WO2002040523A1 - Nouveau polypeptide, glutaryl-coa deshydrogenase humaine 15.51, et polynucleotide codant ce polypeptide - Google Patents

Nouveau polypeptide, glutaryl-coa deshydrogenase humaine 15.51, et polynucleotide codant ce polypeptide Download PDF

Info

Publication number
WO2002040523A1
WO2002040523A1 PCT/CN2001/001098 CN0101098W WO0240523A1 WO 2002040523 A1 WO2002040523 A1 WO 2002040523A1 CN 0101098 W CN0101098 W CN 0101098W WO 0240523 A1 WO0240523 A1 WO 0240523A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
polynucleotide
human
glutaryl
dehydrogenase
Prior art date
Application number
PCT/CN2001/001098
Other languages
English (en)
Chinese (zh)
Inventor
Yumin Mao
Yi Xie
Original Assignee
Shanghai Biowindow Gene Development Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shanghai Biowindow Gene Development Inc. filed Critical Shanghai Biowindow Gene Development Inc.
Priority to AU2002210332A priority Critical patent/AU2002210332A1/en
Publication of WO2002040523A1 publication Critical patent/WO2002040523A1/fr

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004Oxidoreductases (1.)
    • C12N9/001Oxidoreductases (1.) acting on the CH-CH group of donors (1.3)
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides

Definitions

  • the present invention belongs to the field of biotechnology. Specifically, the present invention describes a new polypeptide ⁇ glutaryl-CoA dehydrogenase 15.51, and a polynucleotide sequence encoding the polypeptide. The invention also relates to methods and applications for preparing such polynucleotides and polypeptides.
  • Glutaryl-CoA dehydrogenase catalyzes the oxidative decarboxylation of glutaryl-CoA to butyryl-CoA and carbon dioxide, and uses the electron transfer body flavin protein as an electron acceptor. Similar to most acyl-CoA dehydrogenases, GCD in mitochondria and bacteria is also a homotetramer, and each subunit contains one equivalent of FAD. In mammals, glutaryl-CoA is an intermediate in the oxidation of lysine, tryptophan, and hydroxylysine.
  • GCD deficiency causes type I glutaric acidemia.
  • This is a degenerative genetic disease that is characterized by the loss of glial basal ganglia neurons and progressive dyskinesias that usually occur before the age of 5 years, such as progressive lordosis, dyskinesia, and tremor of hands and feet . Patients with this disease have secreted glutaric acid, 3-carboxyglutaric acid, and glutaric acid [Hmn Mol Genet 1995 Sep; 4 (9): 1493-8].
  • the human glutaryl coenzyme A dehydrogenase 15.51 protein plays an important role in regulating important functions of the body such as cell division and embryo development, and it is believed that a large number of proteins are involved in these regulatory processes, so there has been a need in the art Identification of more human glutaryl-CoA dehydrogenase 15.51 proteins involved in these processes, and in particular the amino acid sequence of this protein.
  • New human glutaryl coenzyme A dehydrogenase 15.51 protein isolation gene also provides a basis for the study to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so isolating its coding DNA is very important.
  • An object of the present invention is to provide an isolated novel polypeptide, human glutaryl-CoA dehydrogenase 15.51, and fragments, analogs and derivatives thereof.
  • Another object of the invention is to provide a polynucleotide encoding the polypeptide.
  • Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding human glutaryl coenzyme A dehydrogenase 15.51.
  • Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding human glutaryl coenzyme A dehydrogenase 15.51.
  • Another object of the present invention is to provide a method for producing human glutaryl-CoA dehydrogenase 15.51.
  • Another object of the present invention is to provide a polypeptide-human glutaryl-CoA dehydrogenase
  • Another object of the present invention is to provide mimic compounds, antagonists, agonists, and inhibitors against the human glutaryl-CoA dehydrogenase 15.51 of the polypeptide of the present invention.
  • Another object of the present invention is to provide a method for diagnosing and treating diseases related to abnormalities of human glutaryl coenzyme A dehydrogenase 15.51. Summary of invention
  • the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
  • the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
  • sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 145 to 570 in SEQ ID NO: 1; and (b) a sequence having 1-2052 in SEQ ID NO: 1 Sequence of bits.
  • the present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
  • the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
  • the present invention also relates to a screen for mimicking, activating, antagonizing or inhibiting human glutaryl coenzyme A dehydrogenase.
  • a method of a 51-protein active compound comprising utilizing a polypeptide of the invention.
  • the invention also relates to compounds obtained by this method.
  • the present invention also relates to a method for in vitro detection of a disease or disease susceptibility related to abnormal expression of human glutaryl coenzyme A dehydrogenase 15.51 protein, comprising detecting the polypeptide or a polynucleotide sequence encoding the same in a biological sample. Mutations, or the amount or biological activity of a polypeptide of the invention in a biological sample.
  • the invention also relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
  • the invention also relates to the polypeptide and / or polynucleotide of the invention in the preparation of a medicament for the treatment of cancer, developmental disease or immune disease or other diseases caused by abnormal expression of human glutaryl coenzyme A dehydrogenase 15.51 the use of.
  • FIG. 1 is a comparison diagram of gene chip expression profiles of human glutaryl-CoA dehydrogenase 15.51 and human glutaryl-CoA dehydrogenase 15.51.
  • the upper graph is a graph of the expression profile of human glutaryl coenzyme A dehydrogenase 15. 51, and the lower graph is the graph of the expression profile of human glutaryl coenzyme A dehydrogenase 15.51.
  • Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of human glutaryl-CoA dehydrogenase 15.51. 16kDa is the molecular weight of the protein. The arrow indicates the isolated protein band.
  • Nucleic acid sequence refers to oligonucleotides, nucleotides or polynucleotides and fragments or parts thereof, and may also refer to the genome or synthetic DM or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
  • amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
  • amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule
  • polypeptide or “protein” is not meant to limit the amino acid sequence to the complete natural amino acid associated with the protein molecule.
  • a “variant" of a protein or polynucleotide refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it.
  • the changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence.
  • Variants can have "conservative" changes, in which the amino acid substituted has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine.
  • Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
  • “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
  • Insertion means that a change in the amino acid sequence or nucleotide sequence results in an increase in one or more amino acids or nucleotides compared to a molecule that exists in nature.
  • Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
  • Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
  • immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response and to bind specific antibodies in a suitable animal or cell.
  • An "agonist” refers to a molecule that, when combined with human glutaryl coenzyme A dehydrogenase 15.51, causes a change in the protein to regulate the activity of the protein.
  • An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that binds human glutaryl coenzyme A dehydrogenase 15.51.
  • Antagonist refers to a biology that can block or regulate human glutaryl-CoA dehydrogenase 15.51 when combined with human glutaryl-CoA dehydrogenase 15.51.
  • Active or immunologically active molecule may include proteins, nucleic acids, carbohydrates or any other molecule that can bind to human glutaryl coenzyme A dehydrogenase 15.51.
  • Regular refers to changes in the function of human glutaryl coenzyme A dehydrogenase 15.51, including increased or decreased protein activity, changes in binding characteristics, and human glutaryl coenzyme A dehydrogenase 15.51. Any other biological, functional or immune change.
  • Substantially pure means substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated.
  • Those skilled in the art can purify human glutaryl-CoA dehydrogenase 15.51 using standard protein purification techniques.
  • Substantially pure human glutaryl coenzyme A dehydrogenase 15. 51 produces a single main band on a non-reducing polyacrylamide gel.
  • Human glutaryl coenzyme A dehydrogenase 15. The purity of the 51 peptide can be analyzed by amino acid sequence.
  • Complementary or “complementarity” refers to the natural binding of polynucleotides that are base-paired under conditions of acceptable salt concentration and temperature.
  • sequence “CTG-A” can be complementary to the complementary sequence “G-A-CT “Binding.
  • the complementarity between two single-stranded molecules can be partial or complete.
  • the degree of complementarity between nucleic acid strands is The efficiency and strength of hybridization between nucleic acid strands has a significant effect.
  • “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
  • Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Southern imprinting or Northern blotting, etc.) under conditions of reduced stringency. Substantially homologous sequences or hybridization probes can compete and inhibit the binding of fully homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.
  • Percent identity refers to the percentage of sequences that are the same or similar in a comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as through the MEGALIGN program (Lasergene sof tware package, DNASTAR, Inc., Madi son Wis.). The MEGALIGN program can compare two or more sequences according to different methods such as the Clus ter method (Hi ggins, D. G. and P. M. Sharp (1988) Gene 73: 237-244). The Clus ter method arranges groups of sequences into clusters by checking the distance between all pairs. The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula:
  • the assay may be Jotun Hein percent identity between nucleic acid sequences Clus ter or a method well known in the art (Hein J., (1990) Methods in enzymology 183: 625-645) 0
  • Similarity refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
  • Amino acids used for conservative substitution for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
  • Antisense refers to a nucleotide sequence that is complementary to a particular DM or RNA sequence.
  • Antisense strand refers to a nucleic acid strand that is complementary to a “sense strand.”
  • Derivative refers to HFP or a chemical modification of its nucleic acid. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
  • Antibody refers to a complete antibody molecule and its fragments, such as Fa,? ( ⁇ ') 2 and?, which can specifically bind to the epitope of human glutaryl-CoA dehydrogenase 15.51.
  • Humanized antibody means that the amino acid sequence of a non-antigen-binding region is replaced with a human antibody Antibodies that are similar but still retain the original binding activity.
  • isolated refers to the removal of a substance from its original environment (for example, its natural environment if it is naturally occurring).
  • a naturally-occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
  • Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not part of its natural environment, they are still isolated.
  • isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
  • polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances in the natural state .
  • isolated human glutaryl coenzyme A dehydrogenase 15.51 means human glutaryl coenzyme A dehydrogenase 15.51 is substantially free of other proteins, lipids, and sugars naturally associated with it. Or other substances. Those skilled in the art can purify human glutaryl-CoA dehydrogenase 15.51 using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. Human glutaryl coenzyme A dehydrogenase 15. The purity of the 51 peptide can be analyzed by amino acid sequence.
  • the present invention provides a new polypeptide, human glutaryl-CoA dehydrogenase 15.51, which basically consists of the amino acid sequence shown in SEQ ID NO: 2.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
  • the polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques. Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude initial methionine residues.
  • the invention also includes fragments, derivatives and analogs of human glutaryl coenzyme A dehydrogenase 15.51.
  • fragment refers to a polypeptide that substantially retains the same biological function or activity of the human glutaryl-CoA dehydrogenase 15.51 of the present invention.
  • a fragment, derivative or analog of the polypeptide of the present invention may be: U) a type in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substituted
  • the amino acid may or may not be encoded by the genetic code; or (II) such a type in which a group on one or more amino acid residues is substituted by another group to include a substituent; or ( ⁇ ⁇ ) such One, in which the mature polypeptide is fused to another compound (such as a compound that extends the half-life of the polypeptide, such as polyethylene glycol); or (IV) one in which the additional amino acid sequence is fused to mature A polypeptide sequence (such as a leader sequence or a secreted sequence or a sequence used to purify the polypeptide or a protein sequence) formed by the polypeptide.
  • such fragments, derivatives and analogs are considered to be within the knowledge of those skilled in the art.
  • the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
  • the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a polynucleotide sequence of 2052 bases in length and its open reading frame 145-570 encodes 141 amino acids.
  • this peptide has a similar expression profile to human glutaryl coenzyme A dehydrogenase, and it can be inferred that the human glutaryl coenzyme A dehydrogenase 15.51 has human glutaryl coenzyme A Catalase functions similarly.
  • the polynucleotide of the present invention may be in the form of DNA or RNA.
  • DNA forms include cDNA, genomic DNA, or synthetic DM.
  • DNA can be single-stranded or double-stranded.
  • the MA can be a coded or non-coded chain.
  • the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
  • a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
  • the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
  • polynucleotide encoding a polypeptide refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.
  • the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
  • Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
  • an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
  • the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity between the two sequences).
  • the invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the invention under stringent conditions.
  • “strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 6 (TC; or (2) Add denaturants during hybridization, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% Ficol 1, 42 ° C, etc .; or (3) Hybridization occurs only when the identity between the two sequences is at least 95% or more, and more preferably 97% or more.
  • the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
  • nucleic acid fragments that hybridize to the sequences described above.
  • a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 nuclei. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques (such as PCR) to identify and / or isolate polynucleotides encoding human glutaryl-CoA dehydrogenase 15.51.
  • polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
  • the specific polynucleotide sequence encoding human glutaryl coenzyme A dehydrogenase 15.51 of the present invention can be obtained by various methods.
  • polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or CDM libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
  • the DM fragment sequence of the present invention can also be obtained by the following methods: 1) separating the double-stranded DNA sequence from the DM of the genome; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.
  • genomic DNA isolation is the least commonly used. Direct chemical synthesis of DM sequences is often the method of choice. The more commonly used method is the separation of cDM sequences.
  • the standard method for isolating the cDM of interest is to isolate mRM from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library.
  • Various methods have been used to extract mRNA, and kits are also commercially available (Qiagene).
  • the construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manua 1, Cold Spruing Harbor Laboratory. New York, 1989).
  • Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
  • genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DNA-RNA hybridization; (2) the presence or absence of marker gene functions; (3) determination of human glutaryl-CoA dehydrogenase 15.51 transcription (4) Detecting protein products expressed by genes through immunological techniques or measuring biological activity. The above methods can be used alone or in combination.
  • the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
  • the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
  • the probes used here are typically the genes of the invention Sequence information is based on chemically synthesized DNA sequences. The genes or fragments of the present invention can of course be used as probes. DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
  • the protein product expressed by human glutaryl-CoA dehydrogenase 15.51 gene can be detected by immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA). Wait.
  • immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA). Wait.
  • a method (Saiki, et al. Science 1985; 230: 1350-1354) using PCR technology to amplify DNA / RNA is preferably used to obtain the gene of the present invention.
  • the RACE method RACE-cDM terminal rapid amplification method
  • the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Select and synthesize using conventional methods.
  • the amplified DM / RNA fragment can be isolated and purified by conventional methods such as by gel electrophoresis.
  • polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be measured by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, sequencing needs to be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
  • the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using human glutaryl-CoA dehydrogenase 15.51 coding sequence, and the present invention is produced by recombinant technology A method of inventing the polypeptide.
  • a polynucleotide sequence encoding human glutaryl coenzyme A dehydrogenase 15.51 can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
  • vector refers to bacterial plasmids, bacteriophages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors known in the art.
  • Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al.
  • any plasmid and vector can be used to construct a recombinant expression vector.
  • An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
  • DM sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis.
  • promoters are: the lac or trp promoter of E.
  • the expression vector also includes a ribosome binding site and a transcription terminator for translation initiation. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers on the late side of the origin of replication, and adenoviral enhancers.
  • the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture. . Fluorescent protein (GFP), or tetracycline or ampicillin resistance for E. coli, etc.
  • a polynucleotide encoding human glutaryl coenzyme A dehydrogenase 15.51 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to form a gene containing the polynucleotide or the recombinant vector Engineered host cells.
  • the term "host cell” refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell.
  • Escherichia coli, Streptomyces bacterial cells such as Salmonella typhimurium
  • fungal cells such as yeast
  • plant cells insect cells
  • fly S2 or Sf 9 animal cells
  • animal cells such as CH0, COS or Bowes melanoma cells.
  • Transformation of a host cell with a DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art.
  • the host is a prokaryote such as E. coli
  • competent cells capable of absorbing DM may be harvested after exponential growth phase, 0 & 012 processing method, the step used are well known in the art.
  • the alternative is to use MgC l 2 .
  • transformation can also be performed by electroporation.
  • the host is a eukaryotic organism, the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
  • the polynucleotide sequence of the present invention can be used to express or produce recombinant human glutaryl coenzyme A dehydrogenase 15. 51 (Sc ience, 1984; 224: 1431). Generally, the following steps are taken:
  • the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
  • a suitable method such as temperature conversion or chemical induction
  • the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If necessary, the recombinant protein can be isolated and purified by various separation methods using its physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
  • conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid
  • polypeptides of the present invention as well as antagonists, agonists and inhibitors of the polypeptides, can be directly used in the treatment of diseases, for example, they can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection, and immune diseases.
  • Glutaryl-CoA dehydrogenase catalyzes the oxidative decarboxylation of glutaryl-CoA to butyryl-CoA and carbon dioxide.
  • Glutaryl-CoA is an intermediate of lysine, tryptophan, and hydroxylysine oxidation. In vivo, its abnormal expression can cause protein metabolism disorders, and then lead to the occurrence of related diseases.
  • the expression profile of the polypeptide of the present invention is consistent with the expression profile of human glutaryl-CoA dehydrogenase (GCD) protein, and both have similar biological functions.
  • GCD glutaryl-CoA dehydrogenase
  • the polypeptide of the present invention is involved in the metabolism of proteins in the body and is an intermediate for the oxidation of lysine, tryptophan and hydroxylysine. Abnormal expression can cause protein metabolism disorders, and then lead to the occurrence of related diseases, including but not limited to:
  • Protein peptide hormone dysfunction can cause the following diseases:
  • Insulin and glucagon diabetes, hypoglycemia, etc .;
  • hypothalamus and pituitary hormones Giant disease, dwarfism, acromegaly, Cortisol syndrome (Cushing's syndrome), primary hyperaldosteronism, secondary chronic adrenal insufficiency, hyperthyroidism Hypothyroidism (Small disease, Juvenile hypothyroidism, Adult hypothyroidism), Male / female infertility Disorders, menstrual disorders (functional uterine bleeding, amenorrhea, polycystic ovary syndrome, premenstrual tension syndrome, menopause syndrome), sexual development disorders, diabetes insipidus, inappropriate antidiuretic hormone secretion syndrome, abnormal lactation, etc .;
  • parathyroid hormone hyperparathyroidism, hypoparathyroidism, etc .
  • Gastrointestinal hormones peptic ulcer, chronic indigestion, chronic gastritis, etc .;
  • Arrhythmia shock, insanity, epilepsy, chorea, hepatic encephalopathy (norepinephrine, Y-aminobutyric acid, serotonin, glutamine), motion sickness, I-type allergic disease (Net Measles, hay fever, allergic rhinitis, skin allergies), peptic ulcer (histamine), hypercholesterolemia (taurine), tumors (polyamines), etc .;
  • hemoglobin diseases anemia, jaundice, tissue-induced organic acidemia due to hypoxia
  • various coagulation factor deficiency bleeding
  • muscle spasms muscle forcing
  • muscle paralysis actin
  • hyperlipoproteinemia etc .
  • GCD glutaric acidemia
  • polypeptide of the present invention and the antagonist, agonist and inhibitor of the polypeptide can be directly used in the treatment of various diseases, such as diseases related to protein metabolism disorder, type I glutaric acidemia and the like.
  • the invention also provides methods of screening compounds to identify agents that increase (agonist) or suppress (antagonist) human glutaryl-CoA dehydrogenase 15.51.
  • Agonists enhance human glutaryl coenzyme A dehydrogenase 15. 51 Stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
  • a mammalian cell or a membrane preparation expressing human glutaryl coenzyme A dehydrogenase 15.51 can be cultured with a labeled human glutaryl coenzyme A dehydrogenase 15.51 in the presence of a drug. The ability of the drug to increase or block this interaction is then determined.
  • Antagonists of human glutaryl coenzyme A dehydrogenase 15.51 include antibodies, compounds, receptor deletions, and the like that have been screened. Antagonist of human glutaryl coenzyme A dehydrogenase 15.51 can bind to human glutaryl coenzyme A dehydrogenase 15.51 and eliminate its function, or inhibit the production of the polypeptide, or with the activity of the polypeptide Site binding prevents the polypeptide from performing its biological function.
  • human glutaryl coenzyme A dehydrogenase 15.51 can be added to the bioanalytical assay, and human glutaryl coenzyme A dehydrogenase 15.51 and its receptors can be determined by measuring compounds The effects of interactions between humans to determine whether a compound is an antagonist.
  • Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds.
  • Catalase molecules bound by catalase 15.51 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. When screening, generally 15.51 molecules of human glutaryl coenzyme A dehydrogenase should be labeled.
  • the present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies.
  • the invention also provides antibodies against the human glutaryl-CoA dehydrogenase 15.51 epitope. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by Fab expression libraries.
  • polyclonal antibodies can be obtained by direct injection of human glutaryl coenzyme A dehydrogenase 15.51 into immunized animals (such as rabbits, mice, rats, etc.).
  • immunized animals such as rabbits, mice, rats, etc.
  • a variety of adjuvants can be used to enhance the immune response, including but It is not limited to Freund's adjuvant and the like.
  • Techniques for preparing monoclonal antibodies to human glutaryl-CoA dehydrogenase 15.51 include, but are not limited to, hybridoma technology (Koh ler and Mistein. Nature, 1975, 256: 495-497), triple tumor technology, . Human B-cell hybridoma technology, EBV-hybridoma technology, etc.
  • An inlay antibody combining a human constant region and a non-human variable region can be produced using existing technologies (Morrison et al., PNAS, 1985, 81: 6851).
  • the existing technology for producing single-chain antibodies (U.S. Pat No. 4946778) can also be used to produce single-chain antibodies against human glutaryl-CoA dehydrogenase 15.51.
  • Antibodies against human glutaryl coenzyme A dehydrogenase 15. 51 can be used in immunohistochemical techniques to detect human glutaryl coenzyme A dehydrogenase 15. 51 in biopsy specimens.
  • Monoclonal antibodies that bind to human glutaryl coenzyme A dehydrogenase 15.51 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
  • Antibodies can also be used to design immunotoxins that target a particular part of the body.
  • 51 High affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
  • a common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
  • This hybrid antibody can be used to kill human glutaryl coenzyme A dehydrogenase 15. 51 positive cells.
  • the antibodies of the present invention can be used to treat or prevent diseases related to human glutaryl-CoA dehydrogenase 15.51. Administration of appropriate doses of antibodies can stimulate or block the production or activity of human glutaryl coenzyme A dehydrogenase 15.51.
  • the invention also relates to a diagnostic test method for quantitative and localized detection of human glutaryl coenzyme A dehydrogenase 15.51 levels.
  • tests are well known in the art and include FISH assays and radioimmunoassays.
  • 15.51 levels of human glutaryl-CoA dehydrogenase detected in the test can be used to explain human glutaryl-CoA The importance of A dehydrogenase 15.51 in various diseases and for the diagnosis of diseases where human glutaryl coenzyme A dehydrogenase 15.51 functions.
  • polypeptide of the present invention can also be used for peptide mapping analysis.
  • the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
  • Polynucleotides encoding human glutaryl coenzyme A dehydrogenase 15.51 can also be used for a variety of therapeutic purposes. Gene therapy technology can be used to treat abnormal cell proliferation, development or metabolism caused by the non-expression or abnormal / inactive expression of human glutaryl coenzyme A dehydrogenase 15.51. Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated human glutaryl coenzyme A dehydrogenase 15.51 to inhibit endogenous human glutaryl coenzyme A dehydrogenase 15.51 activity.
  • a mutated human glutaryl coenzyme A dehydrogenase 15.51 may be a shortened human glutaryl coenzyme A dehydrogenase 15.51, although it can be used with downstream substrates. Binding, but lacks signaling activity. Therefore, the recombinant gene therapy vector can be used to treat diseases caused by glutamate coenzyme A dehydrogenase 15.51.
  • Expression vectors derived from viruses such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to transfer a polynucleotide encoding human glutaryl coenzyme A dehydrogenase 15.51 into cells .
  • a method for constructing a recombinant viral vector carrying a polynucleotide encoding human glutaryl coenzyme A dehydrogenase 15.51 can be found in existing literature (Sambrook, et al.).
  • a recombinant polynucleotide encoding human glutaryl coenzyme A dehydrogenase 15.51 can be packaged into liposomes and transferred into cells.
  • Methods for introducing a polynucleotide into a tissue or cell include: injecting the polynucleotide directly into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
  • a vector such as a virus, phage, or plasmid
  • a ribozyme is an enzyme-like RNA molecule that specifically decomposes specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation.
  • Antisense RNA, DM, and ribozymes can be obtained using any existing RNA or DM synthesis techniques, such as solid-phase phosphoramidite chemical synthesis to synthesize oligonucleotides.
  • Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA. This DNA sequence has been integrated downstream of the vector's RNA polymerase promoter. In order to increase the stability of the nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the linkage between ribonucleosides using phosphate thioester or peptide bonds instead of phosphodiester bonds.
  • Encoding human Coenzyme A dehydrogenase I polynucleotide 5.51 may be used to diagnose the human Coenzyme A dehydrogenase 15.51 related diseases.
  • Polynucleotide encoding human glutaryl coenzyme A dehydrogenase 15.51 Can be used to detect the expression of human glutaryl coenzyme A dehydrogenase 15.51 or abnormal expression of human glutaryl coenzyme A dehydrogenase 15.51 in a disease state.
  • a DNA sequence encoding human glutaryl-CoA dehydrogenase 15.51 can be used to hybridize biopsy specimens to determine the expression of human glutaryl-CoA dehydrogenase 15.51.
  • Hybridization techniques include Southern blotting, Northern blotting, and in situ hybridization. These techniques and methods are publicly available and mature, and related kits are commercially available. A part or all of the polynucleotides of the present invention can be used as probes to be fixed on a micro array or a DNA chip (also called a "gene chip") for analyzing differential expression analysis and gene diagnosis of genes in tissues.
  • Human glutaryl-CoA dehydrogenase 15.51 specific primers for RNA-polymerase chain reaction (RT-PCR) in vitro amplification can also detect human glutaryl-CoA dehydrogenase 15.51 transcription products.
  • Human glutaryl-CoA dehydrogenase 15.51 mutations can also be used to diagnose human glutaryl-CoA dehydrogenase 15.51-related diseases.
  • Human glutaryl coenzyme A dehydrogenase 15.51 mutant forms include point mutations, translocations, deletions, recombinations and any other abnormalities compared to normal wild-type human glutaryl coenzyme A dehydrogenase 15.51 DNA sequences Wait. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect the expression of proteins. Therefore, Nor thern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
  • sequences of the invention are also valuable for chromosome identification. This sequence will specifically target a specific position on a human chromosome and can hybridize to it. Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for marking chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DNA sequences on a chromosome.
  • PCR primers (preferably 15-35bp) are prepared based on cDNA, and the sequences can be located on chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
  • PCR localization of somatic hybrid cells is a quick way to localize DM to specific chromosomes.
  • oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
  • Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.
  • Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step.
  • FISH Fluorescent in situ hybridization
  • the difference in cDM or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).
  • the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
  • suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
  • the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
  • the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell.
  • the polypeptides of the invention can be used in combination with other therapeutic compounds.
  • the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
  • Human glutaryl coenzyme A dehydrogenase 15. 51 is administered in an amount effective to treat and / or prevent a specific indication.
  • the amount and range of human glutaryl coenzyme A dehydrogenase 15.51 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician. Examples
  • RNA Human fetal brain total RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform.
  • Poly (A) mRNA was isolated from total RNA using Quik mRNA I solat ion Kit (product of Qiegene). 2ug poly (A) mRNA is reverse transcribed to form cDNA. Smart cDNA cloning kit (purchased from Clontech 1) was used to insert the cDNA fragment into the multiple cloning site of pBSK (+) vector (Clontech) to transform intestine ⁇ to form a cDNA library.
  • Dye terminate cycle react ion sequencing ki t Perkin-Elmer
  • ABI 377 automatic sequencer Perkin-Elmer
  • the determined cDNA sequences were compared with the existing public DM sequence database (Genebank). By comparison, it was found that the cDNA sequence of one of the clones 0371a05 was new DNA.
  • a series of primers were synthesized to determine the inserted cDNA fragment of the clone in both directions.
  • Example 2 Cloning of human glutaryl coenzyme A by RT-PCR Genes for dehydrogenase 15.51
  • the total RNA from fetal brain cells was used as a template, and ol igo-dT was used as a primer for reverse transcription reaction to synthesize cDNA.
  • the following primers were used for PCR amplification:
  • Primerl 5,-ATGAATGTGAAATTCAAGCTTCTC —3, (SEQ ID NO: 3)
  • Primer2 5'- ACTGAAACACATCTTTTTATTATA -3 '(SEQ ID NO: 4)
  • Primerl is a forward sequence starting at lbp of the 5th end of SEQ ID NO: 1;
  • Primer 2 is the 3 'end reverse sequence in SEQ ID NO: 1.
  • a reaction volume of 50 ⁇ 1 contains 50 mmol / L KCl, 10 mmol / L Tris-HCl pH 8. 5, 1. 5 mmol / L MgCl 2 , 20 ( ⁇ mol / L dNTP, 1 Opmol primer, 1U of Taq DNA polymerase (Clontech).
  • the reaction was performed on a PE9600 DM thermal cycler (Perkin-Elraer) for 25 cycles under the following conditions: 94 ° C 30sec; 55. C 30sec; 72 ° C 2min.
  • ⁇ -act in was used as a positive control and template blank was used as a negative control.
  • the amplified product was purified using a QUGEN kit and connected to a PCR vector using a TA cloning kit (Invi trogen). DNA sequence The analysis results show that the DM sequence of the PCR product is exactly the same as that of 1-2052bp shown in SEQ ID NO: 1.
  • Example 3 Northern blot analysis of human glutaryl-CoA dehydrogenase 15.51 gene expression Total protein was extracted in one step RNA [Anal. Biochem 1987, 162, 156-159] 0 This method involves acid guanidinium thiocyanate phenol-chloroform extraction. 4M guanidinium isothiocyanate- 2 5 mM sodium citrate, 0.2 M sodium acetate (pH 4 .
  • RNA pellet was washed with 70% ethanol, dried and dissolved in water.
  • electrophoresis was performed on a 1.2% agarose gel containing 20 mM 3- (N-morpholino) propanesulfonic acid (pH 7.0)-5 mM sodium acetate-ImM EDTA-2.2M formaldehyde.
  • Example 4 In vitro expression, isolation and purification of recombinant human glutaryl coenzyme A dehydrogenase 15.51 According to the sequence of the coding region shown in SEQ ID NO: 1 and FIG. 1, a pair of specific amplification primers were designed, the sequence is as follows:
  • Primer3 5'-CCCCATATGATGATGAGCTTCAGTCAAGAAAAA-3 '(Seq ID No: 5)
  • Primer4 5'-CCCGAATTCTTATGAATGTTTAATTGAATATTT-3' (Seq ID No: 6)
  • the two ends of these two primers are combined with Ndel and EcoRI restriction sites , followeded by the coding sequences of the 5 'and 3' ends of the gene of interest, respectively.
  • the Ndel and EcoRI restriction sites correspond to the selectivity on the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865.3). Endonuclease site.
  • the PCR reaction was performed using the pBS-0371a05 plasmid containing the full-length target gene as a template.
  • the PCR reaction conditions were as follows: 10 pg of pBS-0371a05 plasmid in a total volume of 50 ⁇ 1, primers Pritner-3 and Pritner-4 were lOpmol, Advantage polymerase Mix (Clontech) 1 ⁇ 1, respectively. Cycle parameters: 94 ° C 20s, 60 ° C 30s, 68 ° C 2 min, a total of 25 cycles. Ndel and EcoRI were used to double digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase.
  • the ligation product was transformed into E. coli DH5a by the calcium chloride method. After being cultured overnight on LB plates containing kanamycin (final concentration 30 g / ml), positive clones were selected by colony PCR method and sequenced. A positive clone (pET-0371a05) with the correct sequence was selected, and the recombinant plasmid was transformed into E. coli BL21 (DE3) plySs (product of Novagen) using the calcium chloride method.
  • a peptide synthesizer (product of PE company) was used to synthesize the following human glutaryl coenzyme A dehydrogenase 15.51-specific peptides:
  • NH2-Met-Met-Ser-Phe-Ser-Gln-Glu-Lys-Lys-Arg-Lys-Asp-Pro-Phe-Ser-C00H (SEQ ID NO: 7).
  • the polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex.
  • Rabbits were immunized with 1 ⁇ 2 g of the hemocyanin-polypeptide complex and complete Freund's adjuvant. After 15 days, the rabbit was immunized with hemocyanin-polypeptide complex and incomplete Freund's adjuvant.
  • a titer plate coated with a 15 g / ml bovine serum albumin peptide complex was used as an ELISA to determine antibody titers in rabbit serum.
  • Protein A-Sepharose was used to isolate total IgG from antibody-positive rabbit serum.
  • the peptide was bound to a cyanogen bromide-activated Sepharose4B column, and anti-peptide antibodies were separated from the total IgG by affinity chromatography. Immunoprecipitation showed that the purified antibody could specifically bind to human glutaryl-CoA dehydrogenase 15.51.
  • Example 6 Application of the polynucleotide fragment of the present invention as a hybridization probe
  • Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
  • the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
  • the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
  • the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method.
  • Filter hybridization methods include dot blotting, Southern blotting, Northern blotting, and copying methods. They all use the same steps of hybridization after fixing the polynucleotide sample to be tested on the filter.
  • the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer, so that the non-specific binding site of the sample on the filter is saturated with the carrier and the synthetic polymer.
  • the pre-hybridization solution is then replaced with a hybridization buffer containing the labeled probe and incubated to hybridize the probe to the target nucleic acid.
  • the unhybridized probes are removed by a series of membrane washing steps.
  • This embodiment utilizes higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals.
  • the probes used in this embodiment include two types: The first type of probe Are oligonucleotide fragments that are completely identical or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are oligonucleotides that are partially identical or complementary to the polynucleotide SEQ ID NO: 1 of the present invention Acid fragments.
  • the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
  • oligonucleotide fragments for use as hybridization probes from the polynucleotide SEQ ID NO: 1 of the present invention should follow the following principles and several aspects to be considered:
  • the preferred range of probe size is 18-50 nucleotides
  • the GC content is 30% -70%, and the non-specific hybridization increases when it exceeds;
  • Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their S The complement region is compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, the primary selection probe should generally not be used;
  • Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
  • Probe 1 which belongs to the second type of probe, is equivalent to the replacement mutant sequence of the gene fragment of SEQ ID NO: 1 or its complementary fragment (41Nt):
  • PBS phosphate buffered saline
  • step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
  • sample film 1) Take 4 x 2 pieces of nitrocellulose membrane (NC membrane) of appropriate size, and mark the spotting position and sample number on it with a pencil. Two NC membranes are needed for each probe for later experiments. In the step, the film is washed with high-strength conditions and strength conditions, respectively.
  • NC membrane nitrocellulose membrane
  • the 32 P-Probe (the second peak is free ⁇ - 32 P-dATP) is prepared.
  • the sample membrane was placed in a plastic bag, and 3-1 Omg pre-hybridization solution (1 OxDenhardt-s; 6xSSC, 0.1 mg / ml CT DNA (calf thymus DNA)) was added. After sealing the bag, shake at 68 ° C for 2 hours.
  • 3-1 Omg pre-hybridization solution (1 OxDenhardt-s; 6xSSC, 0.1 mg / ml CT DNA (calf thymus DNA)
  • Gene microarrays or DNA microarrays are new technologies currently being developed by many national laboratories and large pharmaceutical companies. It refers to the orderly and high-density arrangement of a large number of target gene fragments on glass, The data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software to achieve the purpose of rapid, efficient, and high-throughput analysis of biological information.
  • the polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research on the function of new genes; search for and screen new tissue-specific genes, especially diseases related genes such as tumors; diagnosis of diseases such as heredity disease.
  • the specific method steps have been reported in the literature. For example, see the references DeRi si, JL, Lyer, V. & Brown, P. 0 (1997) Science 278, 680-686. And Hel Le, RA. Schema, M., Chai, A., Shalom, D., (1997) PNAS 94: 2150-2155.
  • a total of 4,000 polynucleotide sequences of various full-length cDMs are used as target DMs, including the polynucleotides of the present invention. They were respectively amplified by PCR, and the concentration of the amplified product was adjusted to about 500 ng / ul after purification, and spotted on a glass medium with a Cartesian 7500 spotter (purchased from Cartesian Company, USA). The distance between them is 280 ⁇ . The spotted slides were hydrated and dried, cross-linked in a UV cross-linker, and dried after elution to fix the DNA on the glass slides to prepare chips. The specific method steps have been reported in the literature.
  • the sample post-treatment step of this embodiment is:
  • Total mRNA was extracted from human mixed tissues and specific tissues (or stimulated cell lines) in one step, and mRM was purified by Ol igotex mRNA Midi Kit (purchased from QiaGen), and another 1 J was separated by reverse transcription.
  • the fluorescent reagent Cy3dUTP (5-Amino-propargyl-2'-deoxyuridine 5--tr iphate coupled to Cy3 fluorescent dye, purchased from Amersham Phamacia Biotech) was used to label mRM of human mixed tissue, and the fluorescent reagent Cy5dUTP (5-Amino- Propargyl- 2'-deoxyuridine 5'-tr iphate coupled to Cy5 fluorescent dye, purchased from Amersham Phamacia Biotech, labeled the body's specific tissue (or stimulated cell line) mRNA, and the probe was prepared after purification.
  • Cy3dUTP 5-Amino-propargyl-2'-deoxyuridine 5--tr iphate coupled to Cy
  • the probes from the above two tissues and the chip were respectively hybridized in a UniHyb TM Hybridizat ion Solut ion (purchased from TeleChem) hybridization solution for 16 hours, and a washing solution (1 ⁇ SSC, 0.2 ° / oSDS) was used at room temperature. After washing, scanning was performed with a ScanArray 3000 scanner (purchased from General Scanning, USA), and the scanned images were analyzed by Imagene software (Biodi scovery, USA) to calculate the Cy3 / Cy5 ratio of each point.
  • the above specific tissues are fetal brain, bladder mucosa, PMA + Ecv304 cell line, LPS + Ecv304 cell line, thymus, normal fibroblasts 1024NC, Fibroblast, growth factor stimulation, 1024NT, scar formation fc Growth factor stimulation, 1013HT, scar into fc without growth factor stimulation, 1013HC, bladder cancer cell EJ, bladder cancer, bladder cancer, liver cancer, liver cancer cell line, fetal skin, spleen, prostate cancer, jejunal adenocarcinoma, cardiac cancer. Based on these 18 Cy3 / Cy5 ratios, a bar graph is drawn ( Figure 1). It can be seen from the figure that the expression profiles of human glutaryl-CoA dehydrogenase 15.51 and human glutaryl-CoA dehydrogenase according to the present invention are very similar.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

L'invention concerne un nouveau polypeptide, une glutaryl-CoA déshydrogénase humaine 15.51, et un polynucléotide codant ce polypeptide ainsi qu'un procédé d'obtention de ce polypeptide par des techniques recombinantes d'ADN. L'invention concerne en outre les applications de ce polypeptide dans le traitement de maladies, notamment de maladies associées aux troubles du métabolisme des protéines et de l'acidurie glutarique de type I. L'invention concerne aussi l'antagoniste agissant contre le polypeptide et son action thérapeutique ainsi que les applications de ce polynucléotide codant la glutaryl-CoA déshydrogénase humaine 15.51.
PCT/CN2001/001098 2000-06-30 2001-06-29 Nouveau polypeptide, glutaryl-coa deshydrogenase humaine 15.51, et polynucleotide codant ce polypeptide WO2002040523A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU2002210332A AU2002210332A1 (en) 2000-06-30 2001-06-29 A novel polypeptide-homo glutaryl- coa dehydrogenase 15.51 and polynucleotide encoding said polypeptide

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN 00116889 CN1331305A (zh) 2000-06-30 2000-06-30 一种新的多肽——人戊二酰辅酶a脱氢酶15.51和编码这种多肽的多核苷酸
CN00116889.4 2000-06-30

Publications (1)

Publication Number Publication Date
WO2002040523A1 true WO2002040523A1 (fr) 2002-05-23

Family

ID=4586288

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2001/001098 WO2002040523A1 (fr) 2000-06-30 2001-06-29 Nouveau polypeptide, glutaryl-coa deshydrogenase humaine 15.51, et polynucleotide codant ce polypeptide

Country Status (3)

Country Link
CN (1) CN1331305A (fr)
AU (1) AU2002210332A1 (fr)
WO (1) WO2002040523A1 (fr)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2021256579A1 (fr) 2020-06-16 2021-12-23 노벨파마 주식회사 Composition pour le traitement de l'acidurie glutarique et procédé d'administration associé

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
SUN XIAO CHENG ET AL.: "Molecular cloning of cDNA encoding mitochondrial very long chain acyl-CoA dehydrogenase from bovine heart", ACTA PHARMACOLOGICA SINICA, vol. 18, no. 1, January 1997 (1997-01-01), pages 25 - 32 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2021256579A1 (fr) 2020-06-16 2021-12-23 노벨파마 주식회사 Composition pour le traitement de l'acidurie glutarique et procédé d'administration associé
EP4166157A4 (fr) * 2020-06-16 2024-03-06 Novel Pharma Inc Composition pour le traitement de l'acidurie glutarique et procédé d'administration associé

Also Published As

Publication number Publication date
AU2002210332A1 (en) 2002-05-27
CN1331305A (zh) 2002-01-16

Similar Documents

Publication Publication Date Title
WO2002040523A1 (fr) Nouveau polypeptide, glutaryl-coa deshydrogenase humaine 15.51, et polynucleotide codant ce polypeptide
WO2002026796A1 (fr) Nouveau polypeptide, recepteur humain 14.3 d'hormone de croissance, et polynucleotide codant ce polypeptide
WO2001094406A1 (fr) Nouveau polypeptide, dihydropyridine-acide dicarboxylique deshydrogenase 21, et polynucleotide codant ce polypeptide
WO2001072815A1 (fr) Nouveau polypeptide, ferredoxine humaine 12, et polynucleotide codant pour ce polypeptide
WO2001046240A1 (fr) Nouveau polypeptide, mariner transposase 19 humaine, et polynucleotide codant pour ce polypeptide
WO2002004501A1 (fr) Nouveau polypeptide, $g(b)-glucosaccharase humaine 11.88, et polynucleotide codant ce polypeptide
WO2001092541A1 (fr) Nouveau polypeptide, catalase 12, et polynucleotide codant ce polypeptide
WO2002012314A1 (fr) Nouveau polypeptide, proteine-1 humaine associee a la dihydropyrimidinase (drp-1) 9.68, et polynucleotide codant ce polypeptide
WO2001094537A2 (fr) Nouveau polypeptide, nadh-ubiquinone oxydoreductase humaine 21.89, et polynucleotide codant ce polypeptide
WO2001092515A1 (fr) Nouveau polypeptide, facteur humain de transcription 29.26, et polynucleotide codant ce polypeptide
WO2002012297A1 (fr) Nouveau polypeptide, proteine humaine 9 de liaison a la tropomoduline, et polynucleotide codant ce polypeptide
WO2002012306A1 (fr) Nouveau polypeptide, desintegrine-metalloprotease humaine 10.67, et polynucleotide codant ce polypeptide
WO2001073045A1 (fr) Nouveau polypeptide, quinine reductase humaine 10, et polynucleotide codant pour ce polypeptide
WO2001092287A1 (fr) Nouveau polypeptide, phosphatase acide 14, et polynucleotide codant ce polypeptide
WO2002020784A1 (fr) Nouveau polypeptide, proteine ribosomale s1111.22, et polynucleotide codant ce polypeptide
WO2002000833A2 (fr) Nouveau polypeptide, proteine 113.31 d'acide gamma carboxyglutamique riche en proline, et polynucleotide codant ce polypeptide
WO2002012319A1 (fr) Nouveau polypeptide, pompe sodium-potassium humaine 14.85, et polynucleotide codant ce polypeptide
WO2001072792A1 (fr) Nouveau polypeptide, proteine humaine 13 analogue a l'ubiquitine, et polynucleotide codant pour ce polypeptide
WO2001073046A1 (fr) Nouveau polypeptide, quinine reductase humaine 13, et polynucleotide codant pour ce polypeptide
WO2001072805A1 (fr) Nouveau polypeptide, sous-unite humaine 14.19 de flavoproteine, et polynucleotide codant pour ce polypeptide
WO2001075024A2 (fr) Nouveau polypeptide, facteur humain 13 associe a nf-e2, et polynucleotide codant pour ce polypeptide
WO2001094533A2 (fr) Nouveau polypeptide, proteine humaine 13 de regulation de la proteine phosphorylase, et polynucleotide codant ce polypeptide
WO2001047993A1 (fr) Nouveau polypeptide, proteine d'echange anionique 9, et polynucleotide codant pour ce polypeptide
WO2002020575A1 (fr) Nouveau polypeptide, proteine humaine 10 associee aux maladies auto-immunes, et polynucleotide codant ce polypeptide
WO2001075051A2 (fr) Nouveau polypeptide, proteine humaine 17 stag3 (antigene stromal), et polynucleotide codant pour ce polypeptide

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP