WO2001085776A1 - Polypeptide humain dihydro-orotase 12 et polynucleotide codant pour ce polypeptide - Google Patents

Polypeptide humain dihydro-orotase 12 et polynucleotide codant pour ce polypeptide Download PDF

Info

Publication number
WO2001085776A1
WO2001085776A1 PCT/CN2001/000666 CN0100666W WO0185776A1 WO 2001085776 A1 WO2001085776 A1 WO 2001085776A1 CN 0100666 W CN0100666 W CN 0100666W WO 0185776 A1 WO0185776 A1 WO 0185776A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
polynucleotide
human dihydroorotase
sequence
human
Prior art date
Application number
PCT/CN2001/000666
Other languages
English (en)
Chinese (zh)
Inventor
Yumin Mao
Yi Xie
Original Assignee
Shanghai Biowindow Gene Development Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shanghai Biowindow Gene Development Inc. filed Critical Shanghai Biowindow Gene Development Inc.
Priority to AU85651/01A priority Critical patent/AU8565101A/en
Publication of WO2001085776A1 publication Critical patent/WO2001085776A1/fr

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14Hydrolases (3)
    • C12N9/78Hydrolases (3) acting on carbon to nitrogen bonds other than peptide bonds (3.5)
    • C12N9/86Hydrolases (3) acting on carbon to nitrogen bonds other than peptide bonds (3.5) acting on amide bonds in cyclic amides, e.g. penicillinase (3.5.2)
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides

Definitions

  • the present invention belongs to the field of biotechnology. Specifically, the present invention describes a new polypeptide, ⁇ -dihydroorotase 12, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and polypeptide.
  • Dihydroorotase also known as carbamoyl aspartate dehydratase, catalyzes the initiation of the third stage of pyrimidine biosynthesis and makes ureidosuccinic acid (N-carbamoyl-L-day Aspartic acid) is converted to dihydroorotate.
  • Dihydroorotase is one of the very few enzymes that can biosynthesize an amino bond-catalyzed reaction without directly coupling energy such as ATP, which catalyzes the cyclization of N-carbamoyl-L-aspartate This catalytic reaction also incorporates a zinc atom necessary for catalytic activity.
  • dihydroorotase In bacteria, dihydroorotase is a dimer composed of two identical long chains of about 400 amino acid residues; in higher eukaryotes, dihydroorotase is one This function is part of a large protein; in Drosophila and mammals, it catalyzes the first three steps of pyrimidine biosynthesis. Dihydroorotase is located at the center of this multiprotein. In yeast, dihydroorotase is encoded by a monofunctional protein gene (URA4). However, a dihydroorotase mutant strain was found to be encoded by the multifunctional protein gene (URA2), catalyzing the first two steps of pyrimidine synthesis.
  • UAA4 monofunctional protein gene
  • UAA2 multifunctional protein gene
  • N-terminal conserved sequence D- [LIVMFYWSAP] -H- [LIVA] -H- [LIVF]-[RN] -x- [PGN] where two hydrazones may be sites for zinc ligands.
  • human dihydroorotase 12 protein plays an important role in regulating important functions of the body such as cell division and embryonic development, and 'It is believed that a large number of proteins are involved in these regulatory processes, so more needs to be identified in the art
  • the human dihydroorotase 12 protein involved in these processes, and in particular the amino acid sequence of this protein is identified.
  • the isolation of the new human dihydroorotase 12 protein encoding gene also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for developing diagnostic and / or therapeutic drugs for the disease, so isolating its coding DNA is important.
  • Another object of the invention is to provide a polynucleotide encoding the polypeptide.
  • Another object of the present invention is to provide a genetically engineered host cell comprising a polynucleotide encoding human dihydroorotase 12.
  • Another object of the present invention is to provide a method for producing human dihydroorotase 12.
  • Another object of the present invention is to provide an antibody against the polypeptide-human dihydro ⁇ alanase 12 of the present invention.
  • Another object of the present invention is to provide mimic compounds, antagonists, agonists, and inhibitors directed to the polypeptide of the present invention, human dihydroorotase 12.
  • Another object of the present invention is to provide a method for diagnosing and treating a disease associated with an abnormality of human dihydroorotase 12.
  • the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
  • the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the present invention also relates to an isolated polynucleotide comprising a nucleotide sequence selected from the group consisting of: Its variant:
  • sequence of the polynucleotide is one selected from: (a) a sequence having positions 665-982 in SEQ ID NO: 1; and (b having a position 1-997 in SEQ ID NO: 1) the sequence of.
  • the present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
  • the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
  • the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of human dihydroorotase 12 protein, which comprises utilizing the polypeptide of the invention.
  • the invention also relates to compounds obtained by this method.
  • the invention also relates to a method for detecting a disease or susceptibility to disease associated with abnormal expression of human dihydroorotase 12 protein in vitro, which comprises detecting a mutation in the polypeptide or a sequence encoding a polynucleotide thereof in a biological sample, or Detection of the amount or biological activity of a polypeptide of the invention in a biological sample.
  • the invention also relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
  • the present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention for the preparation of a medicament for treating cancer, developmental disease or immune disease or other diseases caused by abnormal expression of human dihydroorotase 12.
  • FIG. 1 is a comparison diagram of gene chip expression profiles of human dihydroorotase 12 and human dihydroorotase 9 of the present invention.
  • the upper graph is a graph of the expression profile of human dihydroorotase 12 and the lower graph is the graph of the expression profile of human dihydroorotase 9 Among them, 1 indicates fetal kidney, 2 indicates fetal large intestine, 3 indicates fetal small intestine, 4 indicates fetal muscle, 5 indicates fetal brain, 6 indicates fetal bladder, 7 indicates non-starved L02, 8 indicates L02 +, lhr, As 3+ , and 9 indicates ECV304 P A-, 10 means ECV30 4 PMA +, 11 means fetal liver, 12 means normal liver, 13 means thyroid, 14 Indicates skin, 15 indicates fetal lung, 16 indicates lung, 17 indicates lung cancer, 18 indicates fetal spleen, 19 indicates spleen, 20 indicates prostate, 21 indicates fetal heart, 22 indicates heart,
  • Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of human dihydroorotase 12 isolated. 12kDa is the molecular weight of the protein. The arrow indicates the isolated protein band.
  • Nucleic acid sequence refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
  • amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
  • amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
  • a “variant" of a protein or polynucleotide refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it.
  • the changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence.
  • Variants can have "conservative" changes, in which the amino acid substituted has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine.
  • Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
  • “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
  • Insertion means that a change in the amino acid sequence or nucleotide sequence results in an increase in one or more amino acids or nucleotides compared to a molecule that exists in nature.
  • Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
  • Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
  • immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response and to bind specific antibodies in a suitable animal or cell.
  • An "agonist” refers to a molecule that, when combined with human dihydroorotase 12, can cause the protein to change, thereby regulating the activity of the protein.
  • An agonist may include a protein, a nucleic acid, a carbohydrate or any other molecule that binds human dihydroorotase 12.
  • Antagonist refers to a molecule that, when combined with human dihydroorotase 12, can block or regulate the biological or immunological activity of human dihydroorotase 12. Antagonists and inhibitors It may include proteins, nucleic acids, carbohydrates or any other molecule that can bind human dihydroorotase 12.
  • Regular refers to a change in the function of human dihydroorotase 12, including an increase or decrease in protein activity, a change in binding characteristics, and any other biological properties, functions, or immunity of human dihydroorotase 12. Change of nature.
  • substantially pure is meant that * it does not contain any other proteins, lipids, sugars or other substances with which it is naturally associated.
  • Those skilled in the art can purify human dihydroorotase 12 using standard protein purification techniques. Basically pure human dihydroorotase 12 produces a single main band on a non-reducing polyacrylamide gel. The purity of human dihydroorotase 12 polypeptide can be analyzed by amino acid sequence.
  • Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
  • sequence C-T-G-A
  • complementary sequence G-A-C-T.
  • the complementarity between two single-stranded molecules may be partial or complete.
  • the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
  • “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
  • Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Southern imprinting or Northern blotting, etc.) under conditions of reduced stringency. Substantially homologous sequences or hybridization probes can compete and inhibit the binding of fully homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.
  • Percent identity refers to the percentage of sequences that are the same or similar in a comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as through the MEGALIGN program (Lasergene sof tware package, DNASTAR, Inc., Madi son Wis.). The MEGALIGN program can compare two or more sequences according to different methods, such as the Clus ter method (Higgins, DG and PM Sharp (1988) Gene 73: 237-244). The Clus ter method groups each group by checking the distance between all pairs. The sequences are arranged into clusters. Each cluster is then allocated in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula:
  • the percent identity between nucleic acid sequences can also be determined by the Clus ter method or by methods known in the art such as Jotim Hein (Hein J., (1990) Methods in enzymology 183: 625-645). 0 "Similarity" refers to amino acids The amino acid residues in the corresponding positions are the same when the sequences are aligned. Or the extent of conservative substitution.
  • Amino acids used for conservative substitution may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
  • Antisense refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence.
  • Antisense strand refers to a nucleic acid strand that is complementary to a “sense strand.”
  • Derivative refers to HFP or a chemical modification of its nucleic acid. This chemical modification may be a substitution of a hydrogen atom with a fluorenyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
  • Antibody refers to a complete antibody molecule and its fragments, such as Fa,? ( ⁇ ') 2 and? 7. It can specifically bind to the epitope of human dihydroorotase 12.
  • a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
  • isolated refers to the removal of a substance from its original environment (for example, its natural environment if it is naturally occurring).
  • a naturally-occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
  • Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not part of its natural environment, they are still isolated.
  • isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
  • polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances in the natural state .
  • isolated human dihydroorotase 12 means that human dihydroorotase 12 is substantially free of other proteins, lipids, sugars, or other substances naturally associated with it. Those skilled in the art can purify human dihydroorotase 12 using standard protein purification techniques. Substantially pure peptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of the human dihydroorotase 12 peptide can be analyzed by amino acid sequence.
  • the present invention provides a new polypeptide, human dihydroorotase 12, which is basically composed of the amino acid sequence shown in SEQ ID NO: 2.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, a synthetic polypeptide, and preferably a recombinant polypeptide.
  • the polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be obtained from prokaryotic or eukaryotic hosts (e.g., bacteria, yeast, higher plants, insects, and mammals) using recombinant techniques. Cells). Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
  • the invention also includes fragments, derivatives and analogs of human dihydroorotase 12.
  • fragment refers to a polypeptide that substantially maintains the same biological function or activity of the human dihydroorotase 12 of the present invention.
  • a fragment, derivative or analog of the polypeptide of the present invention may be: (I) this' one kind in which one or more amino acid residues are replaced with conservative or non-conservative amino acid residues, preferably conservative amino acid residues, And the substituted amino acid may or may not be encoded by a genetic codon; or ( ⁇ ) a type in which a group on one or more amino acid residues is substituted by another group to include a substituent; or ( ⁇ I) a form in which the mature polypeptide is fused with another compound (such as a compound that extends the half-life of the polypeptide, such as polyethylene glycol); or (IV) a form in which an additional amino acid sequence is fused into a mature polypeptide Polypeptide sequence (such as the leader or secretory sequence or the sequence used to purify the polypeptide or protein sequence).
  • the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
  • the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a polynucleotide sequence that is 997 bases in length, and its open reading frames 665-982 encode 105 amino acids.
  • this polypeptide has a similar expression profile with human dihydroorotase 9 and it can be inferred that the human dihydroorotase 12 has a similar function to human dihydroorotase 9.
  • the polynucleotide of the present invention may be in a DNA form or an R form.
  • DNA forms include cDNA, genomic DNA, or synthetic DM.
  • DNA can be single-stranded or double-stranded.
  • DNA can be coding or non-coding.
  • the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
  • a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
  • the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
  • polynucleotide encoding a polypeptide refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.
  • the present invention also relates to a variant of the polynucleotide described above, which encodes the same amino group as the present invention.
  • Variants of this polynucleotide may be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
  • an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
  • the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity, between the two sequences).
  • the present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions.
  • “strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60'C; or (2) Add denaturants during hybridization, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% Ficol 1, 42 ° C, etc .; or (3) only between the two sequences Hybridization occurs only when the identity is at least 95%, and more preferably 97%.
  • the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
  • nucleic acid fragments that hybridize to the sequences described above.
  • a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 nuclei. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques such as PCR to identify and / or isolate polynucleotides encoding human dihydroorotase 12.
  • polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
  • the specific polynucleotide sequence encoding human dihydroorotase 12 of the present invention can be obtained by various methods.
  • polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
  • the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) separating a double-stranded DNA sequence from genomic DNA; 2) chemically synthesizing a DM sequence to obtain the double-stranded DM of the polypeptide.
  • genomic DNA isolation is the least commonly used. Direct chemical synthesis of DM sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences.
  • the standard method for isolating the CDM of interest is to isolate mR from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage CDM library.
  • the construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manua, Cold Spruing Harbor Laboratory. New York, 1989).
  • Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech.
  • genes can be screened from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DM or DNA-RNA hybridization; (2) the presence or loss of marker gene function; (3) measuring the level of human dihydroorotase 12 transcripts; (4) Detecting the protein product of gene expression by immunological technology or measuring biological activity. The above methods can be used singly or in combination.
  • the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably Is at least 50 nucleotides, preferably at least 100 nucleotides.
  • the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
  • the probe used here is generally a DNA sequence chemically synthesized based on the gene sequence information of the present invention.
  • the genes or fragments of the present invention can of course be used as probes.
  • DM probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
  • immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) can be used to detect the protein product expressed by the human dihydroorotase 12 gene.
  • ELISA enzyme-linked immunosorbent assay
  • a method (Saiki, et al. Science 1985; 230: 1350-1354) using PCR technology to amplify DNA / RM is preferably used to obtain the gene of the present invention.
  • the RACE method MCE-Rapid Amplification of cDNA Ends
  • the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Select and synthesize using conventional methods.
  • the amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
  • polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be measured by a conventional method such as dideoxy chain termination method (Sanger et al., PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, sequencing needs to be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
  • the present invention also relates to a vector comprising a polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using a human dihydroorotase 12 coding sequence, and the recombinant technology to produce the polypeptide of the present invention Methods.
  • a polynucleotide sequence encoding human dihydroorotase 12 can be inserted into a vector to form a recombinant vector incorporating the polynucleotide of the present invention.
  • vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
  • Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al.
  • any plasmid and vector can be used to construct recombinant expression vectors.
  • An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
  • Methods known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding human dihydroorotase 12 and appropriate transcription / translation regulatory elements. These methods include in vitro recombinant DM technology, DNA synthesis technology, in vivo recombination technology, and the like (Sambroook, et al. Molecular Cloning, a Labora tory Manua, Co. Harbor Harbor Laboratory. New York, 1989).
  • the DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide tnRNA synthesis. Representative examples of these promoters are: the lac or trp promoter of E.
  • the expression vector also includes a ribosome binding site for translation initiation, a transcription terminator, and the like. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Examples include 100 to 270 base pair SV40 enhancers on the late side of the replication initiation point, polyoma enhancers and adenovirus enhancers on the late side of the replication initiation point.
  • the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • GFP fluorescent protein
  • tetracycline or ampicillin resistance for E. coli.
  • a polynucleotide encoding human dihydroorotase 12 or a recombinant vector containing the polynucleotide can be transformed or introduced into a host cell to form a genetically engineered host cell containing the polynucleotide or the recombinant vector.
  • the term "host cell” refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E.
  • coli Streptomyces
  • bacterial cells such as Salmonella typhimurium
  • fungal cells such as yeast
  • plant cells such as insect cells such as Fly S2 or Sf9
  • animal cells such as CH0, COS or Bowes melanoma cells.
  • Transformation of a host cell with a D sequence according to the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art.
  • the host is a prokaryote such as E. coli
  • competent cells capable of DNA uptake can be harvested after exponential growth phase, with ( ⁇ (1 2 Treatment, procedure used are well known in the art. Alternatively MgCl 2 is used If necessary, transformation can also be electroporated Method.
  • the host is a eukaryotic organism, the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
  • the polynucleotide sequence of the present invention can be used to express or produce recombinant human dihydroorotase 12 by conventional recombinant DNA technology (Science, 1984; 224: 1431). Generally there are the following steps:
  • the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
  • a suitable method such as temperature conversion or chemical induction
  • the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If necessary, the recombinant protein can be isolated and purified by various separation methods using its physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
  • conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid
  • polypeptides of the present invention as well as antagonists, agonists and inhibitors of the polypeptides, can be directly used in the treatment of diseases, for example, they can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection, and immune diseases.
  • Dihydroorotase catalyzes the initiation of the third stage of pyrimidine biosynthesis, converting ureidosuccinic acid (N-carbamoyl-L-aspartic acid) to dihydroorotate.
  • Dihydroorotase is one of the very few enzymes to biosynthesize an amino bond-catalyzed reaction without directly coupling energy such as ATP.
  • the pyrimidine biosynthesis is necessary for the production of nucleotides.
  • Dihydroorotase-specific conserved sequences are required to form its active mot if.
  • the abnormal expression of the specific dihydroorotase mot if will cause the function of the polypeptide containing the mot if of the present invention to be abnormal, thereby causing abnormalities in nucleotide biosynthesis, and then affecting the regulation and control of genetic information.
  • Expression, and produce related diseases such as tumors, embryonic developmental disorders, growth and development disorders, inflammation, etc.
  • human dihydroorotase 12 of the present invention will produce various diseases, especially tumors, embryonic developmental disorders, growth and development disorders, and inflammation.
  • diseases include, but are not limited to: Embryonic disorders: congenital abortion, cleft palate, limb loss, limb differentiation disorder, hyaline membrane disease, atelectasis, polycystic kidney, double ureter, cryptorchidism, congenital inguinal hernia, double uterus, vaginal atresia, suburethral Fissure, hermaphroditism, atrial septal defect, ventricular septal defect, pulmonary stenosis, arterial duct occlusion, neural tube defect, congenital hydrocephalus, iris defect, congenital cataract, congenital glaucoma or cataract, congenital deafness
  • Growth and development disorders mental retardation, cerebral palsy, brain development disorders, mental retardation, familial cerebral nucleus hypoplasia syndrome, strabismus, skin, fat and muscular dysplasia such as congenital skin sagging, premature Disease, congenital keratosis, various metabolic defects such as various amino acid metabolic defects, stunting, dwarfism, sexual retardation
  • Tumors of various tissues gastric cancer, liver cancer, lung cancer, esophageal cancer, breast cancer, leukemia, lymphoma, thyroid tumor, uterine fibroids, neuroblastoma, astrocytoma, ependymoma, glioblastoma, Colon cancer, melanoma, adrenal cancer, bladder cancer, bone cancer, osteosarcoma, myeloma, bone marrow cancer, brain cancer, uterine cancer, endometrial cancer, gallbladder cancer, thymic tumor, nasal cavity and sinus cancer, nasopharyngeal cancer , Laryngeal cancer, tracheal tumor, fibroma, fibrosarcoma, lipoma, liposarcoma, leiomyoma
  • Inflammation allergic reaction, bronchial asthma, allergic pneumonia, adult respiratory distress syndrome, sarcoidosis, rheumatoid arthritis, rheumatoid arthritis, osteoarthritis, cholecystitis, glomerulonephritis, immune complex Types of glomerulonephritis, acute anterior uveitis, dermatomyositis, urticaria, atopic dermatitis, hemochromatosis, polymyositis, Addison's disease, chronic active hepatitis, emergency bowel syndrome, atrophy Gastritis, systemic lupus erythematosus, myasthenia gravis, cerebrospinal spinal multiple sclerosis, Guillain-Barre syndrome, intracranial granuloma, pancreatitis, myocarditis, and inflammation caused by infections and trauma
  • human dihydroorotase 12 of the present invention will also produce certain hereditary, hematological and immune system diseases.
  • the invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) human dihydroorotase 12.
  • Agonists enhance human dihydroorotase 12 to stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation such as various cancers.
  • mammalian cells or membrane preparations expressing human dihydroorotase 12 can be cultured with labeled human dihydroorotase 12 in the presence of a drug. The ability of the drug to increase or block this interaction is then determined.
  • Antagonists of human dihydroorotase 12 include screened antibodies, compounds, receptor deletions, and the like. Antagonists of human dihydroorotase 12 can bind to human dihydroorotase 12 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot function biological functions.
  • human dihydroorotase 12 When screening compounds as antagonists, human dihydroorotase 12 can be added to bioassays In the assay, whether a compound is an antagonist is determined by measuring the effect of the compound on the interaction between human dihydroorotase 12 and its receptor. Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds. Polypeptide molecules capable of binding to human dihydroorotase 12 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. In screening, 12 molecules of human dihydroorotase should generally be labeled.
  • the present invention provides a method for producing antibodies by using polysaccharides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies.
  • the invention also provides antibodies against human dihydroorotase 12 epitopes. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments generated from Fab expression libraries.
  • Polyclonal antibodies can be produced by injecting human dihydroorotase 12 directly into immunized animals (such as rabbits, mice, rats, etc.).
  • immunized animals such as rabbits, mice, rats, etc.
  • adjuvants can be used to enhance the immune response, including but not limited to Freund's Adjuvant, etc.
  • Techniques for preparing monoclonal antibodies against human dihydroorotase 12 include, but are not limited to, hybridoma technology (Kohler and Mistein. Nature, 1975, 256: 495-497), triple tumor technology, human beta-cell hybridoma Technology, EBV-hybridoma technology, etc.
  • Chimeric antibodies that bind human constant regions and non-human variable regions can be produced using existing techniques (Morrison et al, PNAS, 1985, 81: 6851). There are few techniques for producing single-chain antibodies ( US Pat No. 4946778) can also be used to produce single chain antibodies against human dihydroorotase 12.
  • Anti-human dihydroorotase 12 antibodies can be used in immunohistochemical techniques to detect human dihydroorotase 12 in biopsy specimens.
  • Monoclonal antibodies that bind to human dihydroorotase 12 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
  • Antibodies can also be used to design immunotoxins that target a particular part of the body.
  • human dihydroorotase 12 high affinity monoclonal antibodies can covalently bind to bacterial or phytotoxins (such as diphtheria toxin, ricin, ormosine, etc.).
  • a common method is to attack the amino group of an antibody with a sulfhydryl crosslinker such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
  • This hybrid antibody can be used to kill human dihydroorotase 12 positive Cell.
  • the antibodies of the present invention can be used to treat or prevent diseases related to human dihydroorotase 12. Administration of an appropriate dose of the antibody can stimulate or block the production or activity of human dihydroorotase 12.
  • the invention also relates to a diagnostic test method for quantitative and localized detection of human dihydroorotase 12 level. These tests are well known in the art and include FISH assays and radioimmunoassays. Tested in the test The measured levels of human dihydroorotase 12 can be used to explain the importance of human dihydroorotase 12 in various diseases and to diagnose diseases in which human dihydroorotase 12 functions.
  • polypeptide of the present invention can also be used for peptide mapping analysis.
  • the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis. . '
  • the polynucleotide encoding human dihydroorotase 12 can also be used for a variety of therapeutic purposes. Gene therapy techniques can be used to treat abnormal cell proliferation, development, or metabolism caused by the non-expression or abnormal / inactive expression of human dihydroorotase 12.
  • Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated human dihydroorotase 12 to inhibit endogenous human dihydroorotase 12 activity.
  • a mutated human dihydroorotase 12 may be a shortened human dihydroorotase 12 lacking a signaling domain. Although it can bind to downstream substrates, it lacks signaling activity.
  • the recombinant gene therapy vector can be used for treating diseases caused by abnormal expression or activity of human dihydroorotase 12.
  • Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to transfer a polynucleotide encoding human dihydroorotase 12 into a cell.
  • Methods for constructing recombinant viral vectors carrying a polynucleotide encoding human dihydroorotase 12 can be found in the existing literature (Sambrook, et al.).
  • a recombinant polynucleotide encoding human dihydroorotase 12 can be packaged into liposomes and transferred into cells.
  • Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
  • a vector such as a virus, phage, or plasmid
  • Oligonucleotides including antisense RM and DNA
  • ribozymes that inhibit human dihydroorotase 12 mRNA are also within the scope of the present invention.
  • a ribozyme is an enzyme-like RM molecule that specifically decomposes a specific MA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation.
  • Antisense RNA and D and ribozymes can be obtained by any existing RM or DM synthesis technology, such as solid phase phosphoramidite chemical synthesis technology has been widely used.
  • Antisense RNA molecules can be obtained by in vitro or in vivo transcription of MA sequences encoding the RNA.
  • This DM sequence has been integrated downstream of the RNA polymerase promoter of the vector.
  • it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the linkage between ribonucleosides using phosphorothioate or peptide bonds instead of phosphodiester bonds.
  • the polynucleotide encoding human dihydroorotase 12 can be used for the diagnosis of diseases related to human dihydroorotase 12.
  • the polynucleotide encoding human dihydroorotase 12 can be used to detect the expression of human dihydroorotase 12 or abnormal expression of human dihydroorotase 12 in a disease state.
  • Human dihydrogen The DM sequence of oralase 12 can be used to hybridize biopsy specimens to determine the expression of human dihydroorotase 12.
  • Hybridization techniques include Southern blotting, Nor thern blotting, and in situ hybridization. These techniques and methods are publicly available and mature, and related kits are commercially available.
  • polynucleotides of the present invention can be used as probes to be fixed on a microarray or a DNA chip (also referred to as a "gene chip") for analyzing differential expression analysis and gene diagnosis of genes in tissues.
  • Human dihydroorotase 12 specific primers can also be used to detect human dihydroorotase 12 transcripts by RNA-polymerase chain reaction (RT-PCR) in vitro amplification.
  • RT-PCR RNA-polymerase chain reaction
  • Detection of mutations in the human dihydroorotase 12 gene can also be used to diagnose human dihydroorotase 12-related diseases.
  • Human dihydroorotase 12 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type human dihydroorotase 12 D sequence. Mutations can be detected using existing techniques such as Southern blotting, MA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression. Therefore, Northern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
  • sequences of the invention are also valuable for chromosome identification. This sequence will specifically target a specific position on a human chromosome and can hybridize to it. Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for marking chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DNA sequences on a chromosome.
  • PCR primers (preferably 15-35bp) are prepared based on cDNA, and the sequences can be located on chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
  • PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
  • oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
  • Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cMA libraries.
  • Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step.
  • FISH Fluorescent in situ hybridization
  • the difference in cDM or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing diseased and unaffected individuals usually involves first looking for structural changes in the chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the CDM that is accurately mapped to a disease-related chromosomal region can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).
  • the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
  • suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
  • the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
  • the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell.
  • the polypeptides of the invention can be used in combination with other therapeutic compounds.
  • the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
  • Human dihydroorotase 12 is administered in an amount effective to treat and / or prevent a specific indication.
  • the amount and range of human dihydroorotase 12 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician. Examples
  • Total human fetal brain RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform.
  • Poly (A) mRNA was isolated from total RNA using Quik mRNA Isolat ion Kit (product of Qiegene). 2ug poly (A) mRNA is reverse transcribed CDM is formed.
  • a Smart cDNA cloning kit (purchased from Clontech) was used to orient the cDNA fragment into the multiple cloning site of the pBSK (+) vector (Clontech) to transform DH5a, and the bacteria formed a cDNA library.
  • Dye terminate cycle reaction sequencing kit Perkin-Elmer
  • ABI 377 automatic sequencer Perkin-Elmer
  • the determined cDNA sequence was compared with the existing public DNA sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 0261M1 was new DNA.
  • a series of primers were synthesized to determine the inserted cDNA fragments of the clone in both directions.
  • CDNA was synthesized using fetal brain total RNA as a template and ol igo-dT as a primer for reverse transcription reaction. After purification with Qiagene's kit, the following primers were used for PCR amplification:
  • Primer2 5'- GAATTAAGCATGAAATTAACACCA-3 '(SEQ ID NO: 4)
  • Pr imerl is a forward sequence located at the 5th end of SEQ ID NO: 1, starting at lbp;
  • Pr imer2 is the 3, terminal reverse sequence of SEQ ID NO: 1.
  • Conditions for the amplification reaction 50 mmol / L KCl, 10 mmol / L Tri s-HCl pH 8. 5, 1. 5 mraol / L MgCl 2 , 200 mol / L dNTP, lOpmol primer, 1U Taq DNA in a 50 ⁇ 1 reaction volume Polymerase (Clontech).
  • the reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elraer) for 25 cycles under the following conditions: 94. C 30sec; 55 ° C 30sec; 72. C 2rain 0 set ⁇ -act in as a positive control and template blank as a negative control at the same time during RT-PCR.
  • the amplified product was purified using a QIAGEN kit and ligated to a pCR vector (Invitrogen) using a TA cloning kit.
  • the DNA sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as l-997bp shown in SEQ ID NO: 1.
  • Example 3 Northern blot analysis of human dihydroorotase 12 gene expression
  • RNA in 20 mM 3- (N- Morpholino) propanesulfonic acid (pH 7. G)-5 mM sodium acetate-ImM EDTA-2. 2M formaldehyde on a 1.2% agarose gel. It was then transferred to a nitrocellulose membrane. A- 32 P dATP was used to prepare 32 P-labeled DNA probes by random primers. The D probe used was the PCR amplified human dihydroorotase 12 coding region sequence (665b P to 982bp) shown in FIG. 1.
  • a 32P-labeled probe (approximately 2 x 10 6 cpm / ml) and an RNA-transferred nitrocellulose membrane were placed in a solution at 42 ° C. C overnight hybridization, the solution bag fresh 50% formamide - After 25 mM KH 2 P0 4 (. PH7 4) -5 x SSC-5 ⁇ Denhardt's solution, and 20 ( ⁇ g / ml salmon sperm DNA hybridization, the filter The membrane was washed in 1 x SSC-0.1% SDS at 55 ° C for 30 min. Then, it was analyzed and quantified using Phosphor Imager.
  • Example 4 In vitro expression, isolation and purification of recombinant human dihydrowheyase 12
  • Primer 3 5'-CCCCATATGATGGGGAGGTGGCCAAGAAAAGAA-3 '(Seq ID No: 5)
  • Pr imer4 5' -C ATGG ATCCTT AACACCATCTTATGACTTGGC A- 3 '(Seq ID No: 6)
  • the 5' ends of these two primers contain Ndel and BamHI digestion sites, followed by coding sequences for the 5 ,, and 3 'ends of the gene of interest, respectively.
  • the Ndel and BamHI digestion sites correspond to the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865). 3) Selective endonuclease sites.
  • PCR was performed using the PBS-0261bll plasmid containing the full-length target gene as a template.
  • the PCR reaction conditions were as follows: a total volume of 50 ⁇ 1 containing 10 pg of pBS-0261bll plasmid, primers Primer-3 and Primer-4 were lOpmol, Advantage polymerase Mix (Clontech) 1 ⁇ 1, respectively. Cycle parameters: 94. C 20s, 60 ° C 30s, 68. C 2 min, a total of 25 cycles. Ndel and BamHI were used to double digest the amplified product and plasmid P ET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase.
  • the ligation product was transformed into coliform bacteria DH50 using the calcium chloride method. After being cultured in LB plates containing kanamycin (final concentration 30 ⁇ ⁇ / ⁇ 1) overnight, positive clones were selected by colony PCR method and sequenced. A positive clone (PET-0261M1) with the correct sequence was selected, and the recombinant plasmid was transformed into E. coli BL21 (DE3) plySs (product of Novagen) using the calcium chloride method.
  • the host strain BL21 (pET-0261bll) was cultured at 37 ° C to the logarithmic growth phase, and IPTG was added to a final concentration of 1 ol. / L, continue to culture for 5 hours. Centrifuge the bacterial cells, decompose them by ultrasound, collect the supernatant by centrifugation, and use an affinity chromatography His. Bind Quick Cartr idge (6 His-Tag) binding column Novagen product) was chromatographed to obtain the purified human protein dihydroorotase 12. After SDS-PAGE electrophoresis, a single band was obtained at 12 kDa ( Figure 2).
  • a peptide synthesizer (product of PE company) was used to synthesize the following human dihydroorotase 12-specific peptides: NH2-Met-Gly-Arg-Trp-Pro-Arg-Lys-Glu-Gly-Arg-Leu-Asn -Arg-Leu-Val-C00H (SEQ ID NO: 7).
  • the polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex, respectively.
  • Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
  • the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
  • the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
  • the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by using a filter hybridization method.
  • Filter hybridization methods include dot blotting, Southern-blotting, Northern blotting, and copying methods. They are all used to fix the polynucleotide sample to be tested on the filter and then hybridize using basically the same steps.
  • the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer, so that the non-specific binding site of the sample on the filter is saturated with the carrier and the polymer.
  • the pre-hybridization solution is then replaced with a hybridization buffer containing the labeled probe and incubated to hybridize the probe to the target nucleic acid.
  • the unhybridized probes are removed by a series of membrane washing steps.
  • This embodiment utilizes higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals.
  • the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
  • the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
  • the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained. First, the selection of the probe
  • oligonucleotide fragments from the polynucleotide SEQ ID NO: 1 of the present invention for use as hybridization probes should follow the following principles and several aspects to be considered:
  • the preferred range of probe size is 18-50 nucleotides
  • Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements For homology comparison of the regions, if the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, the primary probe should not be used generally;
  • Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
  • Probe 1 which belongs to the second type of probe, is equivalent to the replacement mutation sequence (41Nt) of the gene fragment or its complementary fragment of SEQ ID NO: 1:
  • PBS phosphate buffered saline
  • step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
  • NC membranes nitrocellulose membranes
  • Two NC membranes are required for each probe, so that they can be used in the following experimental steps. High strength Conditions and strength conditions wash the film.
  • the sample membrane was placed in a plastic bag and 3-1 Omg pre-hybridization solution (1 OxDenhardt-s; 6xSSC, 0.1 Irag / ral CT DM (calf thymus DNA)) was added. After sealing the bag, shake at 68 ° C for 2 hours.
  • 3-1 Omg pre-hybridization solution (1 OxDenhardt-s; 6xSSC, 0.1 Irag / ral CT DM (calf thymus DNA)
  • Gene chip or DNA microarray is a new technology that many national laboratories and large pharmaceutical companies are currently developing and developing. It refers to the orderly and high-density arrangement of a large number of target gene fragments on glass, The data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software to achieve the purpose of fast, efficient, and high-throughput analysis of biological information.
  • the polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research of new gene functions; search for and screen new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases .
  • the specific method steps have been reported in the literature. For example, see the documents DeRi si, JL, Lyer, V. & Brown, PO (1997) Science 278, 680-686. And the documents Helle, RA, Schema, M. Chai, A., Shalom, D., (1997) PNAS 94: 2150-2155.
  • a total of 4,000 polynucleotide sequences of various full-length cDNAs are used as target DNA, including the polynucleotide of the present invention. They were respectively amplified by PCR. After the purified amplified product was purified, the concentration was adjusted to about 500 ng / ul, and spotted on a glass medium with a Cartesian 7500 spotter (purchased from Cartesian Company, USA). The distance between them is 280 ⁇ . The spotted slides were hydrated and dried, and then placed in a UV cross-linker for cross-linking. After elution, the DNA was fixed on the slides to prepare chips. The specific method steps have been reported in the literature. The sample post-processing steps in this embodiment are:
  • Total mRNA was extracted from human mixed tissues and specific tissues (or stimulated cell lines) in one step, and the mRNA was purified using Oligotex mRNA Midi Ki "purchased from QiaGen”.
  • Cy3dUTP (5-Amino-propargyl-2'-deoxyur idine 5--triphate coupled to Cy3 f luorescent dye, purchased from Araersham Phamacia Biotech) was used to label the mRNA of human mixed tissue, and the fluorescent reagent Cy5dUTP (5_Amino-propargyl-2 ' -deoxyuridine 5--tr iphate coupled to Cy5 f luorescent dye, purchased from Araersham Phamacia Biotech Company, labeled mRM of specific tissues (or stimulated cell lines) of the body, and prepared probes after purification.
  • Cy3dUTP 5-Amino-propargyl-2'-deoxyur idine 5--triphate coupled to Cy3 f luor
  • Probes from the two types of tissues were hybridized with the chip in a UniHyb TM Hybridization Solution (purchased from TeleChem) hybridization solution for 16 hours, and washed with a washing solution (1 x SSC, 0.2 touch) at room temperature Scanning was then performed with a ScanArray 3000 scanner (purchased from Genera Scanning, USA). The scanned images were analyzed and processed with Imagene software (Biodiscovery, USA) to calculate the Cy3 / Cy5 ratio of each point.
  • the above specific tissues are thymus, testis, muscle, spleen, lung, skin, thyroid, liver, PMA + Ecv304 cell line, PMA-Ecv304 cell line, and non-starved L0 2 cell line , L02 cell line stimulated by arsenic for 1 hour, L02 cell line stimulated by arsenic for 6 hours prostate, heart, lung cancer, fetal bladder, fetal small intestine, fetal large intestine, fetal thymus, fetal muscle, fetal liver, fetal kidney, fetal spleen, fetal brain Fetal lung and fetal heart.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

L'invention concerne une dihydro-orotase 12 humaine et le polynucléotide codant pour ce polypeptide ainsi qu'un procédé de production de ce polypeptide au moyen de méthodes recombinantes. L'invention concerne aussi une méthode d'application du polypeptide pour le traitement de maladies diverses telles que cancer, hémopathie, infection par le VIH, maladies immunes et inflammatoires. Elle concerne encore l'antagoniste du polypeptide et son utilisation thérapeutique. Elle concerne enfin l'utilisation du polynucléotide codant la dihydro-orotase 12.
PCT/CN2001/000666 2000-04-29 2001-04-28 Polypeptide humain dihydro-orotase 12 et polynucleotide codant pour ce polypeptide WO2001085776A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU85651/01A AU8565101A (en) 2000-04-29 2001-04-28 A novel polypeptide - human dihydroorotase 12 and the polynucleotide encoding said polypeptide

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN00115521.0 2000-04-29
CN 00115521 CN1321658A (zh) 2000-04-29 2000-04-29 一种新的多肽——人二氢乳清酸酶12和编码这种多肽的多核苷酸

Publications (1)

Publication Number Publication Date
WO2001085776A1 true WO2001085776A1 (fr) 2001-11-15

Family

ID=4584967

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2001/000666 WO2001085776A1 (fr) 2000-04-29 2001-04-28 Polypeptide humain dihydro-orotase 12 et polynucleotide codant pour ce polypeptide

Country Status (3)

Country Link
CN (1) CN1321658A (fr)
AU (1) AU8565101A (fr)
WO (1) WO2001085776A1 (fr)

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0260057A2 (fr) * 1986-09-02 1988-03-16 The University Of Melbourne 2-Oxo-4-carboxypyrimidines

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0260057A2 (fr) * 1986-09-02 1988-03-16 The University Of Melbourne 2-Oxo-4-carboxypyrimidines

Also Published As

Publication number Publication date
CN1321658A (zh) 2001-11-14
AU8565101A (en) 2001-11-20

Similar Documents

Publication Publication Date Title
WO2001090378A1 (fr) Nouveau polypeptide, proteine humaine hexokinase 11, et polynucleotide codant ce polypeptide
WO2001083538A1 (fr) Nouveau polypeptide, proteine humaine 36 du gene k-ras, et polynucleotide codant pour ce polypeptide
WO2001085776A1 (fr) Polypeptide humain dihydro-orotase 12 et polynucleotide codant pour ce polypeptide
WO2001048159A1 (fr) Nouveau polypeptide, dihydroorotase 9, et polynucleotide codant pour ce polypeptide
WO2001047975A1 (fr) Nouveau polypeptide, proteine 10 contenant un domaine chromo, et polynucleotide codant pour ce polypeptide
WO2001075037A2 (fr) Nouveau polypeptide, dihydroorotase humaine 40, et polynucleotide codant pour ce polypeptide
WO2001094371A1 (fr) Nouveau polypeptide, proteine ribosomale humaine s4-10, et polynucleotide codant ce polypeptide
WO2001083758A2 (fr) Nouveau polypeptide, dihydroorotase humaine 8, et polynucleotide codant pour ce polypeptide
WO2001075023A2 (fr) Nouveau polypeptide, phosphatidylinositol-3 (ptdins 3) kinase humaine 9, et polynucleotide codant pour ce polypeptide
WO2001083724A1 (fr) Nouveau polypeptide, dihydroorotase humaine 17, et polynucleotide codant pour ce polypeptide
WO2001083681A2 (fr) Nouveau polypeptide, dihydroorotase humaine 21, et polynucleotide codant pour ce polypeptide
WO2001075017A2 (fr) Nouveau polypeptide, dihydroorotase humaine 17, et polynucleotide codant pour ce polypeptide
WO2001072979A1 (fr) Nouveau polypeptide, dihydroorotase humaine 15, et polynucleotide codant pour ce polypeptide
WO2001090178A1 (fr) Nouveau polypeptide, dihydroorotase humaine 11, et polynucleotide codant ce polypeptide
WO2001073054A1 (fr) Nouveau polypeptide, dihydroorotase humaine 11, et polynucleotide codant pour ce polypeptide
WO2001047974A1 (fr) Nouveau polypeptide, dihydroorotase humaine 10, et polynucleotide codant pour ce polypeptide
WO2001090171A1 (fr) Nouveau polypeptide, proteine humaine ribosomale sii 12, et polynucleotide codant ce polypeptide
WO2001075079A1 (fr) Nouveau polypeptide, dihydroorotase humaine 13, et polynucleotide codant pour ce polypeptide
WO2001070790A1 (fr) Nouveau polypeptide, dihydrooratase humaine 23, et polynucleotide codant pour ce polypeptide
WO2002026795A1 (fr) Nouveau polypeptide, dihydrooratase humaine 15.29, et polynucleotide codant ce polypeptide
WO2001048160A1 (fr) Nouveau polypeptide, proteine tyrosine phosphatase 12, et polynucleotide codant pour ce polypeptide
WO2001073009A1 (fr) Nouveau polypeptide, bromodomaine humain 11, et polynucleotide codant pour ce polypeptide
WO2001074885A1 (fr) Nouveau polypeptide, spase i humaine 8, et polynucleotide codant pour ce polypeptide
WO2001047994A1 (fr) Nouveau polypeptide, proteine 10 utilisant pep, et polynucleotide codant pour ce polypeptide
WO2002020577A1 (fr) Nouveau polypeptide, nucleoside reductase 10.49, et polynucleotide codant ce polypeptide

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP