WO2002000833A2 - Nouveau polypeptide, proteine 113.31 d'acide gamma carboxyglutamique riche en proline, et polynucleotide codant ce polypeptide - Google Patents

Nouveau polypeptide, proteine 113.31 d'acide gamma carboxyglutamique riche en proline, et polynucleotide codant ce polypeptide Download PDF

Info

Publication number
WO2002000833A2
WO2002000833A2 PCT/CN2001/000956 CN0100956W WO0200833A2 WO 2002000833 A2 WO2002000833 A2 WO 2002000833A2 CN 0100956 W CN0100956 W CN 0100956W WO 0200833 A2 WO0200833 A2 WO 0200833A2
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
polynucleotide
proline
protein
rich
Prior art date
Application number
PCT/CN2001/000956
Other languages
English (en)
Chinese (zh)
Other versions
WO2002000833A3 (fr
Inventor
Yumin Mao
Yi Xie
Original Assignee
Biowindow Gene Development Inc. Shanghai
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Biowindow Gene Development Inc. Shanghai filed Critical Biowindow Gene Development Inc. Shanghai
Priority to AU89539/01A priority Critical patent/AU8953901A/en
Publication of WO2002000833A2 publication Critical patent/WO2002000833A2/fr
Publication of WO2002000833A3 publication Critical patent/WO2002000833A3/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • the present invention belongs to the field of biotechnology. Specifically, the present invention describes a new polypeptide, a proline-rich gamma carboxyglutamate protein 113. 31 , and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and polypeptide. Background technique
  • PRGP proline-rich gararaa carboxyglutamate
  • Both PRGP1 and PRGP2 are membrane-intrinsic proteins, each containing a single transmembrane region, and have a proline-rich cytoplasmic region, which contains a potential WW-binding domain PPXY (Chen, HI, and Sudol, M., 1995).
  • these proline-rich regions contain some copies of the sequence of PI and a SH3 binding domain, which proves the importance of the interaction of PRGP protein with SH3 and WW regions of many cytoskeleton members and signal molecules.
  • PRGP1's cDNA contains a 165bp 5 'untranslated region (UTR), a 657bp coding sequence and a rare 3.7kb 3' untranslated region. After the 20 amino acid pro-peptide breaks, the remaining mature protein contains 198 amino acid residues. The starting Met codon appears at position 166 of the nucleotide, which is very close to the coding sequence of the propeptide.
  • PRGP1 lacks a discernible signal peptide, the transmembrane region of the mature protein (residue 58- 83) Acts as a 'signal anchor', positioning the nascent peptide directly into the endoplasmic reticulum cavity.
  • the localization of the protein on the membrane depends on the relative charge of the amino acid residues in the transmembrane region. Sequences in the cytoplasm usually carry a lot of positive charges (Hartmann, E., Rapoport, T. A., and Lodish, H. F., 1989).
  • the carboxy terminus of PRGP1 has a relatively large positive charge and is therefore found in the cytoplasm.
  • there is a disulfide ring in the Gla region which forms the oxidative environment in the endoplasmic reticulum, rather than the reducing environment in the cytoplasm.
  • PRGP1 and PRGP2 are present in many tissue cells, but PRGP1 shows the highest expression in the spinal cord, while PRGP2 shows the highest expression in the thyroid.
  • PRGP protein may interact with some proteins containing WW region and SH3 region in the cytoplasm, and the Gla region can interact with anion-rich phospholipids on the surface, especially phosphatidylserine (Mann, KG, Nesheim, ME et al., 1990; Davie, EW, Fujikawa K., and Kisiel, W., 1991).
  • the proline-rich gamma carboxyglutamate protein 113.31 protein plays an important role in regulating important functions of the body such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes. More proline-rich gamma carboxyglutamate protein 113.31 proteins involved in these processes need to be identified, especially the amino acid sequence of this protein.
  • the isolation of the 113.31 protein encoding the new proline-rich gamma carboxyglutamate protein also provides a basis for the study to determine its role in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for disease 1 and it is therefore important to isolate its coding for DM. Disclosure of invention
  • Another object of the invention is to provide a polynucleotide encoding the polypeptide.
  • Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding a proline-rich gamma carboxyglutamic acid protein 113.31.
  • Another object of the present invention is to provide a protein containing a proline-enriched gamma carboxyglutamic acid.
  • a genetically engineered host cell of a 113.31 polynucleotide A genetically engineered host cell of a 113.31 polynucleotide.
  • Another object of the present invention is to provide a method for producing a proline-rich gamma carboxyglutamic acid protein 113.31.
  • Another object of the present invention is to provide an antibody against the proline-rich gamma carboxyglutamate protein 113.31 of the polypeptide of the present invention.
  • the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
  • the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
  • sequence of the polynucleotide is one selected from the group consisting of: (a) having SEQ ID NO: 1
  • the present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
  • the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
  • the present invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of proline-rich ga a carboxyglutamate protein 113.31 protein, which comprises using the polypeptide of the present invention.
  • the invention also relates to compounds obtained by this method.
  • the present invention also relates to a method for in vitro detection of a disease or susceptibility to disease associated with abnormal expression of a proline-rich gamma carboxyglutamate protein 1 1 3. 31 protein, which comprises detecting the polypeptide or its encoding in a biological sample. A mutation in a polynucleotide sequence, or the amount or biological activity of a polypeptide of the invention in a biological sample is detected.
  • the invention also relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
  • the present invention also relates to the polypeptides and / or polynucleotides of the present invention which are useful in preparing cancer cells, developmental diseases or immune diseases or other proline-rich gamma carboxyglutamate proteins. Use of drugs that cause disease.
  • Nucleic acid sequence means an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to Genomic or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
  • amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
  • amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
  • a “variant" of a protein or polynucleotide refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it.
  • the changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence.
  • Variants can have "conservative" changes, in which the amino acid substituted has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine.
  • Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
  • “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
  • Insertion refers to an alteration in the amino acid sequence or nucleotide sequence that results in an increase in one or more amino acids or nucleotides compared to a naturally occurring molecule.
  • Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
  • Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
  • immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response and to bind to specific antibodies in a suitable animal or cell.
  • An "agonist” refers to a molecule that, when combined with proline-rich ga allows a carboxyglutamate protein 1 1 3. 31, to cause the protein to change, thereby regulating the activity of the protein.
  • An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that can bind a proline-rich gamma carboxyglutamate protein 1 1 3. 31.
  • Antagonist refers to a carboxyl valley that blocks or regulates the proline-rich glutamate when combined with the proline-rich gamma carboxyglutamate protein 1 1 3. 31.
  • Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates, or any other molecule that can bind to a proline-rich gamma carboxyglutamate protein 1 1 3. 31.
  • Regular refers to changes in the function of proline-rich ga glutamate 1 carboxyglutamate protein 1 1 3. 31, including increased or decreased protein activity, changes in binding characteristics, and proline-rich gamma Alteration of any other biological, functional or immune properties of carboxyglutamate protein 1 1 3. 31.
  • substantially pure is meant substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated.
  • Those skilled in the art can use standard protein purification techniques to purify the proline-rich gamma carboxyglutamic acid protein 11 3. 31.
  • Essentially pure proline-rich gamma carboxyglutamate protein 11 3. 31 in non-reducing A single main band can be produced on a polyacrylamide gel.
  • the purity of proline-rich gamma carboxyglutamate protein 113. 31 can be analyzed by amino acid sequence. '
  • Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
  • sequence C-T-G-A
  • complementary sequence G-A-C-T.
  • the complementarity between two single-stranded molecules may be partial or complete.
  • the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
  • “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
  • Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Sou thern blot or Nor thern blot, etc.) under conditions of reduced stringency.
  • Substantially homologous sequences or hybridization probes can compete and inhibit the binding of a completely homologous sequence to a target sequence under conditions of reduced stringency. This does not mean that conditions with reduced stringency allow non-specific binding, because conditions with reduced stringency require that the two sequences interact with each other specifically or selectively.
  • Percent identity refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALIGN program (La sergene sof tware package, DNASTAR, Inc., Madi son Wis.). The MEGALIGN program can compare two or more sequences according to different methods such as the Cluster method (Higg ins, DG and PM Sharp (1988) Gene 73: 237-244). 0 The Clus ter method will check the distance between all pairs by Groups of sequences are arranged in clusters. The clusters are then assigned in pairs or groups.
  • sequence 1 and sequence B The percent identity between two amino acid sequences, such as sequence 1 and sequence B, is calculated by the following formula: Number of residues matching between sequence A and sequence X 100 Number of residues in sequence A-interval residues in sequence A. The number of spacer residues in sequence B can also be determined by Clus ter method or using methods known in the art such as Jotim Hein. The percent identity between nucleic acid sequences (He in J., (1990) Methods in erazumo l ogy 183: 625-645).
  • Similarity refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
  • Amino acids used for conservative substitutions for example, negatively charged amino acids. Acids can include aspartic acid and glutamic acid; positively charged amino acids can include lysine and arginine; have uncharged head groups Amino acids with similar hydrophilicity may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine acid.
  • Antisense refers to a nucleotide sequence that is complementary to a particular DM or RNA sequence.
  • Antisense strand refers to a nucleic acid strand that is complementary to the "sense strand”.
  • Derivative refers to a chemical modification of HFP or a nucleic acid encoding it. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
  • Antibody refers to a complete antibody molecule and its fragments, such as Fa, F (ab ') 2 and Fv, which can specifically bind the proline-rich ga cryptoa carboxyglutamate protein 1 1 3. 31 Epitope.
  • a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
  • isolated refers to the removal of matter from its original environment (for example, its natural environment if it is naturally occurring).
  • a naturally occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
  • Such a polynucleotide may be part of a vector, or such a polynucleotide or polypeptide may be part of a composition. Since the carrier or composition is not a component of its natural environment, they are still isolated.
  • isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
  • polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances existing in the natural state. .
  • isolated proline-rich gamma carboxyglutamate protein 1 1 3. 31 means that proline-rich gamma carboxyglutamate protein 1 1 3. 31 is substantially free of natural and Related to other proteins, lipids, sugars or other substances. Those skilled in the art can purify the proline-rich gamma carboxyglutamate protein 1 1 3. 31 using standard protein purification techniques. Substantially pure polypeptides produce a single main band on a non-reducing polyacrylamide gel. The purity of the proline-rich gamma carboxyglutamate protein 1 1 3. 31 peptide can be analyzed by amino acid sequence.
  • the present invention provides a new polypeptide, proline-rich ga-a carboxyglutamate protein 1 1 3. 31, which is basically composed of the amino acid sequence shown in SEQ ID NO: 2.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
  • the polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques.
  • polypeptide of the invention may be glycosylated, or it may be non-glycosylated.
  • the polypeptides of the invention may also or may not include a starting Methionine residue.
  • the present invention also includes fragments, derivatives, and analogs of proline-rich glutamate carboxyglutamate protein 11 3.31.
  • fragment As used in the present invention, the terms “fragment”, “derivative” and “analog” refer to substantially maintaining the same biological function or activity of the proline-rich garama carboxyglutamate protein 11 3. 31 of the present invention Of peptides.
  • a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution The amino acid may or may not be encoded by a genetic codon; or (II) a type in which a group on one or more amino acid residues is substituted by another group to include a substituent; or ( ⁇ ⁇ )
  • Such a polypeptide sequence in which the mature polypeptide is fused with another compound such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol
  • a polypeptide sequence in which an additional amino acid sequence is fused into the mature polypeptide (Such as a leader sequence or a secreted sequence or a sequence used to purify this polypeptide or a protease sequence)
  • such fragments, derivatives, and analogs are considered to be within the knowledge of those skilled in the art.
  • the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
  • the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a full-length polynucleotide sequence of 956 bases, and its open reading frames 334-699 encode 121 amino acids.
  • this polypeptide has a similar expression profile to the proline-rich garama carboxyglutamate protein 1, which can be inferred that the proline-rich gamma carboxyglutamate protein 1 1 3. 31 has a similar function to proline-rich gamma carboxyglutamate protein 1.
  • the polynucleotide of the present invention may be in the form of DM or RNA.
  • DM forms include cDNA, genomic DNA or synthetic DNA.
  • DNA can be single-stranded or double-stranded.
  • DNA can be coding or non-coding.
  • the coding region sequence encoding the mature dance peptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
  • a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
  • the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
  • polynucleotide encoding a polypeptide refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.
  • the present invention also relates to a variant of the polynucleotide described above, which encodes the same amino group as the present invention.
  • Variants of this polynucleotide may be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
  • an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
  • the invention also relates to a polynucleotide that hybridizes to the sequence described above (with at least 50%, preferably 70% identity between the two sequences).
  • the present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions.
  • "strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 6 (TC; or (2) added during hybridization) Use a denaturing agent, such as 50 ° /.
  • the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
  • nucleic acid fragments that hybridize to the sequences described above.
  • a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 cores Glycylic acid or more.
  • Nucleic acid fragments can also be used in nucleic acid amplification techniques, such as PCR, to identify and / or isolate polynucleotides encoding the proline-rich gamma carboxyglutamate protein I.M.
  • polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
  • the specific polynucleotide sequence encoding the proline-rich gamma carboxyglutamic acid protein 113.31 of the present invention can be obtained by various methods.
  • polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
  • the DM fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.
  • genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences.
  • the standard method for isolating the cDNA of interest is to isolate mRM from donor cells that highly express the gene and perform reverse transcription to form a plasmid or phage cDNA library.
  • the construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989).
  • Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
  • the genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DNA-RNA hybridization; (2) the presence or absence of marker gene functions; (3) determination of the proline-rich gamma carboxyglutamate protein 113.31 The level of transcripts; (4) Detecting protein products expressed by genes by immunological techniques or by measuring biological activity. The above methods can be used singly or in combination.
  • the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
  • the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
  • the probe used here is usually a DM sequence chemically synthesized based on the gene sequence information of the present invention.
  • the genes or fragments of the present invention can of course be used as probes.
  • DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
  • the protein product of the proline-rich gamma carboxyglutamate protein 111 31 can be detected by immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) and so on.
  • immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) and so on.
  • a method using PCR technology to amplify DNA / RNA is preferably used to obtain the gene of the present invention.
  • the RACE method RACE-Rapid Amplification of cDNA Ends
  • the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein Selected and synthesized by conventional methods.
  • the amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
  • polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, the sequencing must be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
  • the present invention also relates to a vector comprising a polynucleotide of the present invention, and a host cell that is genetically engineered using the vector of the present invention or directly with a proline-rich gamma carboxyglutamate protein 113.31 coding sequence, and recombinant technology A method for producing a polypeptide according to the invention.
  • a polynucleotide sequence encoding a proline-rich gafflma carboxyglutamate protein 113.31 can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
  • vector refers to bacterial plasmids, bacteriophages, yeast plasmids, plant cell viruses, mammalian cell diseases, as is well known in the art. Poisons such as adenovirus, retrovirus or other vectors.
  • Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors expressed in bacteria (Rosenberg, et al.
  • any plasmid and vector can be used to construct a recombinant expression vector.
  • An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
  • Methods known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding a proline-rich gamma carboxyl glutamic acid protein 113.31 and appropriate transcription / translation regulatory elements. These methods include in vitro recombinant DNA technology, DM synthesis technology, and in vivo recombination technology (Sambroook, et al. Molecular Cloning, a Laboratory Manual, cold Spring Harbor Laboratory. New York, 1989).
  • the DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis. Representative examples of these promoters are: the lac or trp promoter of E.
  • the expression vector also includes a ribosome binding site for translation initiation and a transcription terminator. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, tumorigenic enhancers on the late side of the origin of replication, and adenoviral enhancers.
  • the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • GFP fluorescent protein
  • tetracycline or ampicillin resistance for E. coli.
  • a polynucleotide encoding a proline-rich gamma carboxyglutamic acid protein 113.31 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a gene containing the polynucleotide or the recombinant vector.
  • Genetically engineered host cells refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E.
  • coli Streptomyces
  • bacterial cells such as Salmonella typhimurium
  • fungal cells such as yeast
  • plant cells insect cells
  • insect cells such as flies S2 or Sf9
  • animal cells such as CH0, COS or Bowes melanoma cells Cell etc.
  • Transformation of a host cell with a DM sequence according to the present invention or a recombinant vector containing the DM sequence can be performed using conventional techniques well known to those skilled in the art.
  • the host is a prokaryote such as E. coli
  • competent cells capable of DNA uptake can be in the exponential growth phase were harvested, treated with CaC l 2 method used in steps well known in the art. The alternative is to use MgC l 2 .
  • transformation can also be performed by electroporation.
  • the host is a eukaryote, the following DM transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
  • the polynucleotide sequence of the present invention can be used to express or produce recombinant proline-rich gamma carboxyglutamate protein 113. 31 (Scence, 1984; 224: 1431). Generally there are the following steps:
  • the medium used in the culture may be selected from various conventional mediums according to the host cells used. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
  • a suitable method such as temperature conversion or chemical induction
  • the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell.
  • recombinant proteins can be isolated and purified by various separation methods using their physical, chemical, and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
  • conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromat
  • FIG. 1 is a comparison diagram of gene chip expression profiles of proline-rich gamma carboxyglutamate protein 113.31 and proline-rich gamma carboxyglutamate protein 1 of the present invention.
  • the upper graph is a graph of the proline-rich gamma carboxyglutamate protein 113. 31, and the lower graph is the proline-rich gamma carboxyglutamate protein 1 Expression spectrum chart.
  • 1-bladder mucosa 2-PMA + Ecv304 cell line, 3- LPS + Ecv304 cell line thymus, 4-normal fibroblasts 1024NC, 5- Fibroblast, growth factor stimulation, 1024NT, 6-scar scar into fc growth factor stimulation 1013HT, 7-scar into fc without stimulation with growth factor, 1013HC, 8- bladder cancer cell EL 9-bladder cancer, 10-bladder cancer, 11-liver cancer, 12-liver cancer cell line, 13-fetal skin, -Spleen, 15-prostate cancer, 16-jejunal adenocarcinoma, 17 cardiac cancer.
  • Figure 2 is a polyacrylamide gel electrophoretogram (SDS-PAGE) of the isolated proline-rich ga-a-carboxyglutamate protein 113.31. 13kDa is the molecular weight of the protein. The arrow indicates the isolated protein band. The best way to implement the invention
  • Example 1 Cloning of proline-rich ga clock a carboxyglutamate protein 113.31
  • RNA Human fetal brain total RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform.
  • Poly (A) mRNA was isolated from total RM using Quik mRNA Isolation Kit (Qiegene). 2ug poly (A) mRNA is reverse transcribed to form cDNA.
  • the Smart cDNA cloning kit purchased from Clontech was used to insert the 00 fragment into the multiple cloning site of pBSK (+) vector (Clontech) to transform DH5 ⁇ , and the bacteria formed a cDNA library.
  • Dye terminate cycle reaction sequencing kit Perkin-Elraer
  • ABI 377 automatic sequencer Perkin-Elmer
  • the determined cDNA sequence was compared with the existing public DM sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 0825D11 was new DNA.
  • the inserted cDM fragments contained in this clone were determined in both directions by synthesizing a series of primers.
  • the 0825D11 clone contained a full-length cDNA of 956 bp (as shown in Seq ID NO: 1), and a 365 bp open reading frame (0RF) from 334 bp to 699 bp, encoding a new protein (such as Seq ID NO : Shown in 2).
  • This clone pBS-0825D11 and encoded the protein as the proline-rich gamma carboxyglutamate protein 113.31.
  • Example 2 Cloning of the gene encoding the proline-rich gamma carboxyglutamate protein 113.31 by RT-PCR method. Using fetal brain cell total RNA as a template and oligo-dT as a primer for reverse transcription reaction to synthesize cDNA.
  • PCR amplification was performed with the following primers:
  • Primer 1 5, one TAGCACAAGGAACTGTCCTTCACC —3, (SEQ ID NO: 3)
  • Primer2 5'- GAGAGGGTTCACAAAGGGTAGGGT -3 '(SEQ ID NO: 4)
  • Primerl is a forward sequence starting from the 1st bp of the 5' end of SEQ ID NO: 1;
  • Primer2 is the 3 'end reverse sequence in SEQ ID NO: 1.
  • Amplification conditions 50 ⁇ l reaction volume containing 50 mraol / L KC1, 10 mmol / L Tris-Cl, (pH8.5), 1.5 mraol / L MgCl 2) 200 ⁇ mol / L dNTP, lOpmol primer, 1U of Taq DNA polymerase (Clontech).
  • the reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) for 25 cycles under the following conditions: 94 ° C 30sec; 55 ° C 30sec; 72 ° C 2niin.
  • ⁇ -actin was set as a positive control and template blank was set as a negative control.
  • the amplified product was purified using a QIAGEN kit, and ligated to a pCR vector (Invitrogen product) using a TA cloning kit. DNA sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as the l-956bp shown in SEQ ID NO: 1.
  • Example 3 Northern blot analysis of the expression of the proline-rich ga cryptoa carboxyglutamate protein 113.31 gene:
  • RNA extraction in one step involves acid guanidinium thiocyanate phenol-chloroform extraction. That is, the tissue is homogenized with 4M guanidine isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1) are added. ), Mix and centrifuge. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water.
  • 32P-labeled probe (about 2 x 10 6 cpm / ml) was hybridized with RNA-transferred nitrocellulose membrane at 42 ° C overnight in a solution.
  • the solution contained 50% formamide-25 mM KHP0, (pH 7.4)-5 x SSC-5 x Denhardt, s solution and 200 g / ml salmon sperm DNA.
  • the filter was placed in 1 X SSC- 0.1% SDS at 55 Wash at 30 ° C for 30 min. Then, use Phosphor Imager for analysis and quantification.
  • Example 4 In vitro expression, isolation and purification of recombinant proline-rich gamma carboxyglutamate protein 113.31 According to SEQ ID NO: 1 and Figure 1 A pair of specific amplification primers was designed for the coding region sequence shown below, and the sequences are as follows:
  • Primer3 5'-CCCCATATGATGGCCAACGGAGAATATCCACA-3 '(Seq ID No: 5)
  • Primer4 5'-CATGGATCCTCATTCGTTCGTTCCACAAACTCC-3 '(Seq ID No: 6)
  • the 5' ends of these two primers contain Ndel and BamHI digestion sites, respectively, followed by the 5 'end and The 3 'end coding sequence, Ndel and BamHI restriction sites correspond to selective endonuclease sites on the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865. 3).
  • the pBS-0825D11 plasmid containing the full-length target gene was used as a template for the PCR reaction.
  • the PCR reaction conditions were as follows: a total volume of 50 ⁇ , containing 10 pg of PBS-0825D11 plasmid, Primer-3 and Primer-4, respectively, 1 Opmol, Advantage polymerase Mix (Clontech) 1 ⁇ 1. Cycle parameters: 94 ° C 20s, 60 "C 30s, 68" C 2 min, a total of 25 cycles. Ndel and BamHI were used to double-digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase. The ligated product was transformed into E. coli DH5 0C by the calcium chloride method.
  • NH2-Met-Ala-Asn-Gly-Glu-Lys-Ser-Thr-Phe-Leu-Ser-I le-Ala-Tyr-Thr-C00 H (SEQ ID NO: 7).
  • the peptide is coupled to hemocyanin and bovine serum albumin to form a complex, respectively.
  • For the method please refer to: Avraraeas, et al. I Hidden chemi s try, 1969; 6: 43. Rabbits were immunized with 4 mg of the hemocyanin polypeptide complex plus complete Freund's adjuvant, and 15 days later, the hemocyanin polypeptide complex plus incomplete Freund's adjuvant was used to boost immunity once.
  • a titer plate coated with 15 ⁇ g / ml bovine serum albumin polypeptide complex was used as an ELISA to determine the antibody titer in rabbit serum.
  • Total IgG was isolated from antibody-positive rabbit serum using protein A-Sepharose.
  • the immunoprecipitation method proved that the purified antibody could specifically bind to the proline-rich gamma carboxyglutamate protein 113.31.
  • Example 6 Application of the polynucleotide fragment of the present invention as a hybridization probe Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
  • the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected. Further, the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
  • the purpose of this example is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method.
  • Filter hybridization methods include dot blotting, Southern blotting, Northern blotting, and copying methods. They all use the same steps to hybridize the fixed polynucleotide sample to the filter.
  • the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer to saturate the non-specific binding site of the sample on the filter with the carrier and the synthesized polymer.
  • the pre-hybridization solution is then replaced with a hybridization buffer containing the labeled probe and incubated to hybridize the probe to the target nucleic acid.
  • the unhybridized probes are removed by a series of membrane washing steps. This embodiment uses higher intensity membrane washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals.
  • the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention;
  • the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
  • the spot imprint method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
  • oligonucleotide fragments from the polynucleotide SEQ ID NO: 1 of the present invention for use as hybridization probes should follow the following principles and several aspects to be considered:
  • the preferred range of probe size is 18-50 nucleotides
  • the GC content is 30% -70%, and the non-specific hybridization increases when it exceeds;
  • Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements For homology comparison of the regions, if the homology with the non-target molecule 3 ⁇ 4 domain is greater than 85% or there are more than 15 consecutive bases, the primary probe should generally not be used;
  • Probe l (p r obel), which belongs to the first type of probe, is identical to the gene fragment of SEQ ID NO: 1 Source or complementary (41Nt):
  • Probe 2 (probe2), which belongs to the second type of probe, is equivalent to the replacement mutant sequence (key) of the gene fragment of SEQ ID NO: 1 or its complementary fragment:
  • step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
  • NC membrane nitrocellulose membrane
  • Gene chip or DNA microarray is a new technology that many national laboratories and large pharmaceutical companies are currently developing and developing. It refers to the orderly and high-density arrangement of a large number of target gene fragments on glass, Silicon and other carriers, and then use fluorescence detection and computer software to compare and analyze data to To achieve the purpose of fast, efficient, high-throughput analysis of biological information.
  • the polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research of new gene functions; searching for and screening new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases .
  • the specific method steps have been reported in the literature, for example, see the literature DeRis i, JL, Lyer, V. & Brown, P. 0.
  • a total of 4,000 polynucleotide sequences of various full-length cDNAs are used as target DNA, including the polynucleotide of the present invention. They were respectively amplified by PCR. After purification, the concentration of the amplified product was adjusted to about 500 ng / ul, and spotted on a glass medium with a Cartesian 7500 spotter (purchased from Cartesian Company, USA). The distance between them is 280 ⁇ ⁇ . The spotted slides were hydrated, dried, and cross-linked in a UV cross-linker. After elution, the slides were fixed to prepare DNA on a glass slide to prepare a chip. The specific method steps have been variously reported in the literature. The post-spot processing steps of this embodiment are:
  • Total mRNA was extracted from human mixed tissues and specific tissues (or stimulated cell lines) in one step, and the mRNA was purified with Oligotex mRNA Midi Ki t (purchased from QiaGen).
  • Cy3dUTP (5- Amino- propargy 2'- deoxyur idine 5'- tr i pha te coupled to Cy3 f luorescent dye, purchased from Amersham Phamac ia Biotech) was used to label the mRNA of human mixed tissue, and the fluorescent reagent Cy5dUTP (5- Amino -propargy 1-2'- deoxyur idine 5 '-tr iphate coupled to Cy5 fluorescent dye, purchased from Amersham Phamacia Biotech Company, labeled the specific tissue (or stimulated cell line) mRNA of the body, and purified the probe to prepare a probe.
  • Cy3dUTP 5- Amino- propargy 2'- deoxyur idine 5'- tr i
  • the probes from the two types of tissues were hybridized with the chip in a UniHyb TM Hybridization Solution (purchased from TeleChera) for 16 hours, and then washed with a washing solution (lx SSC, 0, 2% SDS) at room temperature and then scanned with ScanArray.
  • a 3000 scanner purchased from General Scanning, USA was used for scanning. The scanned image was analyzed and processed with Imagene software (Biodiscovery, USA) to calculate the Cy3 / Cy5 ratio of each point.
  • the above specific tissues are bladder mucosa, PMA + Ecv304 cell line, LPS + Ecv304 cell line thymus, normal fibroblasts 1024NC, Fibroblast, growth factor stimulation, 1024NT, scar-like fc growth factor stimulation , 1013HT, scar into fc without stimulation with growth factors, 1013HC, bladder cancer cell EJ, bladder cancer, bladder cancer, liver cancer, liver cancer cell line, fetal skin, spleen, prostate cancer, jejunal adenocarcinoma, cardia cancer. Draw a graph based on these 17 Cy3 / Cy5 ratios. (figure 1 ) . It can be seen from the figure that the expression profile of the proline-rich gamma carboxyglutamate protein 113.31 and the proline-rich gamma carboxyglutamate protein 1 according to the present invention are very similar. . Industrial Applicability
  • polypeptides of the present invention as well as antagonists, agonists and inhibitors of the polypeptides, can be directly used in the treatment of diseases, for example, they can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection, and immune diseases.
  • Vitamin K is a fat-soluble vitamin with anti-hemorrhagic function.
  • PRGP can also be divided into two proteins, PRGP1 and PRGP2.
  • the proline-rich cytoplasmic region of PRGP can interact with SH3 regions and regions of many cytoskeleton members and signal molecules, and thus has a role in regulating cell signals.
  • the expression profile of the polypeptide of the present invention is consistent with the expression profile of ⁇ -carboxyglutamic acid protein 1 (PRGP1) rich in human proline, and both have similar biological functions.
  • the polypeptide of the present invention interacts with vitamin K in vivo to exert its function. It can interact with SH3 region and WW region of many cytoskeleton members and signal molecules, and thus has a cell signal regulation effect. Its abnormal expression is usually closely related to the occurrence of pathological processes such as related cytoskeleton construction, material metabolism disorders, protein dysfunction, and tumors of related tissues, and related diseases.
  • the abnormal expression of the proline-rich gamma carboxyglutamate protein 113.31 of the present invention will produce various diseases, especially various tumors, embryonic developmental disorders, growth and development disorders, Inflammation, immune diseases, these diseases include but are not limited to:
  • Tumors of various tissues stomach cancer, liver cancer, lung cancer, esophageal cancer, breast cancer, leukemia, lymphoma, thyroid tumor, uterine fibroids, neuroblastoma, astrocytoma, ependymoma, glioblastoma, nerve Fibroma, colon cancer, melanoma, bladder cancer, uterine cancer, endometrial cancer, colon cancer, thymic tumor, nasopharyngeal cancer, laryngeal cancer, tracheal tumor, fibroid, fibrosarcoma, lipoma, liposarcoma
  • Fetal developmental disorders congenital abortion, cleft palate, limb loss, limb differentiation disorder, atrial septal defect, neural tube defect, congenital hydrocephalus, congenital glaucoma or cataract, congenital deafness
  • Growth and development disorders mental retardation, brain development disorders, skin, fat, and muscular dysplasia, bone and joint dysplasia, various metabolic defects, stunting, dwarfism, Cushing's syndrome Sexual retardation
  • Inflammation chronic active hepatitis, sarcoidosis, polymyositis, chronic rhinitis, chronic gastritis, cerebrospinal multiple sclerosis, glomerulonephritis, myocarditis, cardiomyopathy, atherosclerosis, gastric ulcer, cervicitis, Various infectious inflammations
  • Immune diseases Systemic lupus erythematosus, rheumatoid arthritis, bronchial asthma, urticaria, specific dermatitis, post-infection myocarditis, scleroderma, myasthenia gravis, Guillain-Barre syndrome, common variable immunodeficiency disease , Primary B lymphocyte immunodeficiency disease, acquired immunodeficiency syndrome
  • the abnormal expression of the proline-rich gamma carboxyglutamate protein 1 1 3. 31 of the present invention will also produce certain hereditary, bloody Disease, etc.
  • polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat various diseases, especially various tumors, embryonic development disorders, growth and development disorders, inflammation, and immunity Sexual diseases, certain hereditary, blood diseases, etc.
  • the invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) proline-rich gamma carboxyglutamate protein 11 3. 31.
  • Agonists increase the proline-rich gamma carboxyglutamate protein 11 3. 31 stimulates biological functions such as cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
  • a mammalian cell or a membrane preparation that expresses a proline-rich ga to a carboxyglutamic acid protein 11 3. 31 and a labeled proline rich carboxyglutamic acid Protein 1 1 3. 31 were cultured together. The ability of the drug to increase or block this interaction is then determined.
  • Proline-rich antagonists of gamma carboxyglutamate protein 1 1 3. 31 include screened antibodies, Compounds, receptor deletions, and the like.
  • Proline-rich gamma carboxyglutamate protein 113.31 antagonist can bind to proline-rich gamma carboxyglutamate protein 113.31 and eliminate its function, or inhibit the production of the polypeptide, or with the polypeptide The active site binding prevents the polypeptide from performing biological functions.
  • proline-rich gamma carboxyglutamate proteins can be used
  • 113.31 was added to the bioanalytical assay to determine whether a compound is an antagonist by measuring its effect on the interaction between the proline-rich gamma carboxyglutamate protein 113.31 and its receptor. Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds.
  • the peptide molecules capable of binding to the proline-rich gamma carboxyglutamic acid protein 113.31 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. During screening, 113.31 molecules of the proline-rich gamma carboxyglutamate protein should generally be labeled.
  • the present invention provides a method for producing an antibody using a polypeptide, a fragment, a derivative, an analog thereof, or a cell thereof as an antigen.
  • These antibodies can be polyclonal or monoclonal antibodies.
  • the present invention also provides antibodies against the proline-rich 113.31 epitope of the gamma carboxyglutamic acid protein. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by Fab expression libraries.
  • Polyclonal antibodies can be produced by immunizing animals (such as rabbits, mice, rats, etc.) directly with the proline-rich garania carboxyglutamate protein 113.31.
  • a variety of adjuvants can be used to enhance the immune response, including But it is not limited to Freund's adjuvant.
  • Techniques for preparing monoclonal antibodies to proline-rich gamma carboxyglutamate protein 11131 include, but are not limited to, hybridoma technology (Kohler and Milstein. Nature, 1975, 256: 495-497), triple tumor technology, human beta- Cell hybridoma technology, EBV-hybridoma technology, etc.
  • Chimeric antibodies that bind human constant regions and non-human-derived variable regions can be produced using known techniques (Morrison et al, PNAS, 1985, 81: 6851).
  • the existing technology for producing single-chain antibodies (U.S. Pat No. 4946778) can also be used to produce single-chain antibodies against proline-rich ga-a carboxyglutamate protein 113.31.
  • the anti-proline-rich gamma carboxyglutamate protein 113.31 antibody can be used in immunohistochemistry to detect the proline-rich gamma carboxyglutamate protein 113. M in biopsy specimens.
  • Monoclonal antibodies that bind to proline-rich ga cryptoa carboxyglutamate protein 113.31 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
  • Antibodies can also be used to design immunotoxins that target a particular part of the body.
  • the proline-rich gamma carboxyglutamate protein 113.31 has high affinity for monoclonal antibodies that can interact with bacterial or plant toxins (such as Laryngeal toxin, ricin, ormosine, etc.) are covalently bound.
  • a common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
  • This hybrid antibody can be used to kill proline-rich ga a Carboxyglutamate protein 113. 31 positive cells.
  • the antibodies of the present invention can be used to treat or prevent diseases related to the proline-rich gamma carboxyglutamate protein 113.31.
  • the proper dose of the antibody can stimulate or block the production or activity of the proline-rich gamma carboxyglutamate protein 113.31.
  • the invention also relates to a diagnostic test method for quantitatively and locally detecting the level of proline-rich gamma carboxyglutamate protein 11 3. 31.
  • tests are well known in the art and include FISH assays and radioimmunoassays.
  • the assay detected gamma-carboxyglutamic acid proline-rich protein I. 3 1 levels can be used to explain a hidden proline-rich Gla protein ga 11 in various diseases 3.31 The importance and usefulness of proline-rich gamma carboxyglutamate protein 11 3. 31 at work.
  • polypeptide of the present invention can also be used for peptide mapping analysis.
  • the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry.
  • the polynucleotide encoding the proline-rich ga banda carboxyglutamate protein 11 3. 31 can also be used for a variety of therapeutic purposes.
  • Gene therapy technology can be used to treat abnormal cell proliferation, development or metabolism caused by the non-expression or abnormal / inactive expression of proline-rich gamma carboxyglutamate protein 11 3.31.
  • Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutant proline-rich gamma carboxyglutamate protein 113. 31 to inhibit endogenous proline-rich garama carboxyglutamate Protein 11 3. 31 activity.
  • the recombinant gene therapy vector can be used to treat diseases caused by abnormal expression or activity of the proline-rich gamma carboxyglutamate protein 11 3.31.
  • Expression vectors derived from viruses such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to transfer a polynucleotide encoding a proline-rich gamma carboxyglutamate protein 113.31 Into the cell.
  • a method for constructing a recombinant viral vector carrying a polynucleotide encoding a proline-rich ga cryptoa carboxyglutamic acid protein 11 3. 31 can be found in the existing literature (Sambrook, eta l.).
  • a recombinant polynucleotide encoding a proline-rich ga banda carboxyglutamate protein 11 3. 31 can be packaged into liposomes and transferred into cells.
  • Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
  • a vector such as a virus, phage, or plasmid
  • Oligonucleotides that inhibit proline-rich gamma carboxyglutamate protein 11 3. 31 mRNA (including anti- Sense RNA and DNA) and ribozymes are also within the scope of the invention.
  • a ribozyme is an enzyme-like RNA molecule that can specifically decompose a specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation.
  • Antisense RNA, DNA, and ribozymes can be obtained by any existing RNA or DNA synthesis technology, such as the technology for the synthesis of oligonucleotides by solid-phase phosphoramidite chemical synthesis has been widely used.
  • Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA. This DM sequence has been integrated downstream of the RNA polymerase promoter of the vector. In order to increase the stability of a nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the ribonucleoside linkages should use phosphate thioester or peptide bonds instead of phosphodiester bonds.
  • the polynucleotide encoding the proline-rich gamma carboxyglutamate protein 113.31 can be used for the diagnosis of diseases related to the proline-rich gamma carboxyglutamate protein 113.31.
  • a polynucleotide encoding 113.31 of proline-rich gamma carboxyglutamate protein 113.31 can be used to detect the expression of proline-rich gamma carboxyglutamate protein 113.31 or proline-rich gamma in disease states Abnormal expression of carboxyglutamate protein 113.31.
  • the DM sequence encoding the proline-rich gamma carboxyglutamate protein 113.31 can be used to hybridize biopsy specimens to determine the expression of the proline-rich gamma carboxyglutamate protein 113.31.
  • Hybridization techniques include Southern blotting, Northern blotting, in situ hybridization, and the like. These techniques and methods are publicly available and mature, and related kits are commercially available.
  • a part or all of the polynucleotide of the present invention can be used as a probe to be fixed on a microarray or a DNA chip (also referred to as a "gene chip") for analyzing differential expression analysis and gene diagnosis of genes in a tissue.
  • Proline-rich gamraa carboxyglutamate protein 113.31 specific primers for RNA-polymerase chain reaction (RT-PCR) amplification in vitro can also detect proline-rich garama carboxyglutamate protein II 3 ⁇ 31 transcript.
  • Detection of mutations in the 113.31 gene of the proline-rich gamma carboxyglutamate protein 113.31 can also be used to diagnose diseases related to the proline-rich gamma carboxyglutamate protein 113.31.
  • Proline-rich gamma carboxyglutamate protein 113.31 mutant forms include point mutations, translocations, deletions, recombinations, and others compared to the normal wild-type proline-rich gamma carboxyglutamate protein 113.31 DNA sequence Any exceptions etc. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression, so Northern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
  • the sequences of the invention are also valuable for chromosome identification.
  • the sequence specifically targets a specific position on a human chromosome and can hybridize to it.
  • specific sites for each gene on the chromosome need to be identified.
  • only a few chromosome markers based on actual sequence data are available for labeling chromosome positions.
  • it The important first step is to locate these DM sequences on the chromosome.
  • PCR primers (preferably 15-35bp) are prepared according to cDM, and the sequences can be located on chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
  • PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
  • oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
  • Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.
  • Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step.
  • FISH Fluorescent in situ hybridization
  • the physical location of the sequence on the chromosome can be correlated with the genetic map data. These data can be found in, for example, V. Mckusick, Mendelian Inherance in Man (available online with Johns Hopkins University Wetch Med I cali Library). Linkage analysis can then be used to determine the relationship between genes and diseases that have been mapped to chromosomal regions.
  • the difference in cDNA or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).
  • the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
  • suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
  • the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients that do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
  • the present invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the present invention.
  • containers containing one or more ingredients of the pharmaceutical composition of the present invention.
  • the polypeptides of the present invention can be combined with other therapeutic agents. Conjugates are used in combination.
  • the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
  • Proline-rich gamma carboxyglutamate protein I. is administered in an amount effective to treat and / or prevent a specific indication.
  • the amount and range of proline-rich gamma carboxyglutamate protein 1 1 3. 31 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Toxicology (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

L'invention concerne un nouveau polypeptide, une protéine 113.31 d'acide gamma carboxyglutamique riche en proline, et un polynucléotide codant ce polypeptide ainsi qu'un procédé d'obtention de ce polypeptide par des techniques recombinantes d'ADN. L'invention concerne en outre les applications de ce polypeptide dans le traitement de maladies, notamment des tumeurs malignes, de l'hémopathie, des troubles du développement, de l'infection par VIH, de maladies immunitaires et de diverses inflammations. L'invention concerne aussi l'antagoniste agissant contre le polypeptide et son action thérapeutique ainsi que les applications de ce polynucléotide codant la protéine 113.31 d'acide gamma carboxyglutamique riche en proline.
PCT/CN2001/000956 2000-06-14 2001-06-11 Nouveau polypeptide, proteine 113.31 d'acide gamma carboxyglutamique riche en proline, et polynucleotide codant ce polypeptide WO2002000833A2 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU89539/01A AU8953901A (en) 2000-06-14 2001-06-11 A novel polypeptide, a proline rich gamma-carboxyglutamic acid protein 113.31 and the polynucleotide encoding the polypeptide

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN 00116507 CN1328011A (zh) 2000-06-14 2000-06-14 一种新的多肽——脯氨酸富含的gamma羧基谷氨酸蛋白113.31和编码这种多肽的多核苷酸
CN00116507.0 2000-06-14

Publications (2)

Publication Number Publication Date
WO2002000833A2 true WO2002000833A2 (fr) 2002-01-03
WO2002000833A3 WO2002000833A3 (fr) 2002-04-25

Family

ID=4585911

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2001/000956 WO2002000833A2 (fr) 2000-06-14 2001-06-11 Nouveau polypeptide, proteine 113.31 d'acide gamma carboxyglutamique riche en proline, et polynucleotide codant ce polypeptide

Country Status (3)

Country Link
CN (1) CN1328011A (fr)
AU (1) AU8953901A (fr)
WO (1) WO2002000833A2 (fr)

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JPH0692870A (ja) * 1992-09-16 1994-04-05 Meiji Seika Kaisha Ltd 薬物担体用高分子および徐放性制ガン剤

Also Published As

Publication number Publication date
CN1328011A (zh) 2001-12-26
AU8953901A (en) 2002-01-08
WO2002000833A3 (fr) 2002-04-25

Similar Documents

Publication Publication Date Title
WO2002000833A2 (fr) Nouveau polypeptide, proteine 113.31 d'acide gamma carboxyglutamique riche en proline, et polynucleotide codant ce polypeptide
WO2001088084A2 (fr) Nouveau polypeptide, superoxyde dismutase 11, et polynucleotide codant pour ce polypeptide
WO2002014510A1 (fr) Nouveau polypeptide, proteine cbp20 humaine 47.74, et polynucleotide codant ce polypeptide
WO2001092515A1 (fr) Nouveau polypeptide, facteur humain de transcription 29.26, et polynucleotide codant ce polypeptide
WO2002012297A1 (fr) Nouveau polypeptide, proteine humaine 9 de liaison a la tropomoduline, et polynucleotide codant ce polypeptide
WO2001090352A1 (fr) Nouveau polypeptide, proteine 110.12 de liaison avec le centrosome nek-2, et polynucleotide codant ce polypeptide
WO2001090177A1 (fr) Nouveau polypeptide, activateur humain de la mort naturelle des cellules b13.64, et polynucleotide codant ce polypeptide
WO2002006471A1 (fr) Nouveau polypeptide, nucleophosmine 9.68, et polynucleotide codant ce polypeptide
WO2001094401A1 (fr) Nouveau polypeptide, proteine npat humaine 15, et polynucleotide codant pour ce polypeptide
WO2001092329A1 (fr) Nouveau polypeptide, sous-unite $g(a) d'atp-synthetase 9.9, et polynucleotide codant ce polypeptide
WO2001090133A1 (fr) Nouveau polypeptide, uracil desoxyribonucleotide glycosylase humaine 22, et polynucleotide codant ce polypeptide
WO2001092517A1 (fr) Nouveau polypeptide, proteine humaine 29.15 du gene transducteur-2-beta, et polynucleotide codant ce polypeptide
WO2002004501A1 (fr) Nouveau polypeptide, $g(b)-glucosaccharase humaine 11.88, et polynucleotide codant ce polypeptide
WO2001075101A1 (fr) Nouveau polypeptide, proteine humaine de regulation de la transcription 8, et polynucleotide codant pour ce polypeptide
WO2001092518A1 (fr) Nouveau polypeptide, proteine humaine 9.5 associee a la ccr4, et polynucleotide codant ce polypeptide
WO2002000824A2 (fr) Nouveau polypeptide, proteine humaine 10.56 du gene cancerigene tre, et polynucleotide codant ce polypeptide
WO2002040523A1 (fr) Nouveau polypeptide, glutaryl-coa deshydrogenase humaine 15.51, et polynucleotide codant ce polypeptide
WO2001094407A1 (fr) Nouveau polypeptide, enzyme de conjugaison de l'ubiquitine humaine 10.01, et polynucleotide codant ce polypeptide
WO2001090131A1 (fr) Nouveau polypeptide, proteine humaine 10.56 du gene cancerigene tre, et polynucleotide codant ce polypeptide
WO2001090381A1 (fr) Nouveau polypeptide, recepteur humain $g(a)-interferon 115.62, et polynucleotide codant ce polypeptide
WO2001094534A2 (fr) Nouveau polypeptide, facteur humain de transcription 9.57, et polynucleotide codant ce polypeptide
WO2001094533A2 (fr) Nouveau polypeptide, proteine humaine 13 de regulation de la proteine phosphorylase, et polynucleotide codant ce polypeptide
WO2001090173A1 (fr) Nouveau polypeptide, chaperonine humaine cpn60 10, et polynucleotide codant pour ce polypeptide
WO2001092516A1 (fr) Nouveau polypeptide, proteine ribosomale s19e 13, et polynucleotide codant ce polypeptide
WO2001090178A1 (fr) Nouveau polypeptide, dihydroorotase humaine 11, et polynucleotide codant ce polypeptide

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase in:

Ref country code: JP