucose metabolism defects Congenital sugar digestion and absorption defects such as congenital lactose intolerance, hereditary fructose intolerance, monosaccharide metabolism defects such as galactosemia, fructose metabolism defects, glycogen metabolism diseases such as glycogen storage Backlog.
  • Growth and development disorders mental retardation, cerebral palsy, brain development disorders, familial cerebral nucleus dysplasia syndrome, skin, fat and muscular dysplasias such as congenital skin relaxation, premature aging, congenital horn Poor metabolism, various metabolic defects such as various amino acid metabolic defects, stunting, dwarfism, sexual retardation
  • Fetal developmental disorders congenital abortion, cleft palate, facial cleft lip, limb absentness, limb differentiation disorder, gastrointestinal atresia or stenosis, ileum diverticulum, umbilical fistula, congenital umbilical hernia esophagus fistula, hyaline membrane disease, congenital lung Cysts, atelectasis, polycystic kidney, ectopic kidney, horseshoe kidney, double ureter, umbilical fistula, cryptorchidism, congenital inguinal hernia, double uterus, vaginal atresia, hypospadias, amphoteric deformity, atrial septal defect, ventricular septum Defects, abnormal arterial stem separation, aortic or pulmonary artery stenosis, pulmonary artery stenosis, arterial duct occlusion, neural tube defects, congenital hydrocephalus, iris defect, congenital cataract
  • Various tumors gastric cancer, liver cancer, lung cancer, esophageal cancer, breast cancer, leukemia, lymphoma, thyroid tumor, uterine fibroids, neuroblastoma, astrocytoma, ependymoma, glioblastoma, colon cancer , Teratoma, bladder cancer, bone cancer, osteosarcoma, myeloma, bone marrow cancer, brain cancer, uterine cancer, endometrial cancer, thymic tumor, nasal cavity and sinus tumor, nasopharyngeal cancer, tracheal tumor, fibroma, fiber Sarcoma, lipoma, liposarcoma, leiomyoma
  • the invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) human flavin protein subunits 14.19.
  • Agonists enhance human flavin protein subunits 14. 19 stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
  • mammalian cells or membrane preparations expressing human flavin protein subunits 14. 19 can be cultured with labeled human flavin protein subunits 14. 19 in the presence of a drug. The ability of the drug to increase or suppress this interaction is then determined.
  • Antagonists of human flavin protein subunit 14. 19 include antibodies, compounds, receptor deletions, and the like that have been screened. Antagonists of human flavin protein subunit 14.19 can bind to human flavin protein subunit 14.19 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide to make the polypeptide Cannot perform biological functions.
  • human flavin protein subunit I 4 .19 can be added to the bioanalytical assay and determined by measuring the effect of the compound on the interaction between human flavin protein subunit 14.19 and its receptor Whether the compound is an antagonist.
  • Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds.
  • Polypeptide molecules capable of binding to human flavin protein subunit 14.19 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. When screening, the human lutein protein subunit 14.19 molecule should generally be labeled.
  • the present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies.
  • the invention also provides antibodies directed against a human flavin protein subunit 14.19 epitope. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments generated from Fab expression libraries.
  • Polyclonal antibodies can be produced by injecting human flavin protein subunit 14.19 directly into immunized animals (such as rabbits, mice, rats, etc.).
  • immunized animals such as rabbits, mice, rats, etc.
  • a variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's Agent.
  • Techniques for preparing monoclonal antibodies against human flavin protein subunit 14.19 include, but are not limited to, hybridoma technology (Kohler and Milstein. Nature, 1975, 256: 495-497), triple tumor technology, human beta-cell hybridoma technology, EBV -Hybridoma technology, etc.
  • Chimeric antibodies that bind human constant regions to non-human-derived variable regions can be produced using existing techniques (Morrison et al, PNAS, 1985, 81: 6851).
  • the existing technology for producing single chain antibodies (U.S. Pat No. 4946778) can also be used to produce single chain antibodies against human flavin subunit 14.19.
  • Antibodies against human lutein protein subunit 14.19 can be used in immunohistochemical techniques to detect human lutein protein subunit 14.19 in biopsy specimens.
  • Monoclonal antibodies that bind to human flavin protein subunit 14.19 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
  • Antibodies can also be used to design immunotoxins that target a particular part of the body.
  • human flavin protein subunit 14.19 High-affinity monoclonal antibodies can covalently bind to bacterial or phytotoxins (such as diphtheria toxin, ricin, ormosine, etc.).
  • a common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
  • This hybrid antibody can be used to kill the human lutein protein subunit 14.19 positive cell.
  • the antibodies of the present invention can be used to treat or prevent diseases related to human flavin protein subunit 14.19. Administration of appropriate doses of antibodies can stimulate or block the production or activity of human flavin protein subunit 14.19.
  • the invention also relates to a diagnostic test method for quantitatively and locally detecting the level of human flavin protein subunit 14.19.
  • tests are well known in the art and include FISH assays and radioimmunoassays.
  • the level of human flavin protein subunit 14.19 detected in the test can be used to explain the importance of human flavin protein subunit 14.19 in various diseases and to diagnose diseases in which human flavin protein subunit 14.19 plays a role.
  • the polypeptide of the present invention can also be used for peptide mapping analysis.
  • the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
  • Polynucleotides encoding human flavin protein subunits 14. 19 can also be used for a variety of therapeutic purposes. Gene therapy technology can be used to treat abnormal cell proliferation, development, or metabolism caused by the non-expression or abnormal / inactive expression of human flavin protein subunits 14.19.
  • Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated human flavin protein subunits 14. 19 to inhibit endogenous human flavin protein subunits 14. 19 activity.
  • a variant human flavin protein subunit 14.19 may be a shortened human flavin protein subunit 14.19 that lacks a signaling domain, although it can bind to downstream substrates, but lacks signaling active.
  • recombinant gene therapy vectors can be used to treat diseases caused by abnormal expression or activity of human flavin protein subunits.
  • Virus-derived expression vectors such as retroviruses, adenoviruses, adenovirus-associated viruses, herpes simplex virus, parvoviruses, and the like can be used to transfer polynucleosides encoding human flavin protein subunits 14. 19 into cells.
  • a method for constructing a recombinant viral vector carrying a polynucleotide encoding a human flavin protein subunit 14.19 can be found in the existing literature (Sambrook, et al.).
  • recombinant polynucleotides encoding human flavin protein subunits 14. 19 can be packaged into liposomes and transferred into cells.
  • Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
  • a vector such as a virus, phage, or plasmid
  • Oligonucleotides including antisense RNA and DNA
  • ribozymes that inhibit human flavin protein subunits 14.19 mRNA are also within the scope of the present invention.
  • a ribozyme is an enzyme-like RNA molecule that can specifically decompose specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation.
  • Antisense RNA, DM, and ribozymes can be obtained using any existing RNA or DNA synthesis technology. For example, solid-phase phosphoramidite chemical synthesis for the synthesis of oligonucleotides has been widely used.
  • Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA. This DM sequence has been integrated downstream of the RNA polymerase promoter of the vector. In order to increase the stability of the nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the linkage between ribonucleosides using phosphorothioate or peptide bonds instead of phosphodiester bonds.
  • the polynucleotide encoding human flavin protein subunit 14.19 can be used for the diagnosis of diseases related to human flavin protein subunit 14.19.
  • the polynucleotide encoding human flavin protein subunit 14.19 can be used to detect the expression of human flavin protein subunit 14.19 or the abnormal expression of human flavin protein subunit 14.19 in a disease state.
  • a DNA sequence encoding human flavin protein subunit 14.19 can be used to hybridize biopsy specimens to determine the expression of human flavin protein subunit 14.19.
  • Hybridization include Southern blotting t Nor thern blotting, in situ hybridization. These techniques and methods are publicly available and mature, and related kits are commercially available.
  • polynucleotides of the present invention can be used as probes to be fixed on a micro-array (Mi croar ray) or a DNA chip (also known as a "gene chip") for analyzing the difference of genes in tissues. Heterologous analysis and genetic diagnosis. Human flavin protein subunit 14.19 specific primers for RNA-polymerase chain reaction (RT-PCR) in vitro amplification can also detect human flavin protein subunit 14.19 transcription products.
  • RT-PCR RNA-polymerase chain reaction
  • Human flavin protein subunit 14.19 gene can also be used to diagnose human flavin protein subunit 14.19-related diseases.
  • Human flavin protein subunit 14.19 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type human flavin protein subunit 14.19 DNA sequence. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect the expression of proteins, so Nor thern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
  • sequences of the invention are also valuable for chromosome identification. This sequence will specifically target a specific position on a human chromosome and can hybridize to it. Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for marking chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DNA sequences on a chromosome.
  • a PCR primer (preferably 15-35bp) is prepared from the cDNA, and the sequence can be located on the chromosome. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
  • PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
  • oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
  • Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.
  • Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step.
  • FISH Fluorescent in situ hybridization
