WO2002012306A1 - Nouveau polypeptide, desintegrine-metalloprotease humaine 10.67, et polynucleotide codant ce polypeptide - Google Patents

Nouveau polypeptide, desintegrine-metalloprotease humaine 10.67, et polynucleotide codant ce polypeptide Download PDF

Info

Publication number
WO2002012306A1
WO2002012306A1 PCT/CN2001/000994 CN0100994W WO0212306A1 WO 2002012306 A1 WO2002012306 A1 WO 2002012306A1 CN 0100994 W CN0100994 W CN 0100994W WO 0212306 A1 WO0212306 A1 WO 0212306A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
polynucleotide
integrin
metalloproteinase
human non
Prior art date
Application number
PCT/CN2001/000994
Other languages
English (en)
Chinese (zh)
Inventor
Yumin Mao
Yi Xie
Original Assignee
Biowindow Gene Development Inc. Shanghai
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Biowindow Gene Development Inc. Shanghai filed Critical Biowindow Gene Development Inc. Shanghai
Priority to AU95387/01A priority Critical patent/AU9538701A/en
Publication of WO2002012306A1 publication Critical patent/WO2002012306A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/48—Hydrolases (3) acting on peptide bonds (3.4)
    • C12N9/50—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25)
    • C12N9/64—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue
    • C12N9/6421—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue from mammals
    • C12N9/6489—Metalloendopeptidases (3.4.24)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy

Definitions

  • the present invention belongs to the field of biotechnology. Specifically, the present invention describes a new polypeptide, a human non-integrin-metalloproteinase 10.67, and a polynucleotide sequence encoding the polypeptide. The invention also relates to methods and applications for preparing such polynucleotides and polypeptides. Background technique
  • Leukase is involved in extracellular protein metabolism and can be divided into two functional families.
  • Matrix-degraded metalloproteinases (gluease, gelatinase, and stromelysin) are secreted into the extracellular space as a pre-latent form, where they are activated by restricted proteolysis.
  • Matrix activity is tightly controlled at synthetic levels, usually lower and induced by cytokines and other substances, and can also be induced by integrative compounds that combine with specific extracellular protein inhibitors (Nagase, H. and Salvesen, G. ( 1993) in Innovations in Proteases and their Inhibitors (Aviles, FX, ed.), Pp. 315-332, Walter de Gruy ter, Berlin).
  • the second mammalian metalloproteinase family is membrane integrins, which also includes endopeptidases
  • E24.11 and ECE have similar active sites to prokaryotic thermosporins, and meprin is a member of the metal protein astaxanthin (a zinc-containing endopeptidase) family.
  • the substrates of E24.11 and ECE are relatively small peptide chains, meprin can act on larger proteins and degrade extracellular matrix components. Defects in extracellular protein metabolism are important for a variety of diseases such as histiocytoma, lymphoma, colon cancer, lung cancer, and retinoblastoma, and metalloproteinases can be used to form therapies that target targets to insert appropriate inhibitors .
  • MADM mammalian non-integrated metalloproteinase
  • the present invention is named human non-integrin-metalloproteinase 10.67.
  • the human non-integrin-metalloproteinase 10.67 protein plays an important role in regulating important functions of the body such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes, so identification in the art has been required More human non-integrin-metalloproteinase 10.67 proteins involved in these processes, especially the amino acid sequence of this protein was identified.
  • New human non-integrin-metalloproteinase 10.67 The isolation of the protein-coding gene also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so it is important to isolate its coding DNA. Disclosure of invention
  • Another object of the invention is to provide a polynucleotide encoding the polypeptide.
  • Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding a human non-integrin-metalloproteinase 10.67.
  • Another object of the present invention is to provide a genetically engineered host cell comprising a polynucleotide encoding a human non-integrin-metalloproteinase 10.67.
  • Another object of the present invention is to provide a method for producing human non-integrin-metalloproteinase 10.67. Another object of the present invention is to provide an antibody against the polypeptide-human non-integrin-metalloproteinase 1 0.67 of the polypeptide of the present invention.
  • Another object of the present invention is to provide mimic compounds, antagonists, agonists, and inhibitors against the polypeptide of the present invention-human non-integrin-metalloproteinase 10.67.
  • Another object of the present invention is to provide a method for diagnosing and treating diseases related to the human non-integrin-metalloproteinase 10.67 abnormality.
  • the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
  • the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of: (a) a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID No. 2;
  • sequence of the polynucleotide is one selected from: (a) a sequence having positions 3388-3681 in SEQ ID NO: 1; and (b) a sequence having 1-3809 in SEQ ID NO: 1 Sequence of bits.
  • the present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
  • the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
  • the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit human non-integrin-metalloproteinase 10.67 protein activity, which comprises utilizing the polypeptide of the invention.
  • the invention also relates to compounds obtained by this method.
  • the present invention also relates to a method for in vitro detection of a disease or susceptibility to disease associated with abnormal expression of a human non-integrin-metalloproteinase 10.67 protein, comprising detecting mutations in the polypeptide or a polynucleotide sequence encoding the same in a biological sample. Or detecting the amount or biological activity of a polypeptide of the invention in a biological sample.
  • the present invention also relates to a pharmaceutical composition comprising a polypeptide of the present invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
  • the present invention also relates to the preparation of a polypeptide and / or polynucleotide of the present invention for the treatment of cancer, developmental disease or immune disease or other drugs caused by abnormal expression of human non-integrin-metalloproteinase 1.67. use.
  • Nucleic acid sequence refers to oligonucleotides, nucleotides or polynucleotides and fragments or parts thereof, and may also refer to the genome or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
  • amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
  • amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
  • a protein or polynucleotide “variant” refers to an amino acid sequence having one or more amino acids or nucleotide changes, or a polynucleotide sequence encoding it.
  • the changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence.
  • Variants can have "conservative" changes, which The amino acid substituted in the amino acid has a structural or chemical property similar to that of the original amino acid, such as replacing isoleucine with leucine.
  • Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
  • “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
  • Insertion refers to an alteration in the amino acid sequence or nucleotide sequence that results in an increase in one or more amino acids or nucleotides compared to a naturally occurring molecule.
  • Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
  • Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
  • immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response and to bind to specific antibodies in a suitable animal or cell.
  • An "agonist” refers to a molecule that, when combined with a human non-integrin-metalloproteinase 10.67, can cause the protein to change and thereby regulate the activity of the protein.
  • An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that can bind to a human non-integrin-metalloproteinase 10.67.
  • Antagonist refers to a biological activity or immunity that can block or modulate human non-integrin-metalloproteinase 1.067 when combined with human non-integrin-metalloproteinase 1.067.
  • Chemically active molecules may include proteins, nucleic acids, carbohydrates or any other molecule that can bind to human non-integrin-metalloproteinase 1.067.
  • Regular refers to a change in the function of human non-integrin-metalloproteinase 1.67, including any increase or decrease in protein activity, changes in binding characteristics, and any other organism of human non-integrin-metalloproteinase 1.67. Changes in nature, function, or immunity.
  • substantially pure is meant substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated.
  • Those skilled in the art can purify human non-integrin-metalloproteinases 10.67 using standard protein purification techniques.
  • Substantially pure human non-integrin-metalloproteinase 10.67 produces a single main band on a non-reducing polyacrylamide gel.
  • Human non-integrin-metalloproteinase 10. 67 The purity of the peptide can be analyzed by amino acid sequence.
  • Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
  • sequence C-T-G-A
  • complementary sequence G-A-C-T.
  • the complementarity between two single-stranded molecules may be partial or complete.
  • the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
  • “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
  • Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be achieved by hybridization under conditions of reduced stringency (Sou t hern blotting or Nor thern blot, etc.) to detect.
  • Substantially homologous sequences or hybridization probes can compete and inhibit the binding of completely homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.
  • Percent identity refers to the percentage of sequences that are the same or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALIGN program (Lasergene sof tware package, DNASTAR, Inc., Madi son Wis.). The MEGALIGN program can compare two or more sequences according to different methods such as the Clus ter method (Hi gg ins, D. G. and P. M. Sharp (1988) Gene 73: 237-244). The Cluster method arranges groups of groups into clusters by checking the distance between all pairs. The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by:
  • the number of residues matching between sequence A and sequence X 100
  • the number of residues in sequence A-the number of spacer residues in sequence A-the number of spacer residues in sequence B can also be determined by the Clus ter method or by methods known in the art For example, Jotun He in determines the percent identity between nucleic acid sequences (He in J., (1990) Methods in emzumology 183: 625-645). 0 "Similarity" refers to the amino acid residues at the corresponding positions when the amino acid sequences are aligned. The extent of the same or conservative substitution.
  • Amino acids used for conservative substitutions may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
  • Antisense refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence.
  • Antisense strand refers to a nucleic acid strand that is complementary to the “sense strand”.
  • Derivative refers to a chemical modification of HFP or a nucleic acid encoding it. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
  • Antibody refers to a complete antibody molecule and its fragments, such as Fa, F (ab ') 2 and Fv, which can specifically bind to the human non-integrin-metalloproteinase 10.67 epitope.
  • a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
  • isolated refers to the removal of a substance from its original environment (for example, its natural environment if it occurs naturally).
  • a naturally occurring polynucleotide or polypeptide exists in a living animal. It is not isolated, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
  • Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not a component of its natural environment, they are still isolated.
  • isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
  • polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances existing in the natural state. .
  • isolated human non-integrin-metalloproteinase 10. 67 refers to human non-integrin-metalloproteinase 10, 67 which is substantially free of other proteins, lipids, carbohydrates or other substances with which it is naturally associated. Those skilled in the art can purify human non-integrin-metalloproteinase 10.67 using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. Human non-integrin-metalloproteinase 10. 67 The purity of the peptide can be analyzed by amino acid sequence.
  • the present invention provides a new polypeptide-human non-integrin-metalloproteinase 10.67, which is basically composed of the amino acid sequence shown in SEQ ID NO: 2.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
  • the polypeptides of the present invention can be naturally purified products, or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques.
  • polypeptides of the invention may be glycosylated or may be non-glycosylated.
  • the polypeptides of the invention may also include or exclude the starting methionine residue.
  • the invention also includes fragments, derivatives, and analogs of human non-integrin-metalloproteinase 10.67.
  • fragment refers to a polypeptide that substantially maintains the same biological function or activity of the human non-integrin-metalloproteinase 10.67 of the present invention.
  • the fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution
  • the amino acid may or may not be encoded by a genetic codon; or ( ⁇ ) a type in which a group on one or more amino acid residues is replaced by another group to include a substituent; or ( ⁇ ⁇ )
  • Such a polypeptide sequence in which the mature polypeptide is fused with another compound such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol
  • a polypeptide sequence in which an additional amino acid sequence is fused into the mature polypeptide (Such as a leader sequence or a secreted sequence or a sequence used to purify this polypeptide or a protease sequence)
  • such fragments, derivatives, and analogs are considered to be within the knowledge of those skilled in the art.
  • the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
  • the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a polynucleotide sequence of 3809 bases in length and its open reading frames 3388-3681 encode 97 amino acids.
  • this polypeptide has a similar expression profile with human non-integrin-metalloproteinase, and it can be inferred that the human non-integrin-metalloproteinase 10.67 has similar functions to human non-integrin-metalloproteinase .
  • the polynucleotide of the present invention may be in the form of DNA or RNA.
  • DNA forms include cDNA, genomic DNA or synthetic DNA.
  • DNA can be single-stranded or double-stranded.
  • DNA can be coding or non-coding.
  • the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
  • a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
  • the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
  • polynucleotide encoding a polypeptide refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.
  • the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
  • Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
  • an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
  • the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity between the two sequences).
  • the invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the invention under stringent conditions.
  • "strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60 ° C; or (2) A denaturant was added during hybridization, such as 50% (v / v) formamide, 0.1% calf serum / 0.1 ° /. F i co ll, 42.
  • nucleic acid fragments that hybridize to the sequences described above.
  • a "nucleic acid fragment" contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 cores Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques (such as PCR) to identify and / or isolate polynucleotides encoding human non-integrin-metalloproteinase 10.67.
  • polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
  • the specific polynucleotide sequence encoding the human non-integrin-metalloproteinase 10.67 of the present invention can be obtained by various methods.
  • polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or CDM libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
  • the DM fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genome DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.
  • genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences.
  • the standard method for isolating the cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library. There are many mature techniques for mRNA extraction. Kits are also commercially available (Q i agene).
  • the construction of cDM libraries is also a common method (Sambrook, et al., Molecluar Cl oning, A Labora tory Manual, Cold Spring Harbor Labora tory. New York, 1989).
  • Commercially available cDNA libraries are also available, such as different CDM libraries from Clontech. When combined with polymerase reaction technology, even very small expression products can be cloned.
  • genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DNA-RNA hybridization; (2) the presence or absence of a marker gene function; (3) determination of human non-integrin-metalloproteinase 10.67 transcripts (4) Detecting the protein product of gene expression by immunological techniques or measuring biological activity. The above methods can be used singly or in combination.
  • the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably Is at least 50 nucleotides, preferably at least 100 nucleotides.
  • the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
  • the probe used here is generally a DNA sequence chemically synthesized based on the gene sequence information of the present invention.
  • the genes or fragments of the present invention can of course be used as probes.
  • DM probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
  • the protein product of human non-integrin-metalloproteinase 10.67 gene expression can be detected by immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA). Wait. Amplification of DNA / RNA by PCR (Saiki, et al. Science
  • the RACE method RACE-rapid cDNA end rapid amplification method
  • the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein.
  • the amplified DM / RNA fragment can be isolated and purified by conventional methods such as by gel electrophoresis.
  • polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, the sequencing must be repeated. Sometimes it is necessary to determine the cDM sequence of multiple clones in order to splice into a full-length cDNA sequence.
  • the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using the human non-integrin-metalloproteinase 10.67 coding sequence, and the recombinant technology to produce the polypeptide of the present invention Methods.
  • a polynucleotide sequence encoding human non-integrin-metalloproteinase 10.67 may be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
  • vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses or other vectors known in the art.
  • Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al. Gene, 1987, 56: 125) expressed in bacteria; pMSXND expression vectors expressed in mammalian cells ( Lee and Nathans, J Bio Chem.
  • any plasmid and vector can be used to construct a recombinant expression vector.
  • An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
  • the DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis.
  • promoters are: the lac or trp promoter of E. coli; the PL promoter of lambda phage; eukaryotic promoters include the CMV immediate early promoter, the HSV thymidine kinase promoter, the early and late SV40 promoters, Retroviral LTRs and other known promoters that control the expression of genes in prokaryotic or eukaryotic cells or their viruses.
  • the expression vector also includes a ribosome binding site and a transcription terminator for translation initiation. Insertion of enhancer sequences into the vector will allow its transduction in higher eukaryotic cells.
  • Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription.
  • Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers on the late side of the origin of replication, and adenovirus enhancers.
  • the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • GFP fluorescent protein
  • tetracycline or ampicillin resistance for E. coli.
  • a polynucleotide encoding human non-integrin-metalloproteinase 10.67 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a genetic engineering containing the polynucleotide or the recombinant vector.
  • Host cells refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E.
  • coli Streptomyces
  • bacterial cells such as Salmonella typhimurium
  • fungal cells such as yeast
  • plant cells such as fly S2 or Sf 9
  • animal cells such as CH0, COS or Bowes melanoma cells.
  • Transformation of a host cell with a DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art.
  • the host is a prokaryote such as E. coli
  • competent cells capable of DNA uptake can be in the exponential growth phase were harvested, treated with CaC l 2 method used in steps well known in the art. The alternative is to use MgC l 2 .
  • transformation can also be performed by electroporation.
  • the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
  • polynucleotide sequence of the present invention can be used to express or produce recombinant human non-integrin-metalloproteinase 10.67 (Scence, 1984; 224: 1431). Generally, the following steps are taken:
  • the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
  • the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If desired, recombinant proteins can be isolated and purified by various separation methods using their physical, chemical, and other properties. These methods are well known to those skilled in the art.
  • These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
  • Fig. 1 is a comparison diagram of gene chip expression profiles of the human non-integrin-metalloproteinase 10.67 and human non-integrin-metalloproteinase of the present invention.
  • the upper graph is a graph of the expression profile of human non-integrin-metalloproteinase 10.67
  • the lower graph is the graph of the expression profile of human non-integrin-metalloproteinase.
  • Figure 2 shows the polyacrylamide gel electrophoresis of isolated human non-integrin-metalloproteinase 10 67
  • the determined cDNA sequence was compared with an existing public DNA sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 0602g09 was new DNA.
  • a series of primers were synthesized to determine the inserted cDNA fragments of the clone in both directions. The results show that the 0602g09 clone contains a full-length cDNA of 3809bp (as shown in SeQ ID NO: 1), and has a 293bp open reading frame (0RF) from 3388bp to 3681bp, encoding a new protein (such as Seq ID NO : Shown in 2).
  • CDM was synthesized using fetal brain cell total RNA as a template and ol igo-dT as a primer for reverse transcription reaction. After purification by Qiagene's kit, the following primers were used for PCR amplification:
  • Pr imerl 5'- GAAACTATTATTCATTGTTTTTTGAA -3 '(SEQ ID NO: 3)
  • Pr imer2 5'- ATTTGACTCTGTATTTTATTTCAA -3, (SEQ ID NO: 4)
  • Pr imerl is a forward sequence starting at lbp at the 5 ′ end of SEQ ID NO: 1;
  • Pr imer2 is the 3'-end reverse sequence in SEQ ID NO: 1.
  • Amplification conditions 50 mmol / L C1, 10 mmol / L in a 50 ⁇ l reaction volume
  • Tr is-Cl, ( ⁇ 8.5), 1.5 ol / L MgC, 200 ⁇ / L dNTP, lOpraol primer, 1U Taq DNA polymerase (Clontech).
  • the reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) under the following conditions for 25 cycles: 94 ° C 30sec; 55 ° C 30sec; 72 ° C 2min.
  • ⁇ -act in was set as a positive control and template blank was set as a negative control.
  • the amplified product was purified using a QIAGEN kit and ligated to a pCR vector (Invitrogen) using a TA cloning kit.
  • the DNA sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as 1 to 3809bp shown in SEQ ID NO: 1.
  • Example 3 Nor thern blot analysis of human non-integrin-metalloproteinase 10.67 gene expression:
  • RNA extraction in one step [Anal. Biochem 1987, 162, 156-159] 0
  • This method involves acid guanidinium thiocyanate-chloroform extraction. That is, the tissue was homogenized with 4M guanidine isothiocyanate-25mM sodium citrate, 0.2M sodium acetate ( PH 4.0), and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49 : 1), centrifuge after mixing. The aqueous layer was aspirated, isopropanol (0.8 vol) was added and the mixture was centrifuged to obtain RM precipitate. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water.
  • a 32P-labeled probe (approximately 2 x 10 6 cpm / ml) was hybridized with a nitrocellulose membrane to which RNA was transferred at 42 ° C overnight in a solution containing 50% formamide-25mM KH 2 P0 4 (pH7.4)-5 x SSC- 5 x Denhardt's solution and 200 ⁇ / ⁇ 1 salmon sperm DNA. After hybridization, place the filter at 1 x
  • Example 4 In vitro expression, isolation and purification of recombinant human non-integrin-metalloproteinase 10.67
  • Priraer3 5'-CCCCATATGATGTTCTTTCCTTTCCCTTTCAGG-3 '(Seq ID No: 5)
  • Primer4 5'-CCCGAATTCTTATTTCTTGATGTCTTCAGTCTC-3' (Seq ID No: 6)
  • These two primers contain Ndel and EcoRI restriction sites, respectively.
  • the coding sequences of the 5 'and 3' ends of the gene of interest are followed, respectively.
  • the Ndel and EcoRI restriction sites correspond to the selectivity within the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865.3). Digestion site.
  • the PCR reaction was performed using pBS-0602g09 plasmid containing the full-length target gene as a template.
  • the PCR reaction conditions were as follows: 10 pg of pBS-0602g09 plasmid was contained in a total volume of 50 ⁇ 1, and primers Primer-3 and Primer-4 were 10praol and Advantage polymerase Mix (Clontech) 1 ⁇ 1, respectively. Cycle parameters: 94 ° C 20s, 60 ° C 30s, 68 ° C 2 min, a total of 25 cycles. Ndel and EcoRI were used to double digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase.
  • the ligation product was transformed into E. coli DH5a by the calcium chloride method. After being cultured overnight on LB plates containing kanamycin (final concentration 3 ( ⁇ g / ral)), positive clones were screened by colony PCR method and sequenced. The correct positive clone (pET-0602g09) was used to transform the recombinant plasmid into E. coli BL21 (DE3) plySs (product of Novagen) by calcium chloride method.
  • NH2-Met-Phe-Phe-Pro-Phe-Pro-Phe-Arg-Thr-Leu-Gln-Thr-Val-Gly-Pro-C00 H (SEQ ID NO: 7).
  • the polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex, respectively.
  • Rabbits were immunized with 4 mg of the hemocyanin multi-month complex plus complete Freund's adjuvant, and 15 days later, the hemocyanin polypeptide complex plus incomplete Freund's adjuvant was used to boost immunity once.
  • a titer plate coated with a 15 ⁇ ⁇ / ⁇ 1 bovine serum albumin peptide complex was used as an ELISA to determine the antibody titer in rabbit serum.
  • Protein A-Sepharose separation from the rabbit serum IgG antibody positive 0 Total binding polypeptide to cyanogen bromide-activated Sepharose4B column, by affinity chromatography from total IgG isolated anti-polypeptide antibody. 67 ⁇ It was confirmed by immunoprecipitation that the purified antibody could specifically bind to human non-integrin-metalloproteinase 10.67.
  • Example 6 Application of the polynucleotide fragment of the present invention as a hybridization probe
  • the suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in various aspects.
  • the probes can be used to hybridize to the genome or CDM library of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
  • the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissues or Whether the expression in tissue cells is abnormal.
  • the purpose of this example is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method.
  • Filter hybridization methods include dot blotting, Southern blotting, Northern blotting, and copying methods. We all use the same steps to fix the polynucleotide sample to be tested on the filter and then hybridize.
  • the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer so that the non-specific binding site of the sample on the filter is saturated with the carrier and the synthesized polymer.
  • the pre-hybridization solution is then replaced with a hybridization buffer containing the labeled probe and incubated to hybridize the probe to the target nucleic acid.
  • the unhybridized probes are removed by a series of membrane washing steps.
  • This embodiment utilizes higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals.
  • the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
  • the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
  • the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained. First, the selection of the probe
  • oligonucleotide fragments from the polynucleotide SEQ ID NO: 1 of the present invention for use as hybridization probes should follow the following principles and several aspects to be considered:
  • the preferred range of probe size is 18-50 nucleotides
  • Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements The regions are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, then the primary probe should not be used;
  • Probe l which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
  • Probe 2 (probe2), which belongs to the second type of probe, is equivalent to the replacement mutant sequence (41Nt) of the gene fragment of SEQ ID NO: 1 or its complementary fragment:
  • step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
  • NC membrane nitrocellulose membrane
  • Two NC membranes are required for each probe, so that it can be used in subsequent experiments.
  • the film is washed with high-strength conditions and strength conditions, respectively.
  • Gene chip or gene microarray is a new technology that many national laboratories and large pharmaceutical companies are currently developing and developing. It refers to the orderly and high-density arrangement of a large number of target gene fragments on glass, The data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software to achieve the purpose of rapid, efficient, and high-throughput analysis of biological information.
  • the polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research of new gene functions; searching for and screening new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases .
  • the specific method steps have been reported in the literature, for example, see the literature DeRi s i, L L., Lyer, V. & Brown, P. 0.
  • Total mRNA was extracted from human mixed tissues and specific tissues (or stimulated cell lines) using a one-step method, and the mRNA was purified using Oligotex mRNA Midi Kit (purchased from QiaGen).
  • the fluorescent test J Cy3dUTP (5 ⁇ Amino-propargyl-2'-deoxyur idine 5'-tr iphate coupled to Cy3 f luorescent dye, purchased from Amersham Phamacia Biotech) was used to label the mRNA of human mixed tissue, and the fluorescent reagent Cy5dUTP (5-Amino-propargyl-2'-deoxyur idine 5'-triphate coupled to Cy5 f luorescent dye, purchased from Amersham Phamac ia Biotech) Marks the body's specific tissues (or stimulated cell lines) mRNA, which is prepared after purification Probe.
  • Cy3dUTP 5 ⁇ Amino-propargyl-2'-deoxyur idine 5'-tr
  • Hybridization was performed in a Solut ion (purchased from TeleChem) hybridization solution for 16 hours, and then washed with a washing solution (lx SSC, 0.2 SDS) at room temperature, and then scanned with a ScanArray 3000 scanner (purchased by General Scanning, USA).
  • the scanned image Imagene software (Biodiscovery, USA) was used for data analysis and processing to calculate the Cy3 / Cy5 ratio of each point.
  • the above specific tissues are fetal brain, bladder mucosa, and PMA +
  • Ecv304 cell line LPS + Ecv304 cell line thymus, normal fibroblasts 1024NC, Fibroblas t, growth factor stimulation, 1024NT, scar into fc growth factor stimulation, 1013HT, scar into fc without growth factor stimulation, 1013HC, bladder cancer construct Cells EJ, bladder cancer, bladder cancer, liver cancer, liver cancer cell lines, placenta, spleen, prostate cancer, jejunal adenocarcinoma, cardia cancer. Draw a graph based on these 18 Cy3 / Cy5 ratios. (figure 1 ). It can be seen from the figure that the expression profile of human non-integrin-metalloproteinase 10.67 and human non-integrin-metalloproteinase according to the present invention are very similar. Industrial applicability
  • polypeptides of the present invention as well as antagonists, agonists and inhibitors of the polypeptides, can be directly used in the treatment of diseases, for example, they can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection, and immune diseases.
  • MADM Human non-integrin-metalloproteinase
  • the expression profile of the polypeptide of the present invention is consistent with the expression profile of human non-integrin-metalloproteinase (MA belly), and both have similar biological functions.
  • the polypeptide of the present invention participates in the process of extracellular protein metabolism in vivo. Abnormal expression of the polypeptide can lead to disturbance of protein metabolism, and then cause the occurrence of related diseases. These diseases include, but are not limited to:
  • Protein peptide hormone dysfunction can cause the following diseases:
  • Insulin and glucagon diabetes, hypoglycemia, etc .;
  • hypothalamus and pituitary hormones Giant disease, dwarfism, acromegaly, Cortisol syndrome (Cushing's syndrome), primary hyperaldosteronism, secondary chronic adrenal insufficiency, hyperthyroidism Hypothyroidism (stingle disease, juvenile hypothyroidism, adult hypothyroidism), male / female infertility, menstrual disorders (functional uterine bleeding, amenorrhea, polycystic ovary syndrome, premenstrual tension syndrome, Menopause syndrome), sexual development disorder, diabetes insipidus, improper antidiuretic hormone secretion syndrome, abnormal lactation, etc. 3) Parathyroid hormone: hyperparathyroidism, hypoparathyroidism, etc .;
  • Gastrointestinal hormones peptic ulcer, chronic indigestion, chronic gastritis, etc .;
  • Arrhythmia shock, insanity, epilepsy, chorea, hepatic encephalopathy (norepinephrine, Y-aminobutyric acid, serotonin, glutamine), motion sickness, I-type allergic disease (Net Measles, hay fever, allergic rhinitis, skin allergies), peptic ulcer (histamine), hypercholesterolemia (taurine), tumors (polyamines), etc .;
  • hemoglobin diseases anemia, jaundice, tissue-induced organic acidemia due to hypoxia
  • various coagulation factor deficiency bleeding
  • muscle spasms muscle forcing
  • muscle paralysis actin
  • hyperlipoproteinemia etc.
  • the expression profile of the polypeptide of the present invention is consistent with the expression profile of human non-integrin-metalloproteinase (MADM), and both have similar biological functions.
  • the polypeptide of the present invention participates in the process of extracellular protein metabolism in vivo, and its abnormal expression can cause the body to inactivate some abnormal proteins, and then cause related diseases, including but not limited to: histiocytoma, lymphoma, colon Cancer, lung cancer, retinoblastoma, etc .;
  • polypeptide of the present invention and the antagonist, agonist and inhibitor of the polypeptide can be directly used for the treatment of various diseases, such as diseases related to protein metabolism disorders, various tumor diseases, and the like.
  • the invention also provides a method for screening compounds to identify agents that increase (agonist) or suppress (antagonist) human non-integrin-metalloproteinase 1 0.67.
  • Agonists enhance human non-integrin-metalloproteinase 10.67 to stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
  • mammalian cells or membrane preparations expressing human non-integrin-metalloproteinase 10.67 can be cultured with labeled human non-integrin-metalloproteinase 10.67 in the presence of a drug. The ability of the drug to increase or block this interaction is then determined. '
  • Antagonists of human non-integrin-metalloproteinase 10.67 include screened antibodies, compounds, receptor deletions, and the like. Antagonist of human non-integrin-metalloproteinase 10.67 can bind to human non-integrin-metalloproteinase 10.67 and eliminate its function, or inhibit the production of the polypeptide, or with the active site of the polypeptide Binding prevents the polypeptide from functioning biologically.
  • human non-integrin-metalloproteinase 10.67 When screening compounds as antagonists, human non-integrin-metalloproteinase 10.67 can be added to the bioanalytical assay, and by measuring the compounds against human non-integrin-metalloproteinase 10.67 and their receptors, Effect to determine whether a compound is an antagonist. Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds. Polypeptide molecules capable of binding to human non-integrin-metalloproteinase 10.67 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. During screening, the human non-integrin-metalloproteinase 1 0.67 molecule should generally be labeled.
  • the present invention provides a method for producing an antibody using a polypeptide, a fragment, a derivative, an analog thereof, or a cell thereof as an antigen.
  • These antibodies can be polyclonal or monoclonal antibodies.
  • the invention also provides antibodies directed against the human non-integrin-metalloproteinase 10.67 epitope. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by Fab expression libraries.
  • Polyclonal antibodies can be produced by injecting human non-integrin-metalloproteinase 10.67 directly into immunized animals (such as rabbits, mice, rats, etc.).
  • immunized animals such as rabbits, mice, rats, etc.
  • adjuvants can be used to enhance the immune response, including It is not limited to Freund's adjuvant and the like.
  • Techniques for preparing human non-integrin-metalloproteinase 10.67 monoclonal antibodies include, but are not limited to, hybridoma technology (Kohler and Miste in. Nature, 1975, 256: 495-497), triple tumor technology, human Beta-cell hybridoma technology, EBV-hybridoma technology, etc.
  • Chimeric antibodies that bind human constant regions to non-human variable regions can be produced using existing techniques (Morr i son et
  • Antibodies against human non-integrin-metalloproteinase 10.67 can be used in immunohistochemical techniques to detect human non-integrin-metalloproteinase 1 0.67 in biopsy specimens.
  • Monoclonal antibodies that bind to human non-integrin-metalloproteinase 10.67 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
  • Antibodies can also be used to design immunotoxins against a specific bead site in the body.
  • human non-integrin-metal protease 1 0.67 high affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
  • a common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
  • This hybrid antibody can be used to kill human non-integrin-metalloproteinase 10. 67 positive cells.
  • the antibodies of the present invention can be used to treat or prevent human non-integrin-metalloproteinase 10.67-related diseases. Administration of appropriate doses of antibodies can stimulate or block the production or activity of human non-integrin-metalloproteinase 10.67.
  • the invention also relates to a diagnostic test method for quantitatively and locally detecting the level of human non-integrin-metalloproteinase 10.67.
  • tests are well known in the art and include FISH assays and radioimmunoassays.
  • the level of human non-integrin-metalloproteinase 10.67 detected in the test can be used to explain the importance of human non-integrin-metalloproteinase 10.67 in various diseases and to diagnose human non-integrin-metal Diseases where Protease 10. 67 works.
  • polypeptide of the present invention can also be used for peptide mapping analysis.
  • the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry.
  • the polynucleotide encoding human non-integrin-metalloproteinase 10.67 can also be used for a variety of therapeutic purposes.
  • Gene therapy technology can be used to treat abnormal cell proliferation, development, or metabolism caused by the non-expression or abnormal / inactive expression of human non-integrin-metalloproteinase 10.67.
  • Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated human non-integrin-metalloproteinase 10.67 to inhibit endogenous human non-integrin-metalloproteinase 10.67 activity.
  • a variant human non-integrin-metalloproteinase 10.67 may be a shortened human non-integrin-metalloproteinase without the signaling domain 10.67, although it can bind to downstream substrates, it lacks signaling activity. Therefore, the recombinant gene therapy vector can be used to treat diseases caused by abnormal expression or activity of human non-integrin-metalloproteinase 10.67.
  • Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus and the like can be used to transfer a polynucleotide encoding human non-integrin-metalloproteinase 10.67 into cells.
  • recombinant viral vectors carrying a polynucleotide encoding human non-integrin-metalloproteinase 10.67 can be found in existing literature (Sambrook, et al.).
  • a recombinant polynucleotide encoding human non-integrin-metalloproteinase 10.67 can be packaged into liposomes and transferred into cells.
  • Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
  • a vector such as a virus, phage, or plasmid
  • Oligonucleotides (including antisense RNA and DNA) that inhibit human non-integrin-metalloproteinase 10.67 raRNA and ribozymes are also within the scope of the present invention.
  • a ribozyme is an enzyme-like RNA molecule that specifically decomposes specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation.
  • Antisense RM, DNA and ribozymes can be obtained by any existing RNA or DNA synthesis technology, such as the solid-phase phosphate amide chemical synthesis method for oligonucleotide synthesis.
  • Antisense RM molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA. This DNA sequence is integrated downstream of the RNA polymerase promoter of the vector. In order to increase the stability of the nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the linkage between ribonucleosides using phosphate thioester or peptide bonds instead of phosphodiester bonds.
  • the polynucleotide encoding human non-integrin-metalloproteinase 10.67 can be used for the diagnosis of diseases related to human non-integrin-metalloproteinase 10.67.
  • the polynucleotide encoding human non-integrin-metalloproteinase 10.67 can be used to detect the expression of human non-integrin-metalloproteinase 10.67 or abnormal expression of human non-integrin-metalloproteinase 10.67 in a disease state.
  • a DNA sequence encoding human non-integrin-metalloproteinase 10.67 can be used to hybridize biopsy specimens to determine the expression of human non-integrin-metalloproteinase 10.67.
  • Hybridization techniques include Southern blotting, Northern blotting, in situ hybridization, and the like. These techniques and methods are publicly available and mature, and related kits are available commercially.
  • a part or all of the polynucleotides of the present invention can be used as probes to be fixed on a microarray or a DNA chip (also called a "gene chip") for analyzing differential expression analysis and gene diagnosis of genes in tissue.
  • Human non-integrin-metalloproteinase 10.67 specific primers for RNA-polymerase chain reaction (RT-PCR) in vitro amplification can also detect human non-integrin-metalloproteinase 10.67 transcripts.
  • Detection of mutations in the human non-integrin-metalloproteinase 10.67 gene can also be used to diagnose human non-integrin-metalloproteinase 10.67-related diseases.
  • Human non-integrin-metalloproteinase 10.67 mutant form Including point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type human non-integrin-metalloproteinase 10.67 DNA sequence. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression. Therefore, Northern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
  • the sequences of the invention are also valuable for chromosome identification.
  • the sequence specifically targets a specific position on a human chromosome and can hybridize to it.
  • specific sites for each gene on the chromosome need to be identified.
  • only a few chromosome markers based on actual sequence data are available for marking chromosome positions.
  • an important first step is to locate these DNA sequences on a chromosome.
  • a PCR primer (preferably 15-35bp) is prepared from the cDNA, and the sequence can be located on the chromosome. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
  • PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
  • oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
  • Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.
  • Fluorescent in situ hybridization of cDM clones with metaphase chromosomes allows precise chromosomal localization in one step.
  • FISH Fluorescent in situ hybridization
  • the physical location of the sequence on the chromosome can be correlated with the genetic map data. These data can be found in, for example, V. Mckusick, Mende l ian
  • the differences in cDNA or genomic sequences between the affected and unaffected individuals need to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in the chromosome, such as deletions or translocations that are visible at the chromosomal level or detectable using cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution Capacity and each 20kb corresponds to a gene).
  • the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
  • suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
  • the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients that do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
  • the present invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the present invention.
  • a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the present invention.
  • these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which reminders permit their administration on the human body by government agencies that manufacture, use, or sell them.
  • the polypeptide of the present invention can be used in combination with other therapeutic compounds.
  • the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
  • Human non-integrin-metalloproteinase 1 0.67 is administered in an amount effective to treat and / or prevent a specific indication.
  • the amount and range of human non-integrin-metalloproteinase 10.67 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Medicinal Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Health & Medical Sciences (AREA)
  • Biomedical Technology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Public Health (AREA)
  • Molecular Biology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Biotechnology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Microbiology (AREA)
  • Veterinary Medicine (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

L'invention concerne un nouveau polypeptide, une désintégrine-métalloprotéase humaine 10.67, et un polynucléotide codant ce polypeptide ainsi qu'un procédé d'obtention de ce polypeptide par des techniques recombinantes d'ADN. L'invention concerne en outre les applications de ce polypeptide dans le traitement de maladies, notamment de maladies liées aux troubles du métabolisme des protéines et de toutes sortes de tumeurs. L'invention concerne aussi l'antagoniste agissant contre le polypeptide et son action thérapeutique ainsi que les applications de ce polynucléotide codant la désintégrine-métalloprotéase humaine 10.67.
PCT/CN2001/000994 2000-06-19 2001-06-18 Nouveau polypeptide, desintegrine-metalloprotease humaine 10.67, et polynucleotide codant ce polypeptide WO2002012306A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU95387/01A AU9538701A (en) 2000-06-19 2001-06-18 A novel polypeptide-the human non-integrin metalloprotease 10.67 and the polynucleotide encoding said polypeptide

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN00116596.8 2000-06-19
CN00116596A CN1329167A (zh) 2000-06-19 2000-06-19 一种新的多肽——人非整合蛋白－金属蛋白酶10.67和编码这种多肽的多核苷酸

Publications (1)

Publication Number Publication Date
WO2002012306A1 true WO2002012306A1 (fr) 2002-02-14

Family

ID=4586000

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2001/000994 WO2002012306A1 (fr) 2000-06-19 2001-06-18 Nouveau polypeptide, desintegrine-metalloprotease humaine 10.67, et polynucleotide codant ce polypeptide

Country Status (3)

Country Link
CN (1) CN1329167A (fr)
AU (1) AU9538701A (fr)
WO (1) WO2002012306A1 (fr)

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1997045447A1 (fr) * 1996-05-31 1997-12-04 The Scripps Research Institute PROCEDES ET COMPOSITIONS SERVANT A L'INHIBITION DE L'ANGIOGENESE LIEE A LA PRESENCE DE αvβ¿5?

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1997045447A1 (fr) * 1996-05-31 1997-12-04 The Scripps Research Institute PROCEDES ET COMPOSITIONS SERVANT A L'INHIBITION DE L'ANGIOGENESE LIEE A LA PRESENCE DE αvβ¿5?

Also Published As

Publication number Publication date
CN1329167A (zh) 2002-01-02
AU9538701A (en) 2002-02-18

Similar Documents

Publication Publication Date Title
WO2002026796A1 (fr) Nouveau polypeptide, recepteur humain 14.3 d'hormone de croissance, et polynucleotide codant ce polypeptide
WO2002012306A1 (fr) Nouveau polypeptide, desintegrine-metalloprotease humaine 10.67, et polynucleotide codant ce polypeptide
WO2001083538A1 (fr) Nouveau polypeptide, proteine humaine 36 du gene k-ras, et polynucleotide codant pour ce polypeptide
WO2002040523A1 (fr) Nouveau polypeptide, glutaryl-coa deshydrogenase humaine 15.51, et polynucleotide codant ce polypeptide
WO2002000824A2 (fr) Nouveau polypeptide, proteine humaine 10.56 du gene cancerigene tre, et polynucleotide codant ce polypeptide
WO2001071003A1 (fr) Nouveau polypeptide, serine protease humaine 8, et polynucleotide codant pour ce polypeptide
WO2002012297A1 (fr) Nouveau polypeptide, proteine humaine 9 de liaison a la tropomoduline, et polynucleotide codant ce polypeptide
WO2002040525A1 (fr) Nouveau polypeptide, proteine humaine a doigt de zinc 18.92, et polynucleotide codant ce polypeptide
WO2001075048A2 (fr) Nouveau polypeptide, proteine ribosomale humaine s11 23, et polynucleotide codant pour ce polypeptide
WO2001083540A1 (fr) Nouveau polypeptide, kiaa0883-44, et polynucleotide codant pour ce polypeptide
WO2001085752A1 (fr) Polynucleotide codant un peptide de myosine
WO2001092541A1 (fr) Nouveau polypeptide, catalase 12, et polynucleotide codant ce polypeptide
WO2002012458A1 (fr) Nouveau polypeptide, desintegrine-metalloprotease humaine 11.11, et polynucleotide codant ce polypeptide
WO2002026794A1 (fr) Nouveau polypeptide, proteine ribosomale humaine l7a20.57, et polynucleotide codant ce polypeptide
WO2001077165A1 (fr) Nouveau polypeptide, proteine humaine de liaison 12 d'une proteine precurseur de l'amyloide, et polynucleotide codant pour ce polypeptide
WO2001072802A1 (fr) Nouveau polypeptide, proteine humaine de liaison 14 d'une proteine precurseur de l'amyloide, et polynucleotide codant pour ce polypeptide
WO2001073041A1 (fr) Nouveau polypeptide, adn ligase humaine 15, et polynucleotide codant pour ce polypeptide
WO2001075024A2 (fr) Nouveau polypeptide, facteur humain 13 associe a nf-e2, et polynucleotide codant pour ce polypeptide
WO2001047973A1 (fr) Nouveau polypeptide, proteine 14 associee a la vesicule a gaz, et polynucleotide codant pour ce polypeptide
WO2002026971A1 (fr) Nouveau polypeptide, facteur de transcription humain lcr-f112.1, et polynucleotide codant ce polypeptide
WO2001090131A1 (fr) Nouveau polypeptide, proteine humaine 10.56 du gene cancerigene tre, et polynucleotide codant ce polypeptide
WO2001078755A2 (fr) Nouveau polypeptide, proteine humaine de mutation 9 de l'ataxie-telangiectasie, et polynucleotide codant pour ce polypeptide
WO2002026952A1 (fr) Nouveau polypeptide, serine/threonine proteine kinase humaine 11.22, et polynucleotide codant ce polypeptide
WO2001090171A1 (fr) Nouveau polypeptide, proteine humaine ribosomale sii 12, et polynucleotide codant ce polypeptide
WO2002020604A1 (fr) Nouveau polypeptide, proteine humaine 11 associee a l'arn a double helice, et polynucleotide codant ce polypeptide

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP