WO2001090173A1 - Nouveau polypeptide, chaperonine humaine cpn60 10, et polynucleotide codant pour ce polypeptide - Google Patents
Nouveau polypeptide, chaperonine humaine cpn60 10, et polynucleotide codant pour ce polypeptide Download PDFInfo
- Publication number
- WO2001090173A1 WO2001090173A1 PCT/CN2001/000827 CN0100827W WO0190173A1 WO 2001090173 A1 WO2001090173 A1 WO 2001090173A1 CN 0100827 W CN0100827 W CN 0100827W WO 0190173 A1 WO0190173 A1 WO 0190173A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- polypeptide
- polynucleotide
- protein
- molecular chaperone
- sequence
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
Definitions
- the present invention belongs to the field of biotechnology. Specifically, the present invention describes a novel polypeptide mate cpn60 protein 10 and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and polypeptide.
- Chaperone proteins are involved in many important biological processes such as protein folding and aggregation of oligomeric protein complexes, maintaining protein precursors in an unfolded state to facilitate protein transmembrane transport, and enabling denatured proteins to be disaggregated and repaired. It is mainly to help other peptides maintain the normal conformation to form the correct oligomeric structure, thereby exerting normal physiological functions. They are widely distributed, from bacteria to humans, animals and plants, and are abundant in prokaryotes, chloroplasts and mitochondria. The abnormal expression of such proteins in the organism will lead to the formation of normal conformations of some proteins, which will affect the normal physiological functions of various proteins and cause various diseases related to abnormal transport of substances, such as some metabolic disorders, immune disorders, etc. .
- the chaperone forms an oligomeric complex consisting of two different subunits: a 60Kd protein, such as cpn60 (groEL in bacteria); and a 13Kd protein, such as cpnl O (groES in bacteria) ). They all interact with some proteins in the body to regulate the functions of various proteins in the body.
- the cpn60 protein has weak ATPase activity. This subunit of all chaperone proteins consists of highly conserved 550-580 amino acid residues. The cpn60 protein contains a conserved consensus fragment of 12 amino acid residues, which is shown below:
- This sequence fragment is an important part of the interaction of this subunit with other proteins to coordinate the molecular chaperone to perform normal physiological functions. This fragment is also an important part of the ATPase activity of this subunit. Mutations in this sequence segment will cause the subunit to malfunction, which will affect the function of the entire chaperone in the organism.
- the protein can also combine with other related proteins in the body to play a variety of similar protein regulation. Therefore, it is closely related to the occurrence of diseases such as various metabolic disorders and immune system disorders in the body.
- molecular chaperone cpn60 protein 10 protein plays an important role in regulating important functions of the body, such as cell division and embryo development, and it is believed that a large number of proteins are involved in these regulatory processes, there has been a need in the art to identify more involved in these processes Molecular chaperone cpn60 protein 10 protein, especially the amino acid sequence of this protein is identified. Isolation of the new molecular chaperone cpn60 protein 10 protein encoding gene also provides a basis for research to determine the role of the protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so it is important to isolate its code for DM. Object of the invention
- An object of the present invention is to provide an isolated novel polypeptide-molecular chaperone cpn60 protein 10 and fragments, analogs and derivatives thereof.
- Another object of the invention is to provide a polynucleotide encoding the polypeptide.
- Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding a molecular chaperone cpn60 protein 10.
- Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding a molecular chaperone cpn60 protein 10.
- Another object of the present invention is to provide a method for producing the molecular chaperone cpn60 protein 10.
- Another object of the present invention is to provide antibodies against the cpn60 protein 10, a chaperone of a polypeptide of the present invention.
- Another object of the present invention is to provide mimic compounds, antagonists, agonists, and inhibitors against cpn60 protein 10, a molecular chaperone of the polypeptide of the present invention.
- Another object of the present invention is to provide a method for diagnosing and treating diseases associated with abnormalities of the molecular chaperone cpn60 protein 10. Summary of invention
- the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
- the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
- the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
- sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 316-585 in SEQ ID NO: 1; and (b) a sequence having 1-1405 in SEQ ID NO: 1 Sequence of bits.
- the present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
- the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
- the invention also relates to a method for selecting compounds that mimic, activate, antagonize or inhibit the activity of the molecular chaperone cpn60 protein 10 protein, which comprises utilizing the polypeptide of the invention.
- the invention also relates to compounds obtained by this method.
- the invention also relates to a method for in vitro detection of a disease or susceptibility to disease associated with abnormal expression of the molecular chaperone c P n6 () protein 10 protein, comprising detecting mutations in the polypeptide or a sequence encoding a polynucleotide thereof in a biological sample, Alternatively, the amount or biological activity of a polypeptide of the invention in a biological sample is detected.
- the invention also relates to a pharmaceutical composition
- a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
- the present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention in the preparation of a medicament for treating cancer, developmental disease or immune disease or other diseases caused by abnormal expression of molecular chaperone cpn60 protein 10.
- FIG. 1 is a comparison diagram of gene chip expression profiles of molecular chaperone cpn60 protein 10 and molecular chaperon cpn60 protein according to the present invention.
- the top graph is a graph of the molecular chaperone cpn60 protein 10
- the bottom graph is the graph of the molecular chaperon cpn60 protein.
- 1-bladder mucosa 2-PMA + Ecv304 cell line, 3-LPS + Ecv304 cell line thymus, 4-normal fibroblasts 1024NC, 5-Fibroblas t, growth factor stimulation, 1024NT, 6-scar into fc growth factor stimulation, 1013HT, 7-scar into fc stimulation without growth factor, 1013HC, 8-bladder cancer cell EJ, 9-bladder cancer, 10-bladder cancer, 11-liver cancer, 12- Liver cancer cell lines, 13-fetal skin, 14-spleen, 15-prostate cancer, 16-jejunum adenocarcinoma, 17 cardia cancer.
- Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of the isolated molecular chaperone cpn60 protein 10.
- OkDa is the molecular weight of the protein.
- the arrow indicates the isolated protein band.
- Nucleic acid sequence refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
- amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
- amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
- a “variant" of a protein or polynucleotide refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it.
- the changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence.
- Variants can have "conservative" changes, in which the amino acid substituted has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine.
- Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
- “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
- Insertion means that a change in the amino acid sequence or nucleotide sequence results in an increase in one or more amino acids or nucleotides compared to a molecule that exists in nature.
- Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
- Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
- immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response and to bind specific antibodies in a suitable animal or cell.
- An "agonist” refers to a molecule that, when combined with the molecular partner cpn60 protein 10, can cause the protein to change, thereby regulating the activity of the protein.
- An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that can bind the molecular chaperone cpn60 protein 10.
- Antagonist refers to a molecule that, when combined with the molecular chaperone cpn60 protein 10, can block or regulate the biological or immunological activity of the molecular chaperone cpn60 protein 10.
- Antagonist And inhibitors can include proteins, nucleic acids, carbohydrates or any other molecule that can bind to the molecular chaperone cpn60 protein 10.
- “Regulation” refers to a change in the function of the molecular chaperone cpn60 protein 10, including an increase or decrease in protein activity, a change in binding characteristics, and any other biological, functional, or immune properties of the molecular chaperone cpn60 protein 10.
- Substantially pure means substantially free of other proteins, lipids, carbohydrates or other substances with which it is naturally associated.
- Those skilled in the art can purify the molecular chaperone cpn60 protein 10 using standard protein purification techniques.
- the essentially pure chaperone cpn60 protein 10 produces a single main band on a non-reducing polyacrylamide gel.
- Molecular chaperone cpn60 protein 10 peptide purity can be analyzed by amino acid sequence.
- Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
- sequence C-T-G-A
- complementary sequence G-A-C-T.
- the complementarity between two single-stranded molecules may be partial or complete.
- the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
- “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
- Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Southern imprinting or Northern blotting, etc.) under conditions of reduced stringency. Substantially homologous sequences or hybridization probes can compete and inhibit the binding of fully homologous sequences to target sequences under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.
- Percent identity refers to the percentage of sequences that are the same or similar in a comparison of two or more amino acid or nucleic acid sequences. Percent identity can be determined electronically, such as through the MEGALIGN program
- the MEGALIGN program can compare two or more sequences (Higgins, D. G. and
- the percent identity between nucleic acid sequences can also be determined by the Clus ter method or by methods known in the art such as Jotun Hein (Hein J., (1990) Methods in enzymology 183: 625-645). 0 "Similarity" refers to amino acids The amino acid residues in the corresponding positions are the same when the sequences are aligned. Or the extent of conservative substitution.
- Amino acids used for conservative substitution may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
- Antisense refers to a nucleotide sequence that is complementary to a particular DM or RNA sequence.
- Antisense strand refers to a nucleic acid strand that is complementary to a “sense strand.”
- Derivative refers to HFP or a chemical modification of its nucleic acid. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
- Antibody refers to a complete antibody molecule and its fragments, such as Fa,? ( ⁇ ') 2 and? 7, which can specifically bind to the epitope of the molecular chaperone cpn60 protein 10.
- a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
- isolated refers to the removal of a substance from its original environment (for example, its natural environment if it is naturally occurring).
- a naturally-occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
- Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not part of its natural environment, they are still isolated.
- isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
- polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances in the natural state .
- isolated molecular chaperone cpn60 protein 10 means that the molecular chaperone cpn60 protein 10 is substantially free of other proteins, lipids, sugars, or other substances with which it is naturally associated. Those skilled in the art can purify the molecular chaperone cpn60 protein 10 using standard protein purification techniques. Substantially pure peptides produce a single main band on a non-reducing polyacrylamide gel. The purity of the molecular chaperone cpn60 protein 10 peptide can be analyzed by amino acid sequence.
- the present invention provides a new polypeptide, the molecular chaperone cpn60 protein 10, which is basically composed of the amino acid sequence shown in SEQ ID NO: 2.
- the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
- the polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be obtained from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammals) using recombinant technology. Milk animal cells).
- the polypeptide of the invention may be glycosylated, or it may be non-glycosylated.
- Polypeptides of the invention may also include or exclude starting methionine residues.
- the invention also includes fragments, derivatives and analogs of the molecular chaperone cpn60 protein 10.
- fragment refers to a polypeptide that substantially retains the same biological function or activity of the molecular chaperone cpn60 protein 10 of the present invention.
- a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution
- the amino acid may or may not be encoded by a genetic codon; or ( ⁇ ) such a type in which one or more amino acid residues are substituted with other groups to include a substituent; or (III) such A type in which a mature polypeptide is fused to another compound (such as a compound that extends the half-life of a polypeptide, such as polyethylene glycol); or (IV) a type of polypeptide sequence in which an additional amino acid sequence is fused into a mature polypeptide ( Such as leader sequences or secreted sequences or sequences used to purify this polypeptide or protease sequences).
- such fragments, derivatives and analogs are considered to be within the knowledge of those skilled in the art.
- the invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
- the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
- the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a polynucleotide sequence of 1405 bases in length and its open reading frames 316-585 encode 89 amino acids.
- the peptide has a similar expression profile with the molecular chaperone cpn60 protein, and it can be deduced that the molecular chaperone cpn60 protein 10 has a similar function as the molecular chaperone C pn60 protein.
- the polynucleotide of the present invention may be in the form of DNA or RM.
- DM forms include cDNA, genomic DNA, or synthetic DM.
- DNA can be single-stranded or double-stranded.
- DNA can be coding or non-coding.
- the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
- a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
- the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
- polynucleotide encoding a polypeptide is meant to include polynucleotides that encode such polypeptides and polynucleotides that include additional coding and / or noncoding sequences.
- the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention. Variants of this polynucleotide may be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
- an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
- the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity, between the two sequences).
- the present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions.
- “strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60 ° C; or (2) Add denaturants during hybridization, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% Ficol 1, 42 ° C, etc .; or (3) only between the two sequences Hybridization occurs only when the identity is at least 95%, and more preferably 97%.
- the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
- nucleic acid fragments that hybridize to the sequences described above.
- a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 nuclei. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques such as PCR to identify and / or isolate polynucleotides encoding the molecular chaperone cpn60 protein 10.
- polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
- the specific polynucleotide sequence encoding the molecular chaperone c P n60 protein 10 of the present invention can be obtained by various methods.
- polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or CDM libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
- the DM fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DM of the polypeptide.
- genomic DNA isolation is the least commonly used. Direct chemical synthesis of DM sequences is often the method of choice. The more commonly used method is the separation of the CDM sequences.
- the standard method for isolating the cDNA of interest is to isolate m A from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage CDM library. There are many mature techniques for extracting mRNA, and kits are also commercially available (Qiagene).
- the construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manua, Cold Spring Harbor Labora tory. New York, 1989).
- Commercially available cDNA libraries such as different cDNAs from Clontech library. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
- genes can be screened from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DNA-RNA hybridization; (2) the presence or absence of a marker gene function; (3) determination of the level of the molecular chaperone 0 1160 : protein 10 transcript; ( 4) Detecting gene-expressed protein products by immunological techniques or by measuring biological activity. The above methods can be used singly or in combination.
- the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
- the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
- the probe used here is usually a DM sequence chemically synthesized based on the gene sequence information of the present invention.
- the genes or fragments of the present invention can of course be used as probes.
- DM probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
- immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) can be used to detect protein products expressed by the molecular chaperone cpn60 protein 10 gene expression protein.
- ELISA enzyme-linked immunosorbent assay
- a method (Sa iki, et al. Sc; 1985; 230: 1 350-1354) using PCR technology to amplify DNA / RNA is preferably used to obtain the gene of the present invention.
- the RACE method RACE-Rapid Amplification of cDNA Ends
- the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein Select and synthesize using conventional methods.
- the amplified DM / RNA fragment can be isolated and purified by conventional methods such as by gel electrophoresis.
- polynucleotide sequence of the gene of the present invention or various DM fragments and the like obtained as described above can be measured by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, sequencing needs to be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
- the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using the molecular chaperone cpn60 protein 10 coding sequence, and a method for producing the polypeptide of the present invention by recombinant technology. .
- a polynucleotide sequence encoding the molecular chaperone cpn60 protein 10 can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
- vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
- Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al.
- any plasmid and vector can be used to construct a recombinant expression vector.
- An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
- DM sequences encoding the molecular chaperone cpn60 protein 10 and appropriate transcription / translation regulatory elements. These methods include in vitro recombinant DNA technology, DM synthesis technology> in vivo recombination technology (Sambroook, et al. Molecular Cloning, a Labora tory Manua 1, Cold Spr ing Harbor Laboratory. New York, 1989).
- the DM sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis. Representative examples of these promoters are: the lac or trp promoter of E.
- the expression vector also includes a ribosome binding site for translation initiation, a transcription terminator, and the like. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors expressed by DM, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers and adenovirus enhancers on the late side of the origin of replication.
- the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
- selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
- GFP fluorescent protein
- tetracycline or ampicillin resistance for E. coli.
- a polynucleotide encoding the molecular chaperone cpn60 protein 10 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a genetically engineered host cell containing the polynucleotide or the recombinant vector.
- the term "host cell” refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E.
- coli Streptomyces
- bacterial cells such as Salmonella typhimurium
- fungal cells such as yeast
- plant cells such as fly S2 or Sf 9
- animal cells such as CH0, COS or Bowes melanoma cells.
- Transformation of a host cell with a DNA sequence according to the present invention or a recombinant vector containing the DM sequence can be performed using conventional techniques well known to those skilled in the art.
- the host is a prokaryote such as E. coli
- competent cells capable of absorbing DM can be harvested after the exponential growth phase and treated with the (: ⁇ 12 method, the steps used It is well known in the art.
- MgCl 2 is used.
- transformation can also be performed by electroporation.
- the host is a eukaryote, the following DM transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
- polynucleotide sequence of the present invention can be used to express or produce recombinant molecular chaperone cpn60 protein 10 (Science, 1984; 224: 1431). Generally there are the following steps:
- the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
- a suitable method such as temperature conversion or chemical induction
- the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If necessary, the recombinant protein can be isolated and purified by various separation methods using its physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
- conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid
- polypeptides of the present invention as well as antagonists, agonists and inhibitors of the polypeptides, can be directly used in the treatment of diseases, for example, they can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection, and immune diseases.
- Chaperone proteins are involved in many important biological processes such as protein folding and aggregation of oligomeric protein complexes, maintaining protein precursors in an unfolded state to facilitate protein transmembrane transport, and enabling denatured proteins to be disaggregated and repaired. It is mainly to assist other peptides to maintain the normal conformation to form the correct oligomeric structure, thereby exerting normal physiological functions.
- the specific sequence of the molecular chaperone subunit cpn60 protein is an important part of its interaction with other proteins to coordinate the normal chaperone function of the molecular chaperone. This fragment is also an important part of the ATPase activity of this subunit. Mutations in this sequence segment will cause the subunit to malfunction, which will affect the function of the entire chaperone in the organism.
- the abnormal expression of the specific cpn60 protein raot if will cause the function of the polypeptide containing the mot if of the present invention to be abnormal, resulting in the coordination of protein folding, disaggregation, assembly and repair after transmembrane transport. Loss of function and related diseases such as tumors, embryonic developmental disorders, growth and development disorders, inflammation, etc.
- the abnormal expression of the molecular chaperone cpn60 protein 13 of the present invention will produce various diseases, especially various tumors, embryonic developmental disorders, growth disorders, and inflammation. These diseases include, but are not limited to:
- Embryonic disorders congenital abortion, cleft palate, limb loss, limb differentiation disorder, hyaline membrane disease, atelectasis, polycystic kidney, double ureter, cryptorchidism, congenital inguinal hernia, double uterus, vaginal atresia, suburethral Fissure, hermaphroditism, atrial septal defect, ventricular septal defect, pulmonary stenosis, arterial duct occlusion, neural tube defect, congenital hydrocephalus, iris defect, congenital cataract, congenital glaucoma or cataract, congenital deafness
- Growth and development disorders mental retardation, cerebral palsy, brain development disorders, mental retardation, familial cerebral nucleus dysplasia syndrome, strabismus, skin, fat and muscular dysplasia such as congenital skin laxity, premature aging Disease, congenital keratosis, various metabolic defects such as various amino acid metabolic defects, stunting, dwarfism, sexual retardation
- Tumors of various tissues gastric cancer, liver cancer, lung cancer, esophageal cancer, breast cancer, leukemia, lymphoma, thyroid tumor, uterine fibroids, neuroblastoma, astrocytoma, ependymoma, glioblastoma, Colon cancer, melanoma, adrenal cancer, bladder cancer, bone cancer, osteosarcoma, myeloma, bone marrow cancer, brain cancer, uterine cancer, endometrial cancer, gallbladder cancer, thymic tumor, nasal cavity and sinus tumor, nasopharynx Cancer, laryngeal cancer, tracheal tumor, fibroma, fibrosarcoma, lipoma, liposarcoma, leiomyoma
- Inflammation various infections, allergic reactions, bronchial asthma, adult respiratory distress syndrome, rheumatoid arthritis, rheumatoid arthritis, osteoarthritis, glomerulonephritis, immune complex glomerulonephritis, Osteoporosis, dermatomyositis, urticaria, atopic dermatitis, hemochromatosis, polymyositis, Addison's disease, Graves' disease, chronic active hepatitis, intestinal emergency syndrome, atrophic gastritis , Systemic lupus erythematosus, myasthenia gravis, cerebrospinal multiple sclerosis, Guillain-Barre syndrome, intracranial granulomatosis, Wegener's granulomatosis, autoimmune thyroiditis, pancreatitis, myocarditis, atherosclerosis, multiple Scleroderma: various infections, allergic reactions, bronchial asthma, adult respiratory distress syndrome, rhe
- the abnormal expression of the molecular chaperone cpn60 protein 10 of the present invention will also produce certain hereditary, hematological and immune system diseases.
- the invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) the molecular chaperone cpn60 protein 10.
- Agonists enhance the biological functions of molecular chaperone cpn60 protein 10 to stimulate cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
- mammalian cells or proteins expressing the molecular chaperone cpn60 protein 10 can be expressed in the presence of drugs.
- the membrane preparation was cultured together with the labeled molecular chaperone cpn60 protein 10. The ability of the drug to increase or block this interaction is then determined.
- Antagonists of the molecular chaperone cpn60 protein 10 include antibodies, compounds, receptor deletions, and the like that have been screened.
- the antagonist of the molecular chaperone cpn60 protein 10 can bind to the molecular chaperone cpn60 protein 10 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot perform biological functions.
- the molecular chaperone cpn60 protein 10 can be added to a bioanalytical assay to determine whether the compound is an antagonist by measuring the effect of the compound on the interaction between the molecular chaperone cpn60 protein 10 and its receptor. Receptor deletions and analogs that act as antagonists can be screened in the same way as for screening compounds described above.
- Peptide molecules capable of binding to the molecular partner cpn60 protein 10 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. When screening, generally 10 molecules of the molecular chaperone cpn60 protein should be labeled.
- the present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies.
- the invention also provides antibodies directed against the molecular chaperone cpn60 protein 10 epitope. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments generated from Fab expression libraries.
- polyclonal antibodies can be obtained by immunizing animals (such as rabbits, mice, rats, etc.) with the molecular chaperone cpn60 protein 10 directly.
- a variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's adjuvant.
- Techniques for preparing monoclonal antibodies for the molecular chaperone cpn60 protein 10 include, but are not limited to, hybridoma technology (Kohler and Miste in. Nature, 1975, 256: 495-497), triple tumor technology, human beta-cell hybridoma technology, EBV-hybridoma technology, etc.
- Antibodies against chaperone c P n60 protein 10 can be used in immunohistochemistry to detect chaperone cpn60 protein 10 in biopsy specimens.
- Monoclonal antibodies that bind to the molecular chaperone cpn60 protein 10 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
- Antibodies can also be used to design immunotoxins that target a particular part of the body.
- the molecular chaperone c P ri60 protein 10 high affinity monoclonal antibodies can interact with bacterial or plant toxins (such as diphtheria toxin, ricin, Ormosine, etc.).
- a common method is to attack the amino group of the antibody with a thiol crosslinker such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
- This hybrid antibody can be used to kill the molecular partner cpn60 protein 10 positive cells.
- the antibodies in the present invention can be used to treat or prevent diseases related to the molecular chaperone cpn60 protein 10.
- Administration of appropriate doses of antibodies can stimulate or block the production or activity of the molecular chaperone C pn60 protein 10.
- the invention also relates to a diagnostic test method for quantitatively and locally detecting the molecular chaperone cpn60 protein 10 level.
- tests are well known in the art and include FISH assays and radioimmunoassays.
- the level of the molecular chaperone cpn60 protein 10 detected in the test can be used to explain the importance of the molecular chaperone cpn60 protein 10 in various diseases and to diagnose diseases in which the molecular chaperone cpn60 protein 10 plays a role.
- the polypeptide of the present invention can also be used for peptide mapping analysis.
- the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
- '' Polynucleotides encoding molecules that promote cpn60 protein 10 can also be used for a variety of therapeutic purposes. Gene therapy technology can be used to treat abnormal cell proliferation, development, or metabolism caused by the absence or abnormal / inactive expression of the molecular chaperone cpn60 protein 10.
- Recombinant gene therapy vectors can be designed to express mutated molecular chaperone cpn60 protein 10 to inhibit endogenous molecular chaperone cpn60 protein 10 activity.
- a mutated molecular chaperone cpn60 protein 10 may be a shortened molecular chaperone cpn60 protein 10 that lacks a signal transduction domain. Although it can bind to downstream substrates, it lacks signal transduction activity. Therefore, the recombinant gene therapy vector can be used to treat diseases caused by abnormal expression or activity of the molecular chaperone cpn60 protein 10.
- Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to transfer a polynucleotide encoding the molecular chaperone cpn60 protein 10 into cells.
- a method for constructing a recombinant viral vector carrying a polynucleotide encoding a molecular chaperone cpn60 protein 10 can be found in existing literature (Sambrook, et al.).
- a polynucleotide encoding the molecular chaperone cpn60 protein 10 can be packaged into liposomes and transferred into cells.
- Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
- a vector such as a virus, phage, or plasmid
- Oligonucleotides including antisense RM and DNA
- ribozymes that inhibit the molecular chaperone cpn60 protein 10 mRNA are also within the scope of the present invention.
- a ribozyme is an enzyme-like RNA molecule that can specifically decompose a specific RM. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation.
- Antisense RM, DNA and ribozymes can be obtained by any existing RM or DM synthesis technology, such as the technology of solid phase phosphate amide synthesis of oligonucleotides has been widely used.
- Antisense RM molecules can be encoded by The DNA sequence of the RNA is obtained by transcription in vitro or in vivo. This DM sequence has been integrated downstream of the vector's RNA polymerase promoter. In order to increase the stability of a nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the ribonucleoside linkages should use phosphate thioester or peptide bonds instead of phosphodiester bonds.
- the polynucleotide encoding the molecular chaperone c P n60 protein 10 can be used for the diagnosis of diseases related to the molecular chaperone cpn60 protein 10.
- the polynucleotide encoding the chaperone cpn60 protein 10 can be used to detect the expression of the chaperone cpn60 protein 10 or the abnormal expression of the chaperone cpn60 protein 10 in a disease state.
- the DNA sequence encoding the molecular chaperone cpn60 protein 10 can be used to hybridize biopsy specimens to determine the expression status of the molecular chaperone cpn60 protein 10. Hybridization techniques include Southern blotting, Nor thern blotting, and in situ hybridization.
- RNA-polymerase chain reaction in vitro amplification of the specific chaperone cpn60 protein 10 can also detect the transcription product of the chaperone cpn60 protein 10.
- Detection of mutations in the molecular chaperone cpn60 protein 10 gene can also be used to diagnose molecular chaperone cpn60 protein 10-related diseases.
- Molecular chaperone cpn60 protein 10 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type molecular chaperone cpn60 protein 10 DNA sequence. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression. Therefore, the Nor thern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
- sequences of the invention are also valuable for chromosome identification. This sequence will specifically target a specific position on a human chromosome and can hybridize to it. Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for marking chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DNA sequences on a chromosome.
- PCR primers (preferably 15-35bp) are prepared from the cDNA, and the sequences can be located on the chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
- PCR localization of somatic hybrid cells is a quick way to localize DM to specific chromosomes.
- oligonucleotide primers of the present invention by a similar method, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
- Other similar strategies that can be used for chromosomal localization include in situ Hybridization, pre-screening of chromosomes using labeled flow sorting, and pre-selection of hybridization, thereby constructing a chromosome-specific cDNA library.
- Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step.
- FISH Fluorescent in situ hybridization
- the difference in cDM or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).
- the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
- suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
- the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
- the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
- a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
- these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell.
- the polypeptides of the invention can be used in combination with other therapeutic compounds.
- the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
- the molecular chaperone cpn60 protein 10 is administered in an amount effective to treat and / or prevent a specific indication.
- the amount and dose range of the molecular chaperone cpn60 protein 10 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician. Examples
- RNA Human fetal brain total RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform.
- Poly (A) mRM was isolated from total RNA using Quik mRM Isolat ion Kit (product of Qiegene). 2ug poly (A) mRM forms cDM by reverse transcription. Smart cDM cloning kit (purchased from Clontech
- Dye terminate cycle react ion sequencing ki t Perkin-Elmer
- ABI 377 automatic sequencer Perkin-Elmer
- the determined cDNA sequences were compared with the existing public DM sequence database (Genebank). By comparison, it was found that the cMA sequence of one of the clones 0357c03 was a new DM.
- a series of primers were synthesized to determine the inserted cDNA fragment of the clone in both directions.
- the total RM of fetal brain cells was used as a template, and ol igo-dT was used as a primer for reverse transcription reaction to synthesize cDM. After purification by Qiagene's kit, the following primers were used for PCR amplification:
- Primer 1 5: one GAGGTTGGTTGATTCAAGTGGTTT-3, (SEQ ID NO: 3)
- Primer2 5'- TCTTAATCAAAAAATAATTTATTA -3 '(SEQ ID NO: 4)
- Primerl is a forward sequence located at the 5th end of SEQ ID NO: 1, starting at lbp;
- Primer2 is the 3 'end reverse sequence in SEQ ID NO: 1.
- Amplification conditions 50 mmol / L KCl, 10 mmol / L Tris-HCl pH 8.5, 1.5 mmol / L MgCl 2 , 2 (mol / L dNTP, 1 Opmol primers in a reaction volume of 50 ⁇ 1 , 1U of Taq DM polymerase (product of Clontech).
- the reaction was performed for 25 cycles on a PE9600 DNA thermal cycler (Perkin-Elmer) under the following conditions: 94 ° C 30sec; 55 ° C 30sec; 72 ° C 2min.
- ⁇ -act in was used as a positive control and template blank was used as a negative control.
- Amplification products were purified using a QIAGEN kit and TA The cloning kit was ligated to a pCR vector (Invitrogen). The results of DNA sequence analysis showed that the DNA sequence of the PCR product was exactly the same as 1-1405bp shown in SEQ ID NO: 1.
- Example 3 Northern blot analysis of the expression of the molecular chaperone cpn60 protein 10 gene Total RNA was extracted in one step [Anal. Biochem 1987, 162, 156-159]. This method involves acid guanidinium thiocyanate phenol-chloroform extraction.
- the tissue was homogenized with 4M guanidine isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1), centrifuge after mixing. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water.
- RNA was electrophoresis was performed on a 1.2% agarose gel containing 20 mM 3- (N-morpholino) propanesulfonic acid (pH 7.0)-5 mM sodium acetate-ImM EDTA-2.2 M formaldehyde. It was then transferred to a nitrocellulose membrane.
- 32 P dATP labeled probe 32 P- DM prepared by the random primer Method - with o. The DM probe used was the sequence of the coding region (316bp to 585bp) of the PCR amplified molecular chaperone C pn60 protein shown in FIG. 1.
- a 32P-labeled probe (approximately 2 x 10 6 cpm / ml) was hybridized with a nitrocellulose membrane to which RNA was transferred at 42 ° C overnight in a solution containing 50% formamide-25mM H 2 P0 4 (. pH7 4) - 5 x SSC-5 ⁇ Denhardt's solution and 200 ⁇ 8 / ⁇ 1 salmon sperm DNA. After hybridization, the filter was washed in 1 x SSC-0.1% SDS at 55 ° C for 30rain. Then, Phosphor Imager was used for analysis and quantification.
- Example 4 In vitro expression, isolation and purification of recombinant molecular chaperone cpn60 protein 10
- Pr imer 3 5'-CCCCATATGATGCTCATTTACCATTCTAAAAAC-3 '(Seq ID No: 5)
- Pr imer4 5'-CATGGATCCTTACCAGTCATGAAAAACAATATT-3' (Seq ID No: 6)
- the 5 'ends of these two primers contain Ndel and BaraHI digestion respectively Sites, followed by the coding sequences of the 5 'and 3' ends of the gene of interest, respectively, and the Ndel and BamHI restriction sites correspond to the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865. 3) Selective endonuclease site.
- PCR reaction was performed using the pBS-0357C03 plasmid containing the full-length target gene as a template.
- PCR reaction conditions were: 1 in a total volume of 50 ⁇ plasmid pBS-0357c03 containing 10pg, primer Pr imer - 3 and Pr imer-4 were l Opmol, Advantage polymerase Mix (Clontech Products) 1 ⁇ 1.
- Cycle parameters 94. C 20s, 60 ° C 30s, 68 ° C 2 rain, a total of 25 cycles. Ndel and BamHI were used to double digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase.
- the ligation product was transformed into coliform bacteria DH50 using the calcium chloride method. After being cultured overnight on LB plates containing kanamycin (final concentration 3 ( ⁇ g / ml)), positive clones were screened by colony PCR and sequenced. Positive clone with correct sequence (pET-0357c03) Granules were transformed into E. coli BL21 (DE3) plySs (product of Novagen).
- Polypeptide synthesizer (product of PE company) was used to synthesize the following molecular chaperone cpn60 protein 10 specific peptides: NH2-Met-Leu-I le-Tyr-Hi s-Ser-Lys-Asn-Pro-Lys-Ser-Leu- Lys-Asn-Tyr-C00H (SEQ ID NO: 7).
- the polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex. For methods, see: Avrameas, et al. Immunochemi stry, 1969; 6: 43.
- the suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in various aspects.
- the probes can be used to hybridize to the genome or CDM library of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
- the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
- the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by using a filter hybridization method.
- Filter hybridization methods include dot blotting, Southern blotting, Northern blotting, and copying methods. They all use the same steps of hybridization after fixing the polynucleotide sample to be tested on the filter.
- the sample-fixed filter is first applied
- the probe-free hybridization buffer is pre-hybridized so that the non-specific binding site of the sample on the filter is saturated with the carrier and the synthetic polymer.
- the pre-hybridization solution is then replaced with a hybridization buffer containing the labeled probe and incubated to hybridize the probe to the target nucleic acid.
- the unhybridized probes are removed by a series of membrane washing steps.
- This embodiment utilizes higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals.
- the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
- the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
- the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
- oligonucleotide fragments from the polynucleotide SEQ ID NO: 1 of the present invention for use as hybridization probes should follow the following principles and several aspects to be considered:
- the preferred range of probe size is 18-50 nucleotides
- Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other unknown genomic sequences and their complements The regions are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, then the primary probe should not be used;
- Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (only):
- Probe 2 which belongs to the second type of probe, is equivalent to the replacement mutation sequence (41Nt) of the gene fragment or its complementary fragment of SEQ ID NO: 1:
- PBS phosphate buffered saline
- NC membranes nitrocellulose membranes
- Two NC membranes are required for each probe, so that they can be used in the following experimental steps.
- the film was washed with high-strength conditions and strength conditions, respectively.
- the sample membrane was placed in a plastic bag, and 3 to 10 mg of prehybridization solution (lOxDenhardt-s; 6xSSC, 0.1 mg / ral CT DM (calf thymus DNA)) was added. After sealing the bag, shake at 68 ° C for 2 hours.
- prehybridization solution lOxDenhardt-s; 6xSSC, 0.1 mg / ral CT DM (calf thymus DNA)
- Gene chip or DNA microarray is a new technology that many national laboratories and large pharmaceutical companies are currently developing and developing. It refers to the orderly and high-density arrangement of a large number of target gene fragments on glass, The data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software to achieve the purpose of fast, efficient, and high-throughput analysis of biological information.
- the polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research of new gene functions; search for and screen new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases .
- the specific method steps have been reported in the literature, for example, see the literature DeRi si, JL, Lyer, V. & Brown, PO (1997) Sc ience 278, 680-686. And the literature Hel le, RA, Schema, M Chai, A., Sha lom, D., (1997) PNAS 94: 2150-2155.
- a total of 4,000 polynucleotide sequences of various full-length cDNAs are used as target DNA, including the polynucleotide of the present invention. They were respectively amplified by PCR. After the purified amplified product was purified, the concentration was adjusted to about 500 ng / ul, and spotted on a glass medium with a Cartesian 7500 spotter (purchased from Cartesian Company, USA). The distance between them is 280 ⁇ . The spotted slides were hydrated and dried, cross-linked in a UV cross-linker, and dried after elution to fix the DNA on the glass slide to prepare a chip. Its specific method steps There have been many reports in the literature. The sample post-processing steps in this embodiment are:
- Total mRNA was extracted from human mixed tissues and specific tissues (or stimulated cell lines) in one step, and mRM was purified with Oligotex raRNA Midi Kit (purchased from QiaGen).
- the fluorescent test J Cy3dUTP (5-Araino-propargy 1-2 '-deoxyur idine 5'-triphate coupled to Cy3 f luorescent dye, purchased from Amersham Phamacia Biotech) was used to label the mRNA of human mixed tissue, and the fluorescent reagent Cy5dUTP (5-Amino-propargy 1-2'-deoxyur idine 5'-triphate coupled to Cy5 f luorescent dye, purchased from Amersham Phamacia Biotech) was used to label the mRNA of specific tissues (or stimulated cell lines) in the body, and was prepared after purification. Probe. For specific steps and methods, see:
- the probes from the above two tissues and the chip were respectively hybridized in a UniHyb TM Hybridizat ion Solut ion (purchased from TeleChem) hybridization solution for 16 hours, and washed with a washing solution (lx SSC, 0.2% SDS) at room temperature. Scanning was performed with a ScanArray 3000 scanner (purchased from Genera Scanning, USA), and the scanned images were analyzed and processed with Imagene software (Biodiscovery, USA) to calculate the Cy3 / Cy5 ratio of each point.
- the above specific tissues are bladder mucosa, PMA + Ecv304 cell line, LPS + Ecv304 cell line thymus, normal fibroblasts 1024NC, Fibroblas t, growth factor stimulation, 1024NT, scar-like fc growth factor Stimulation, 1013HT, scar into fc without stimulation with growth factors, 1013HC, bladder cancer cell EJ, bladder cancer, bladder cancer, liver cancer, liver cancer cell line, fetal skin, spleen, prostate cancer, jejunum adenocarcinoma, cardia cancer. Based on these 17 Cy3 / Cy5 ratios, a histogram is drawn ( Figure 1). It can be seen from the figure that the molecular chaperone cpn60 protein 10 and the molecular chaperone cpn60 protein expression profile according to the present invention are very similar.
Landscapes
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Gastroenterology & Hepatology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Medicinal Chemistry (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Toxicology (AREA)
- Peptides Or Proteins (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
AU79545/01A AU7954501A (en) | 2000-05-24 | 2001-05-21 | A novel polypeptide, a molecular chaperone cpn60 protein 10 and the polynucleotide encoding the polypeptide |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN00115833.3 | 2000-05-24 | ||
CN 00115833 CN1324814A (zh) | 2000-05-24 | 2000-05-24 | 一种新的多肽——分子伴侣cpn60蛋白10和编码这种多肽的多核苷酸 |
Publications (1)
Publication Number | Publication Date |
---|---|
WO2001090173A1 true WO2001090173A1 (fr) | 2001-11-29 |
Family
ID=4585275
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/CN2001/000827 WO2001090173A1 (fr) | 2000-05-24 | 2001-05-21 | Nouveau polypeptide, chaperonine humaine cpn60 10, et polynucleotide codant pour ce polypeptide |
Country Status (3)
Country | Link |
---|---|
CN (1) | CN1324814A (fr) |
AU (1) | AU7954501A (fr) |
WO (1) | WO2001090173A1 (fr) |
Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP0774512A2 (fr) * | 1995-09-14 | 1997-05-21 | Tadayuki Imanaka | Procédé de production de protéines utilisant de chaperon |
-
2000
- 2000-05-24 CN CN 00115833 patent/CN1324814A/zh active Pending
-
2001
- 2001-05-21 WO PCT/CN2001/000827 patent/WO2001090173A1/fr active Application Filing
- 2001-05-21 AU AU79545/01A patent/AU7954501A/en not_active Abandoned
Patent Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP0774512A2 (fr) * | 1995-09-14 | 1997-05-21 | Tadayuki Imanaka | Procédé de production de protéines utilisant de chaperon |
Non-Patent Citations (3)
Title |
---|
DATABASE GENBANK [online] 12 December 1999 (1999-12-12), BURGESS J., Database accession no. Z82206 * |
DATABASE GENBANK [online] 28 June 1997 (1997-06-28), SMIT A.F. ET AL., Database accession no. U49973 * |
MUCHOWSKI P.J. ET AL., PROC. NATL. ACAD. SCI. USA, vol. 95, no. 3, 3 February 1998 (1998-02-03), pages 1004 - 1009 * |
Also Published As
Publication number | Publication date |
---|---|
CN1324814A (zh) | 2001-12-05 |
AU7954501A (en) | 2001-12-03 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
WO2002014510A1 (fr) | Nouveau polypeptide, proteine cbp20 humaine 47.74, et polynucleotide codant ce polypeptide | |
WO2001046410A1 (fr) | Nouveau polypeptide, proteine 13 du sous-groupe moleculaire cpn60, et polynucleotide codant pour ce polypeptide | |
WO2001066730A1 (fr) | Nouveau polypeptide, proteine humaine rs3 12, et polynucleotide codant pour ce polypeptide | |
WO2001090173A1 (fr) | Nouveau polypeptide, chaperonine humaine cpn60 10, et polynucleotide codant pour ce polypeptide | |
WO2001092515A1 (fr) | Nouveau polypeptide, facteur humain de transcription 29.26, et polynucleotide codant ce polypeptide | |
WO2001090352A1 (fr) | Nouveau polypeptide, proteine 110.12 de liaison avec le centrosome nek-2, et polynucleotide codant ce polypeptide | |
WO2001075048A2 (fr) | Nouveau polypeptide, proteine ribosomale humaine s11 23, et polynucleotide codant pour ce polypeptide | |
WO2001090177A1 (fr) | Nouveau polypeptide, activateur humain de la mort naturelle des cellules b13.64, et polynucleotide codant ce polypeptide | |
WO2002006470A1 (fr) | Nouveau polypeptide, myoglobuline humaine ixa11.88, et polynucleotide codant ce polypeptide | |
WO2001090175A1 (fr) | Nouveau polypeptide, chaperonine humaine cpn60 15, et polynucleotide codant pour ce polypeptide | |
WO2001090133A1 (fr) | Nouveau polypeptide, uracil desoxyribonucleotide glycosylase humaine 22, et polynucleotide codant ce polypeptide | |
WO2001092518A1 (fr) | Nouveau polypeptide, proteine humaine 9.5 associee a la ccr4, et polynucleotide codant ce polypeptide | |
WO2001075101A1 (fr) | Nouveau polypeptide, proteine humaine de regulation de la transcription 8, et polynucleotide codant pour ce polypeptide | |
WO2002048355A1 (fr) | Nouveau polypeptide, proteine garp humaine 12.98, et polynucleotide codant ce polypeptide | |
WO2001079432A2 (fr) | Nouveau polypeptide, facteur humain de transcription de la differentiation cellulaire 58, et polynucleotide codant pour ce polypeptide | |
WO2001094401A1 (fr) | Nouveau polypeptide, proteine npat humaine 15, et polynucleotide codant pour ce polypeptide | |
WO2001092329A1 (fr) | Nouveau polypeptide, sous-unite $g(a) d'atp-synthetase 9.9, et polynucleotide codant ce polypeptide | |
WO2001090172A1 (fr) | Nouveau polypeptide, proteine ribosomale l39 13, et polynucleotide codant ce polypeptide | |
WO2001075053A2 (fr) | Nouveau polypeptide, chaperonine humaine 14, et polynucleotide codant pour ce polypeptide | |
WO2001075003A2 (fr) | Nouveau polypeptide, protéine humaine d'utérus associé à une molécule cpn 60 26, et polynucléotide codant pour ce polypeptide | |
WO2001087963A1 (fr) | Proteine s18-12 ribosomale, polypeptide humain, et polynucleotide la codant | |
WO2001073072A1 (fr) | Nouveau polypeptide, chaperonine humaine 18, et polynucleotide codant pour ce polypeptide | |
WO2001064735A1 (fr) | Nouveau polypeptide, chaperonine moleculaire humaine cpn 60 8, et polynucleotide codant pour ce polypeptide | |
WO2001092516A1 (fr) | Nouveau polypeptide, proteine ribosomale s19e 13, et polynucleotide codant ce polypeptide | |
WO2002000833A2 (fr) | Nouveau polypeptide, proteine 113.31 d'acide gamma carboxyglutamique riche en proline, et polynucleotide codant ce polypeptide |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A1 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
122 | Ep: pct application non-entry in european phase | ||
NENP | Non-entry into the national phase |
Ref country code: JP |