  • cDNA or genomic sequences between the affected and unaffected individuals need to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in the chromosome, such as deletions or translocations that are visible at the chromosomal level or detectable using cDNA sequence-based PCR. Based on the resolution capabilities of current physical mapping and gene mapping technologies, cDNAs that are accurately mapped to disease-related chromosomal regions can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping capability and every 20kb corresponds to a gene).
  • the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
  • suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
  • the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
  • the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell.
  • the polypeptides of the invention can be used in combination with other therapeutic compounds.
  • the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
  • Human flavin protein subunits 14. 19 are administered in amounts effective to treat and / or prevent specific indications.
  • the amount and range of human flavin protein subunits 14.19 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician. Examples
  • Total human fetal brain RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform.
  • Poly (A) mRNA was isolated from total RNA using Quik mRNA Isolat ion Kit (product of Qiegene). 2ug poly (A) mRNA is reverse transcribed to form cDNA.
  • a Smart cDNA cloning kit (purchased from Clontech) was used to orient the cDNA fragment into the multiple cloning site of the pBSK (+) vector (Clontech) to transform DH5a, and the bacteria formed a cDNA library.
  • Dye terminate cyc le reac t ion sequencing kit (Perkin-Elmer) and ABI 377 automatic sequencer (Perkin-Elraer) were used to determine the sequences at the 5 'and 3' ends of all clones.
  • the determined cDNA sequence was compared with an existing public DNA sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 0122g03 was a new D.
  • a series of primers were synthesized to determine the inserted cDNA fragments of the clone in both directions.
  • CDNA was synthesized using fetal brain total RNA as a template and oligo-dT as a primer for reverse transcription reaction. After purification using Qiagene's kit, the following primers were used for PCR amplification:
  • Primerl 5'- TCTGTAACATGGGAAGAAATATTG-3 '(SEQ ID NO: 3)
  • Primer2 5'- GGTGAAGCCATTTATTTGTTCATG -3 '(SEQ ID NO: 4)
  • Primerl is a forward sequence starting at lbp of the 5th end of SEQ ID NO: 1;
  • Primer2 is the 3 'end reverse sequence in SEQ ID NO: 1.
  • Amplification reaction conditions A reaction volume of 50 ⁇ 1 contains 50 mmol / L KC1, 10 mraol / L Tris-HCl, pH 8.5, 1.5 mmol / L MgCl 2 , 20 ( ⁇ mol / L dNTP, lOpmol primer, 1U Taq DNA polymerase (Clontech). The reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) for 25 cycles under the following conditions: 94.C 30sec; 55 ° C 30sec; 72.C 2min. At RT-PCR At the same time, ⁇ -actin was set as a positive control and the template blank was set as a negative control.
  • RNA precipitate wash the obtained RNA precipitate with 70% ethanol, dry and dissolve in water.
  • RNA in 20raM 3- ( N-morpholino) Propanesulfonic acid (PH7.0)-5mM sodium acetate-ImM EDTA- 2.2M formaldehyde on a 1.2% agarose gel for electrophoresis. Then transfer to a nitrocellulose membrane.
  • Use ct- 32 P dATP prepared 32 P-labeled DNA probes by random primers.
  • the DNA probes used were the PCR amplified human flavin protein subunit 14.19 coding region sequence (154bp to 543bp) shown in Figure 1.
  • the probe (about 2 x 10 6 cpm / ml) was hybridized with a nitrocellulose membrane to which RNA was transferred at 42 ° C overnight in a solution containing 50% formamide-25mM KH 2 P0 4 (pH7.4 ) -5 ⁇ SSC-5 ⁇ Denhardt's solution and 200 g / ml salmon sperm DNA. After hybridization, the filter was washed in lx SSC-0.1 ° /. SDS at 55 ° C for 30 minutes. Then, analysis was performed using Phosphor Imager and Quantitative.
  • Example 4 In vitro expression, isolation and purification of recombinant human flavin protein subunit 14.19
  • Primer3 5,-CCCCATATGATGATACTACTTTTTAAGGCTGTA -3, (Seq ID No: 5)
  • Primer4 5'- CATGGATCCTCAGTTAATTAAGCCTCTTTCTTT -3, (Seq ID No: 6)
  • the 5 'ends of these two primers contain Nhel and BamHI restriction sites, respectively.
  • 5 'end of target gene And the coding sequence at the 3 'end, the Nhel and BamHI restriction sites correspond to the selective endonuclease sites on the expression vector plasmid pET-28b (+) (product of Novagen, Cat. No. 69865. 3).
  • the PCR reaction was performed using pBS-0122g03 plasmid containing the full-length target gene as a template.
  • the PCR reaction conditions were as follows: a total volume of 50 ⁇ 1 containing 10 pg of pBS-0122g03 plasmid, primers Primer-3 and Primer-4 were 10 pmol, and Advantage po lymerase Mix (Clontech) 1 ⁇ 1. Cycle parameters: 94 ° C 20s, 60 ° C 30s, 68 ° C 2 min, a total of 25 cycles. Nhel and BamHI were used to double-digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase.
  • the ligated product was transformed into the colibacillus DH5 ot by the calcium chloride method. After being cultured overnight in LB plates containing kanamycin (final concentration 30 ⁇ ⁇ / ⁇ 1), positive clones were selected by colony PCR method and sequenced. A positive clone (PET-0122g03) with the correct sequence was selected, and the recombinant plasmid was transformed into E. coli BL21 (DE3) plySs (product of Novagen) using the calcium chloride method.
  • a peptide synthesizer (product of PE company) was used to synthesize the following human-flavin protein subunit 14.19-specific peptides: NH2-Me tI le-Leu-Leu-Phe-Lys-Ala-Va l-Leu-Va l- Cys-Ser-H i s-Al a-Al a-C00H (SEQ ID NO: 7).
  • the polypeptide is coupled with hemocyanin and bovine serum albumin to form a complex, respectively.
  • Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
  • the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
  • the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. 01/00455 Whether the expression in tissue cells is abnormal.
  • the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method.
  • Filter hybridization methods include dot blotting, Southern imprinting, Nor thern blotting, and copying methods. They all use the same steps to fix the polynucleotide sample to be tested on the filter and then hybridize.
  • the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer to saturate the non-specific binding site of the sample on the filter with the carrier and the synthesized polymer.
  • the pre-hybridization solution is then replaced with a hybridization buffer containing labeled probes and incubated to hybridize the probes to the target nucleic acid.
  • the unhybridized probes are removed by a series of membrane washing steps.
  • This embodiment uses higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals.
  • the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
  • the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
  • the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
  • oligonucleotide fragments for use as hybridization probes from the polynucleotide SEQ ID NO: 1 of the present invention should follow the following principles and several aspects to be considered:
  • the preferred range of probe size is 18-50 nucleotides
  • Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements For homology comparison of the regions, if the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, the primary probe should not be used generally;
  • Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
  • Probe 1 which belongs to the second type of probe, is equivalent to the replacement mutant sequence (41Nt) of the gene fragment or its complementary fragment of SEQ ID NO: 1:
  • PBS phosphate buffered saline
  • step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
  • NC membrane nitrocellulose membrane
  • Gene chip or DNA microarray is a new technology that many national laboratories and large pharmaceutical companies are currently developing and developing. It refers to the orderly and high-density arrangement of a large number of target gene fragments on the slope. Then, compare and analyze the data with fluorescence detection and computer software on a carrier such as glass, silicon, etc., so as to achieve the purpose of analyzing biological information quickly, efficiently and with high throughput.
  • the polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research of new gene functions; search for and screen new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases . The specific method steps have been reported in the literature.
  • a total of 4,000 polynucleotide sequences of various full-length cDNAs are used as target DNA, including the polynucleotide of the present invention. They were amplified by PCR respectively. After purification, the concentration of the amplified product was adjusted to about 500 ng / ul, and spotted on a glass medium using a Cartesian 7500 spotter (purchased from Cartesian Company, USA). The distance between the points is 280 ⁇ . The spotted slides were hydrated and dried, cross-linked in a UV cross-linker, and dried after elution to fix the DNA on the glass slides to prepare chips. The specific method steps have been reported in the literature. The sample post-processing steps in this embodiment are:
  • Total mRNA was extracted from human mixed tissues and specific tissues (or stimulated cell lines) in one step, and mRM was purified by Ol igotex mRNA Midi Kit (purchased from QiaGen), and another 1 J was separated by reverse transcription.
  • the fluorescent reagent Cy3dUTP (5-Amino-propargyl-2'-deoxyuridine 5--triphate coupled to Cy3 f luorescent dye, purchased from Amersham Phamac ia Biotech) was used to label the mRNA of human mixed tissue, and the fluorescent reagent Cy5dUTP (5-Amino -Propargyl-2'-deoxyur idine 5'-tr iphate coupled to Cy5 fluorescent dye, purchased from Amersham Pharaacia Biotech Company, labeled mRNA of specific tissues (or stimulated cell lines) of the body, and purified probes were prepared.
  • the probes from the two types of tissues and the chip were hybridized in a UniHyb TM Hybridization Solution (purchased from TeleChem) hybridization solution for 16 hours, and the washing solution was used at room temperature (1 ⁇ SSC, 0.2% SDS) After washing, scanning was performed with a ScanArray 3000 scanner (purchased from Genera Scanning, USA), and the scanned images were analyzed by Imagene software (Biodi scovery, USA) to calculate the Cy3 / Cy5 ratio of each point.
  • the above specific tissues are thymus, testis, muscle, spleen, lung, skin, thyroid, liver, PMA + Ecv304 cell line, PMA-Ecv304 cell line, non-starved L02 cell line, L02 cell line stimulated by arsenic for 1 hour, L02 cell line stimulated by arsenic for 6 hours prostate, heart, lung cancer, fetal bladder, fetal small intestine, fetal large intestine, fetal thymus, fetal muscle, fetal liver, fetal kidney, fetal spleen, fetal brain, Fetal lung and fetal heart.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Pharmacology & Pharmacy (AREA)
  • General Chemical & Material Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Zoology (AREA)
  • Biophysics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Toxicology (AREA)
  • Immunology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biochemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

L'invention concerne un nouveau polypeptide, une sous-unité humaine 14.19 de flavoprotéine, et un polynucléotide codant pour ce polypeptide ainsi qu'un procédé d'obtention de ce polypeptide par des techniques recombinantes d'ADN. L'invention concerne en outre les applications de ce polypeptide dans le traitement de maladies, notamment des tumeurs malignes, de l'hémopathie, de l'infection par VIH, de maladies immunitaires et de diverses inflammations. L'invention concerne aussi l'antagoniste agissant contre le polypeptide et son action thérapeutique ainsi que les applications de ce polynucléotide codant pour la sous-unité humaine 14.19 de flavoprotéine.
PCT/CN2001/000455 2000-03-28 2001-03-26 Nouveau polypeptide, sous-unite humaine 14.19 de flavoproteine, et polynucleotide codant pour ce polypeptide WO2001072805A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU58161/01A AU5816101A (en) 2000-03-28 2001-03-26 A new polypeptide - human flavoprotein subunit 14.19 and the polynucleotide encoding it

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN00115250A CN1315432A (zh) 2000-03-28 2000-03-28 一种新的多肽——人黄素蛋白亚基15和编码这种多肽的多核苷酸
CN00115250.5 2000-03-28

Publications (1)

Publication Number Publication Date
WO2001072805A1 true WO2001072805A1 (fr) 2001-10-04

Family

ID=4584718

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2001/000455 WO2001072805A1 (fr) 2000-03-28 2001-03-26 Nouveau polypeptide, sous-unite humaine 14.19 de flavoproteine, et polynucleotide codant pour ce polypeptide

Country Status (3)

Country Link
CN (1) CN1315432A (fr)
AU (1) AU5816101A (fr)
WO (1) WO2001072805A1 (fr)

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4587216A (en) * 1983-08-31 1986-05-06 Exxon Research And Engineering Co. Microbiological oxidation reactions using purified monooxygenase enzyme components

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4587216A (en) * 1983-08-31 1986-05-06 Exxon Research And Engineering Co. Microbiological oxidation reactions using purified monooxygenase enzyme components

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
DATABASE GENBANK [online] 23 November 1999 (1999-11-23), PAVITT R.: "Human DNA sequence from clone 142F18 on chromosome Xq26.3-27.2 contains part of a gene similar to melanoma-associated antigen, EST, GSS and an inverted repeat", Database accession no. AL031073 *

Also Published As

Publication number Publication date
CN1315432A (zh) 2001-10-03
AU5816101A (en) 2001-10-08

Similar Documents

Publication Publication Date Title
WO2002020795A1 (fr) Nouveau polypeptide, hexokinase proteine 9.68, et polynucleotide codant ce polypeptide
WO2001090378A1 (fr) Nouveau polypeptide, proteine humaine hexokinase 11, et polynucleotide codant ce polypeptide
WO2001072805A1 (fr) Nouveau polypeptide, sous-unite humaine 14.19 de flavoproteine, et polynucleotide codant pour ce polypeptide
WO2001098488A1 (fr) Nouveau polypeptide, sous-unite 24 de flavoproteine humaine, et polynucleotide codant ce polypeptide
WO2001075048A2 (fr) Nouveau polypeptide, proteine ribosomale humaine s11 23, et polynucleotide codant pour ce polypeptide
WO2001072832A1 (fr) Nouveau polypeptide, famille de proteines 11 a laquelle appartiennent des hormones de croissance, et polynucleotide codant pour ce polypeptide
WO2001068873A1 (fr) Nouveau polypeptide, molecule humaine d'adhesion intercellulaire 12, et polynucleotide codant pour ce polypeptide
WO2001094371A1 (fr) Nouveau polypeptide, proteine ribosomale humaine s4-10, et polynucleotide codant ce polypeptide
WO2001075016A2 (fr) Nouveau polypeptide, tyrosinase humaine 16, et polynucleotide codant pour ce polypeptide
WO2001090348A1 (fr) Nouveau polypeptide, chaine lourde de myoglobuline humaine 11, et polynucleotide codant ce polypeptide
WO2001092541A1 (fr) Nouveau polypeptide, catalase 12, et polynucleotide codant ce polypeptide
WO2001075047A2 (fr) Nouveau polypeptide, sous-unite humaine 10 de flavoproteine, et polynucleotide codant pour ce polypeptide
WO2001079435A2 (fr) Nouveau polypeptide, sous-unite humaine 14 de flavoproteine, et polynucleotide codant pour ce polypeptide
WO2001072972A1 (fr) Nouveau polypeptide, ribulose-biphosphate carboxylase humaine 8, et polynucleotide codant pour ce polypeptide
WO2001047966A1 (fr) Nouveau polypeptide, sous-unite de flavoproteine 9, et polynucleotide codant pour ce polypeptide
WO2001072810A1 (fr) Nouveau polypeptide, proteine humaine 12 de la famille des amidases, et polynucleotide codant pour ce polypeptide
WO2002020587A1 (fr) Nouveau polypeptide, sous-unite humaine nadh deshydrogenase i-12.43, et polynucleotide codant ce polypeptide
WO2001074995A2 (fr) Nouveau polypeptide, protéine humaine de mutation 15 de l'ataxie telangiectasie, et de polynucléotide codant pour ce polypeptide
WO2002020778A1 (fr) Nouveau polypeptide, thyrocalcitonine 15.18, et polynucleotide codant ce polypeptide
WO2001083758A2 (fr) Nouveau polypeptide, dihydroorotase humaine 8, et polynucleotide codant pour ce polypeptide
WO2001090171A1 (fr) Nouveau polypeptide, proteine humaine ribosomale sii 12, et polynucleotide codant ce polypeptide
WO2001072795A1 (fr) Nouveau polypeptide, quinine reductase humaine 16, et polynucleotide codant pour ce polypeptide
WO2001075079A1 (fr) Nouveau polypeptide, dihydroorotase humaine 13, et polynucleotide codant pour ce polypeptide
WO2001073061A1 (fr) Nouveau polypeptide, proteine humaine 22 du retinoblastome, et polynucleotide codant pour ce polypeptide
WO2001047995A1 (fr) Nouveau polypeptide, dioxygenase humaine 13, et polynucleotide codant pour ce polypeptide

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP