WO2002012458A1 - Nouveau polypeptide, desintegrine-metalloprotease humaine 11.11, et polynucleotide codant ce polypeptide - Google Patents

Nouveau polypeptide, desintegrine-metalloprotease humaine 11.11, et polynucleotide codant ce polypeptide Download PDF

Info

Publication number
WO2002012458A1
WO2002012458A1 PCT/CN2001/000990 CN0100990W WO0212458A1 WO 2002012458 A1 WO2002012458 A1 WO 2002012458A1 CN 0100990 W CN0100990 W CN 0100990W WO 0212458 A1 WO0212458 A1 WO 0212458A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
polynucleotide
integrin
metalloproteinase
human non
Prior art date
Application number
PCT/CN2001/000990
Other languages
English (en)
Chinese (zh)
Inventor
Yumin Mao
Yi Xie
Original Assignee
Biowindow Gene Development Inc. Shanghai
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Biowindow Gene Development Inc. Shanghai filed Critical Biowindow Gene Development Inc. Shanghai
Priority to AU93625/01A priority Critical patent/AU9362501A/en
Publication of WO2002012458A1 publication Critical patent/WO2002012458A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/48—Hydrolases (3) acting on peptide bonds (3.4)
    • C12N9/50—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25)
    • C12N9/64—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue
    • C12N9/6421—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue from mammals
    • C12N9/6489—Metalloendopeptidases (3.4.24)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • the present invention belongs to the field of biotechnology. Specifically, the present invention describes a new polypeptide, a human non-integrin-metalloproteinase 11.11, and a polynucleotide sequence encoding the polypeptide. The invention also relates to methods and applications for preparing such polynucleotides and polypeptides. Background technique
  • Leukase is involved in extracellular protein metabolism and can be divided into two functional families. Matrix-degraded metalloproteinases (gluease, gelatinase, and stromelysin) are secreted into the extracellular space as a pre-latent form, where they are activated by restricted proteolysis. Matrix activity is tightly controlled at synthetic levels, usually lower and induced by cytokines and other substances, and can also be induced by integrative compounds that combine with specific extracellular protein inhibitors (Nagase, H. and Salvesen, G. ( 1993) in Innovations in Proteases and their Inhibitors (Aviles, FX, ed.), Pp. 315-332, Walter de Gruyter, Berlin).
  • the second mammalian metalloproteinase family is a membrane integrin, which also includes endopeptidases 24.1UE24.11), endothelin-converting peptide converting enzyme (BCE) and meprin, E24. Ll and ECE and prokaryotic thermosporin proteases With similar active sites, meprin is a member of the metal protein astaxanthin, a zinc-containing endopeptidase family.
  • the substrates of E24.11 and ECE are relatively small peptides. Meprin can act on larger proteins and degrade extracellular matrix components.
  • Defects in extracellular protein metabolism are important for a variety of diseases such as histiocytoma, lymphoma, colon cancer, lung cancer, and retinoblastoma, and metalloproteinases can be used to form therapies that target targets to insert appropriate inhibitors .
  • MADM mammalian non-integrated metalloproteinase
  • This protein contains extracellular metalloproteinases and non-integrated regions, a transmembrane helix, and a basic / proline-rich cytoplasmic C- end.
  • MADM has a long relationship with members of the reprolysin protein family, which includes snake venom non-integrated metalloproteinases and some cell surface non-integrated mammalian proteins.
  • the proteolytic enzyme region of MADM contains an extended zinc-binding site HEVGHNFGSPH, followed by a non-integrated cysteine-rich region. This cysteine-rich region consists of a 19 amino acid fragment and a transmembrane. Spiral connection (Howard, L., Lu, X., Mitchell, S., Griffiths, S. and Glynn, P., Bioc em. J. 317 (Pt 1), 45-50 (1996)).
  • the human non-integrin-metalloproteinase 11.11 protein plays an important role in regulating important functions of the body such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes, so there has been a need in the art Identification of more human non-integrin-metalloproteinase 11.1 1 proteins involved in these processes, especially the amino acid sequence of this protein. Newcomer non-integrin-metalloproteinase 11. 11 The isolation of protein-coding genes also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic agents for diseases, so it is important to isolate its coding DM. Disclosure of invention
  • Another object of the invention is to provide a polynucleotide encoding the polypeptide.
  • Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding a human non-integrin-metalloproteinase 11.11.
  • Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding a human non-integrin-metalloproteinase 11.11.
  • Another object of the present invention is to provide a method for producing human non-integrin-metalloproteinase 11.11.
  • Another object of the present invention is to provide antibodies against the polypeptide-human non-integrin-metalloproteinase 11.11 of the present invention.
  • Another object of the present invention is to provide mimic compounds, antagonists, agonists, and inhibitors of the polypeptide of the present invention-human non-integrin-metalloproteinase 11.11.
  • Another object of the present invention is to provide a method for diagnosing and treating diseases associated with the human non-integrin-metalloproteinase II.11 abnormality.
  • the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
  • the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the present invention also relates to an isolated polynucleotide comprising a nucleotide sequence selected from the group consisting of: Its variant:
  • the polynucleotide sequence of (a) or (b) has at least 70. /. Identical polynucleotides.
  • sequence of the polynucleotide is one selected from the group consisting of: (a) having SEQ ID NO: 1
  • the present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
  • the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
  • the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of human non-integrin-metalloproteinase 11.11 protein, which comprises utilizing the polypeptide of the invention.
  • the invention also relates to compounds obtained by this method.
  • the present invention also relates to a method for in vitro detection of a disease or susceptibility to disease associated with abnormal expression of a human non-integrin-metalloproteinase 11.11 protein, comprising detecting mutations in the polypeptide or a polynucleotide sequence encoding the same in a biological sample. Or detecting the amount or biological activity of a polypeptide of the invention in a biological sample.
  • the invention also relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
  • the present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention in the preparation of a medicament for the treatment of cancer, developmental disease or immune disease or other diseases caused by abnormal expression of human non-integrin-metalloproteinase 11.11 .
  • Nucleic acid sequence refers to oligonucleotides, nucleotides or polynucleotides and fragments or parts thereof, and may also refer to the genome or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
  • amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
  • amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
  • a protein or polynucleotide “variant” refers to an amino acid sequence having one or more amino acids or nucleotide changes, or a polynucleotide sequence encoding it.
  • the changes may include amino acid sequences or nucleotides A deletion, insertion, or substitution of an amino acid or nucleotide in a sequence.
  • Variants may have "conservative" changes in which the substituted amino acid has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine.
  • Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
  • “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
  • Insertion refers to an alteration in the amino acid sequence or nucleotide sequence that results in an increase in one or more amino acids or nucleotides compared to a naturally occurring molecule.
  • Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
  • Bioly active refers to a protein with the scab, regulatory, or biochemical function of a natural molecule.
  • immunologically active refers to the ability of a natural, recombinant, or protein to induce a specific immune response in a suitable animal or cell to bind to a specific antibody.
  • An "agonist” refers to a molecule that can cause changes in the protein and thereby regulate the activity of the protein when combined with human non-integrin-metalloproteinase 11.1 1-.
  • Agonists can include proteins, nucleic acids, carbohydrates, or any other molecule that can bind to human non-integrity 4. Protein-metalloproteinases 11. 11.
  • Antagonist refers to a biological activity or immunological activity that can block or modulate human non-integrin-metalloproteinase 11.11 when combined with human non-integrin-metalloproteinase 11.11 Molecule.
  • Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates, or any other molecule that can bind human non-integrin-metalloproteinase 11.11.
  • Regular refers to a change in the function of human non-integrin-metalloproteinase 11.11, including an increase or decrease in protein activity, changes in knot characteristics, any other biological properties of human non-integrin-metalloproteinase 11.11, Changes in functional or immune properties.
  • substantially pure ' means substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated.
  • Those skilled in the art can purify human non-integrin-metalloproteinases using standard protein purification techniques.
  • “Complementary” or “complementarity” refers to the natural knotting of polynucleotides by base pairing under conditions of acceptable salt concentration and temperature.
  • the sequence "C-T-G-A” can be combined with the complementary sequence "G-A-C-T”.
  • the complementarity between two single-stranded molecules may be partial or complete.
  • the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
  • “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
  • Partial homology refers to a partially complementary sequence that at least partially inhibits the hybridization of a completely complementary sequence to a target nucleic acid. Pay. The inhibition of such hybridization can be detected by performing hybridization (Southern blotting or Nor thern blotting, etc.) under conditions of reduced stringency. Substantially homologous sequences or hybridization probes can compete and inhibit the binding of completely homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.
  • Percent identity refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALIGN program (Las ergene sof tware package, DNASTAR, Inc., Madis on Wi s.). The MEGALIGN program can compare two or more sequences according to different methods such as the Clus ter method (Higgins, DG and PM Sharp (1988) Gene 73: 237-244). 0 The Cluster method checks all pairs The distances of each group are arranged into clusters. The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula:
  • the number of residues in sequence A-the number of spacer residues in sequence A-the number of spacer residues in sequence B can also be determined by the Clus ter method or by a method well known in the art Methods such as Jotun He in determine the percent identity between nucleic acid sequences (He in J., (1990) Methods in emzumology 183: 625-645) 0 "Similarity" refers to the amino acid residues at the corresponding positions when the amino acid sequences are aligned. The degree of identical or conservative substitution of the radical.
  • Amino acids used for conservative substitutions may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
  • Antisense refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence.
  • Antisense strand refers to a nucleic acid strand that is complementary to a “sense strand.”
  • Derivative refers to a chemical modification of HFP or a nucleic acid encoding it. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
  • Antibody refers to a complete antibody molecule and its fragments, such as Fa,? ( ⁇ ') 2 and? It can specifically bind to the epitope of human non-integrin-metalloproteinase 11.11.
  • Humanized antibody means that the amino acid sequence of a non-antigen-binding region is replaced with a human antibody Antibodies that are similar but still retain the original binding activity.
  • isolated refers to the removal of a substance from its original environment (for example, its natural environment if it is naturally occurring).
  • a naturally-occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
  • Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not part of its natural environment, they are still isolated.
  • isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
  • polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances in the natural state .
  • isolated human non-integrin-metalloproteinase 11.11 means human non-integrin-metalloproteinase 11.11 is substantially free of other proteins, lipids, carbohydrates or other substances with which it is naturally associated. Those skilled in the art can purify human non-integrin-metalloproteinase '11.11 using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. Human non-integrin-metalloproteinase 11. The purity of the peptide can be analyzed by amino acid sequence.
  • the present invention provides a new polypeptide, human non-integrin-metalloproteinase 11.11, which is basically composed of the amino acid sequence shown in SEQ ID NO: 2.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
  • the polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques. Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
  • the invention also includes fragments, derivatives and analogs of human non-integrin-metalloproteinase 11.11.
  • fragment refers to a polypeptide that substantially maintains the same biological function or activity of the human non-integrin-metalloproteinase 11.11 of the present invention.
  • a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution
  • the amino acid may or may not be encoded by a genetic codon; or ( ⁇ ) such a type in which one or more amino acid residues are substituted with other groups to include a substituent; or (III) such One, in which the mature polypeptide is fused with another compound (such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol); or (IV) one in which the additional amino acid sequence is fused Polypeptide sequences (such as leader sequences or secreted sequences or sequences used to purify this polypeptide) formed by incorporation into mature polypeptides.
  • Such fragments, derivatives and analogs are considered by those skilled in the art through the description herein. Within the scope of knowledge.
  • the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
  • the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a 3380 base polynucleotide sequence, and its open reading frame 2254-2559 encodes 101 amino acids.
  • this peptide has a similar expression profile to human non-integrin-metalloproteinase, and it can be inferred that the human non-integrin-metalloproteinase 11.11 has similar functions to human non-integrin-metalloproteinase.
  • the polynucleotide of the present invention may be in the form of DNA or RNA.
  • DNA forms include cDNA, genomic DNA, or synthetic DNA.
  • DNA can be single-stranded or double-stranded.
  • DNA can be coding or non-coding.
  • the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
  • a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 in the present invention, but which differs from the coding region sequence shown in SEQ ID NO: 1.
  • the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
  • polynucleotide encoding a polypeptide means a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.
  • the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
  • Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
  • an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
  • the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity between the two sequences).
  • the invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the invention under stringent conditions.
  • "strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60 ° C; or (2) Add a denaturant during hybridization, such as 50 ° /.
  • polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
  • nucleic acid fragments that hybridize to the sequences described above.
  • a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 cores. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques (such as PCR) to identify and / or isolate polynucleotides encoding human non-integrin-metalloproteinase 11. 1 1.
  • polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
  • the specific polynucleotide sequence encoding the human non-integrin-metalloproteinase 11.11 of the present invention can be obtained by various methods.
  • polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
  • the DM fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the DM of the genome; 2) chemically synthesizing the DM sequence to obtain the double-stranded DNA of the polypeptide.
  • genomic DNA isolation is the least commonly used. Direct chemical synthesis of DM sequences is often the method of choice.
  • the more commonly used method is the isolation of cDNA sequences.
  • the standard method for isolating the cDNA of interest is to isolate raRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library.
  • mRM plasmid or phage cDNA library.
  • kits are also commercially available (Qi agene;).
  • construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manua, Co. Harbor Labora tory. New York, 1989).
  • Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When combined with polymerase reaction technology, even very small expression products can be cloned.
  • genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DM-DNA or DNA-RNA hybridization; (2) the presence or absence of marker gene functions; (3) determination of human non-integrin-metalloproteinase 1 1. 11 transcripts (4) Detecting the protein product of gene expression by immunological techniques or measuring biological activity. The above methods can be used alone or in combination.
  • the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
  • the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
  • the probes used here are usually the gene sequence information of the present invention Based on the chemically synthesized DM sequence.
  • the genes or fragments of the present invention can of course be used as probes.
  • DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
  • the human non-integrin-metalloproteinase 11.11 gene expression protein can be detected by immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA).
  • immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA).
  • a method for amplifying DNA / RNA using PCR technology is preferably used to obtain the gene of the present invention.
  • the RACE method RACE-Rapid Amplification of cDNA Ends
  • the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Select and synthesize using conventional methods.
  • the amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
  • polynucleotide sequence of the gene of the present invention, or various DNA fragments, etc. obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDM sequence, the sequencing must be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
  • the present invention also relates to a vector comprising a polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using a human non-integrin-metalloproteinase 11.11 coding sequence, and recombinant technology to produce the present invention Said method of polypeptide.
  • a polynucleotide sequence encoding human non-integrin-metalloproteinase 11.11 can be inserted into a vector to form a recombinant vector containing the polynucleotide of the present invention.
  • vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
  • Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al.
  • any plasmid and vector can be used to construct a recombinant expression vector.
  • An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
  • Methods known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding human non-integrin-metalloproteinase 11.11 and appropriate transcriptional / translational regulatory elements. These methods include in vitro recombinant DNA technology, DNA synthesis technology, and in vivo recombination technology (Sambroook, et al. Mol ecular Cloning, a Laboratory Manua l, cold Spring Harbor Laboratory. New York, 1989) 0 DNA sequence may be operably linked to an appropriate promoter in the expression vector, to direct mRNA synthesis. Representative examples of these promoters are: l ac or trp promoter of E.
  • the expression vector also includes a ribosome binding site and a transcription terminator for translation initiation. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers on the late side of the origin of replication, and adenoviral enhancers.
  • the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • GFP fluorescent protein
  • tetracycline or ampicillin resistance for E. coli.
  • a polynucleotide encoding human non-integrin-metalloproteinase 11.11 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to form a genetic engineering containing the polynucleotide or the recombinant vector.
  • Host cell refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell.
  • Escherichia coli, Streptomyces bacterial cells such as Salmonella typhimurium
  • fungal cells such as yeast
  • plant cells insect cells
  • fly S2 or Sf 9 animal cells
  • animal cells such as CH0, COS or Bowes melanoma cells.
  • Transformation of a host cell with the DM sequence of the present invention or a recombinant vector incorporating the DM sequence can be performed by conventional techniques well known to those skilled in the art.
  • the host is a prokaryote such as E. coli
  • competent cells capable of absorbing DNA can be harvested after the exponential growth phase and treated with the ( 12 method, the steps used are well known in the art.
  • MgCl 2 can be used.
  • transformation can also be performed by electroporation.
  • the host is a eukaryote, the following MA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposomes ⁇ Installed and so on.
  • the polynucleotide sequence of the present invention can be used to express or produce recombinant human non-integrin-metalloproteinase 1 1. 11 (Scence, 1984; 224: 1431). Generally speaking, there are the following steps:
  • the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
  • a suitable method such as temperature conversion or chemical induction
  • the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell.
  • recombinant proteins can be separated and purified by various separation methods using their physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
  • conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography
  • FIG. 1 is a comparison diagram of gene chip expression profiles of the human non-integrin-metalloproteinase 11.11 and human non-integrin-metalloproteinase of the present invention.
  • the upper graph is a graph of the expression profile of human non-integrin-metalloproteinase 11.11
  • the lower graph is the graph of the expression profile of human non-integrin-metalloproteinase.
  • Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of isolated human non-integrin-metalloproteinase 11.11.
  • l lkDa is the molecular weight of the protein.
  • the arrow indicates the isolated protein band.
  • Human fetal brain total MA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform.
  • Poly (A) mRNA 2ug po ly (A) mRM was isolated from total RNA using Quik raRNA I solat ion Kit (product of Qiegene) to form cDNA by reverse transcription.
  • the Smart cDNA cloning kit purchased from Clontech was used to insert the cDNA fragment into the multiple cloning site of the pBSK (+) vector (Clontech) to transform DH5 ⁇ , and the bacteria formed a cDNA library.
  • Dye terminate cycle react ion sequencing kit Perkin-Elmer
  • ABI 377 automatic sequencer Perkin-Elmer
  • cMA sequence of one of the clones 0502gl1
  • a series of primers were synthesized to determine the inserted cDNA fragments of the clone in both directions.
  • the 0502gll clone contained a full-length cDNA of 3380bp (as shown in Seq ID NO: 1), and a 305bp open reading frame (0RF) from 2254bp to 2559bp, encoding a new protein (such as Seq ID NO : Shown in 2).
  • this cloned pBS- 0502 g ll the encoded protein has been named human integrin non - metalloprotease 11.11
  • Example 2 RT-PCR to clone encoding human integrin non - 11.11 metalloprotease gene of
  • CDNA was synthesized using fetal brain cell total RNA as a template and ol igo-dT as a primer for reverse transcription reaction.
  • PCR amplification was performed with the following primers:
  • Pr imerl 5'- CTAATTGTTTGGCCTCAATGTTCA -3 (SEQ ID NO: 3)
  • Pr imer2 5'- TGTCACCTGAAAAAGTGCATTTCT -3 '(SEQ ID NO: 4)
  • Primerl is a forward sequence located at the 5th end of SEQ ID NO: 1, starting from the Ibp;
  • Pr imer2 is the 3'-end reverse sequence in SEQ ID NO: 1.
  • Amplification conditions 50 ol / L KC1, 10ramol / L Tris-CI, (pH 8.5.5), 1.5 mmol / L MgCl 2 , 200 ⁇ mol / L dNTP in a 50 ⁇ 1 reaction volume , l Opmol primer, 1U Taq DNA polymerase (Clontech).
  • the reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) under the following conditions for 25 cycles: 94 ° C 30sec; 55 ° C 30sec; 72 C 2min.
  • ⁇ -act in was set as a positive control and template blank was set as a negative control.
  • the amplified product was purified using a QIAGEN kit and ligated to a PCR vector using a TA cloning kit (Invitrogen). DM sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as that of 1 to 3380bp shown in SEQ ID NO: 1.
  • Example 3 Northern blot analysis of human non-integrin-metalloproteinase 11.11 gene expression: Total RNA extraction in one step [Anal. Biochera 1987, 162, 156-159] 0 This method involves acid guanidinium thiocyanate-chloroform extraction.
  • the tissue is homogenized with 4M guanidinium isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1 ), Mix and centrifuge. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. The obtained RM precipitate was washed with 70% ethanol, dried and dissolved in water.
  • a 32P-labeled probe (about 2 x 10 6 cpm / ml) was hybridized with a nitrocellulose membrane to which RNA was transferred at 42 ° C overnight in a solution containing 50% formamide-25niM KH 2 P0 4 ( ⁇ 7.4) -5 x SSC-5 x Denhardt's solution and 200 ⁇ g / ml salmon sperm DM. After hybridization, the filters were washed in 1 x SSC-0.1% SDS at 55 C for 30 min. Then, Phosphor Imager was used for analysis and quantification.
  • Example 4 In vitro expression, isolation and purification of recombinant human non-integrin-metalloproteinase 11.11
  • Priraer3 5'-CCCCATATGATGTGGGGTTTGACCTTTCGACCT-3 '(Seq ID No: 5)
  • Primer4 5' -CATGGATCCTCAATACCTTTGTGATAAGATCTC-3 '(Seq ID No: 6)
  • the 5' ends of these two primers contain Mel and BamHI restriction sites, respectively.
  • the coding sequences for the 5 'and 3' ends of the gene of interest are followed, respectively.
  • the Ndel and BamHI restriction sites correspond to the selectivity within the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865.3). Digestion site.
  • the pBS-0502gll plasmid containing the full-length target gene was used as a template for the PCR reaction.
  • the PCR reaction conditions are as follows: a total volume of 50 ⁇ 1 containing pBS- 0502gll plasmid 10 pg ⁇ l Advantage polymerase Mix (Clontech) 1 ⁇ 1. Cycle parameters: 94 ° C 20s, 60 ° C 30s, 68 C 2 rain, a total of 25 cycles. Ndel and BamHI were used to double-digest the amplified product and plasmid pBT-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase.
  • the ligation product was transformed into colibacillus DH5cx by the calcium chloride method. After being cultured overnight on LB plates containing kanamycin (final concentration 30 g / ral), positive clones were screened by colony PCR method and sequenced. A positive clone (pET-0502gll) with the correct sequence was selected, and the recombinant plasmid was transformed into E. coli BL21 (DE3) plySs (product of Novagen) using the calcium chloride method.
  • the host strain BL21 (pET-0502gll) was cultured at 37 C to the logarithmic growth phase, and IPTG was added to a final concentration of 1 ol / L. , Continue culturing for 5 hours. Centrifuge to collect bacterial cells, decompose by ultrasound, collect the supernatant by centrifugation, and use an affinity chromatography column His. Bind Quick Cartridge that can bind 6 histidines (6His-Tag). (Product of Novagen company). Chromatography was performed to obtain the purified human non-integrin-metalloproteinase 11.11.
  • Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
  • the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
  • the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
  • the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method.
  • Filter hybridization methods include dot blotting, Southern blotting, Northern blotting, and copying methods. They all use the same steps of hybridization after fixing the polynucleotide sample to be tested on the filter.
  • the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer, so that the non-specific binding site of the sample on the filter is saturated with the carrier and the synthetic polymer.
  • the pre-hybridization solution is then replaced with a hybridization buffer containing the labeled probe and incubated to hybridize the probe to the target nucleic acid.
  • the unhybridized probes are removed by a series of membrane washing steps Off.
  • This embodiment utilizes higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals.
  • the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
  • the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
  • the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
  • oligonucleotide fragments from the polynucleotide SEQ ID NO: 1 of the present invention for use as hybridization probes should follow the following principles and several aspects to be considered:
  • the preferred size of the probe is 1 S-50 nucleotides
  • Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other unknown genomic sequences and their complements The regions are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, the primary probe should not be used;
  • Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
  • Probe 2 (probe2), which belongs to the second type of probe, is equivalent to the replacement mutation sequence (41Nt) of the gene fragment of SBQ ID NO: 1 or its complementary fragment:
  • cold homogenization buffer (0.25 mol / L sucrose; 25 ol / L Tris-HCl, pH 7.5; 25 mfflol / LnaCl; 25 mmol / L MgCl 2 ).
  • step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
  • NC membrane nitrocellulose membrane
  • the 32 P-Probe (the second peak is free ⁇ - 32 P-dATP) is prepared.
  • the sample membrane was placed in a plastic bag, and 3-lOrag pre-hybridization solution (10xDenhardt-s; 6xSSC ; 0.1 mg / ml CT DNA (calf thymus DNA)) was added. After the bag was sealed, it was shaken in a 68 ° C water bath 2 hours.
  • Gene chip or gene microarray is a new technology that many national laboratories and large pharmaceutical companies are currently developing and developing. It refers to the orderly and high-density arrangement of Da Shi's target gene sheets on glass. , Silicon and other carriers, and then use fluorescence detection and computer software to compare and analyze the data, in order to achieve the purpose of rapid, efficient, high-throughput analysis of biological information.
  • the polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research of new gene functions; search for and screen new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases .
  • the specific method steps have been reported in the literature. For example, refer to the literature DeRi si, JL, Lyex, V. & Brown, P. 0. (1997) Science 278, 680-686. And the literature Hel le 'RA, Schema, M., Chai, A., Shalom, D., (1997) PNAS 94: 2150-2155
  • a total of 4,000 polynucleotide sequences of various full-length cDNAs are used as target DNA, including the polynucleotide of the present invention. They were respectively amplified by PCR, and the concentration of the amplified product was adjusted to about 500 ng / ul after purification, and spotted on a glass medium with a Cartesian 7500 spotter (purchased from Cartesian Company, USA). The distance between them is 280 ⁇ ⁇ . The spotted slides were hydrated, dried, and cross-linked in a purple diplomatic apparatus. After elution, the DNA was fixed on a glass slide to prepare a chip. The specific method steps are widely reported in the literature. The post-spot processing steps of this embodiment are:
  • Total mMA was extracted from human mixed tissues and specific tissues (or stimulated cell lines) in one step, and tnRNA was purified by Oligotex mRNA Midi Kit (purchased from QiaGen), and separated by reverse transcription.
  • Light test ij Cy3dUTP (5-Am ino-propargy 1-2 '-deoxyur i dine 5'-triphate coupled to C 3 fluorescent dye, purchased from Araersham Pharaacia Biotech) was used to label the mRNA of human mixed tissue, and the fluorescent reagent Cy5dUTP ( 5- Amino- propargy 1-2'- deoxyur idine 5--triphate cou led to Cy5 fluorescent dye, purchased from Amersham Phamacia Biotech Company, labeled mRNA of specific tissues (or stimulated cell lines) of the body, purified and prepared for detection needle.
  • Cy5dUTP 5- Amino- propargy 1-2'- deoxyur idine 5--triphate
  • the probes from the two types of tissues and the chip were hybridized in a UniHyb TM Hybridization Solution (purchased from TeleChem) hybridization solution for 16 hours, washed with a washing solution (1> ⁇ SSC, 0.2 »/ oSDS) at room temperature and then used.
  • ScanArray 3000 scanner purchased from General Scanning Company, USA was used for scanning. The scanned image was analyzed and processed with Imagene software (Biodiscovery Company, USA) to calculate the Cy3 / Cy5 ratio of each point.
  • the above specific tissues are fetal brain, bladder mucosa, PMA + Ecv304 cell line, LPS + Bcv304 cell line, thymus, normal fibroblasts 1024NC, Fibroblast, growth factor stimulation, 1024NT, scar into fc Growth factor stimulation, 1013HT, scar into fc without growth factor stimulation, 1G13HC, bladder cancer plant cell EJT, bladder cancer, bladder cancer, liver cancer, liver cancer cell line, fetal skin, spleen, prostate cancer, jejunal adenocarcinoma, cardia cancer.
  • Draw a graph based on these 18 Cy3 / Cy5 ratios. (figure 1) The figure shows the human non-integrin-metalloproteinase 11.11 and human non-integrin according to the present invention.
  • polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat malignant tumors, adrenal deficiency, skin diseases, various inflammations, HIV infections and immune diseases.
  • MADM MADM is a newly discovered member of this family. It is involved in extracellular protein metabolism in the body, and its abnormal expression can cause the corresponding physiological process to be impaired, and then cause the disorder of protein metabolism.
  • the expression profile of the polypeptide of the present invention is consistent with the expression profile of human non-integrin-metalloproteinase (MADM), and both have similar biological functions.
  • the polypeptide of the present invention participates in the process of extracellular protein metabolism in vivo. Abnormal expression can lead to disorder of protein metabolism, and then cause the occurrence of related diseases. These diseases include, but are not limited to, diseases related to protein metabolism disorder.
  • Protein peptide hormone dysfunction can cause the following diseases:
  • Insulin and glucagon diabetes, hypoglycemia, etc .;
  • hypothalamus and pituitary hormones Giant disease, dwarfism, acromegaly, Cortisol syndrome (Cushing's syndrome), primary hyperaldosteronism, secondary chronic adrenal insufficiency, hyperthyroidism Hypothyroidism (stingle disease, juvenile hypothyroidism, adult hypothyroidism), male / female infertility, menstrual disorders (functional uterine bleeding, amenorrhea, polycystic ovary syndrome, premenstrual tension syndrome, Menopause syndrome), sexual development disorder, diabetes insipidus, inappropriate antidiuretic hormone secretion syndrome, abnormal lactation, etc .;
  • Parathyroid hormone hyperparathyroidism, hypoparathyroidism, etc .
  • Gastrointestinal hormones peptic ulcer, chronic indigestion, chronic gastritis, etc .;
  • Arrhythmia shock, insanity, epilepsy, chorea, hepatic encephalopathy (norepinephrine,
  • Y-aminobutyric acid serotonin, glutamine
  • motion sickness I-type allergic diseases (urticaria, hay fever, allergic rhinitis, skin allergies), peptic ulcer (histamine), high Bold Alcoholemia (taurine), tumor (polyamine), etc .;
  • Various hemoglobin diseases anemia, jaundice, tissue-induced organic acidemia due to hypoxia), various coagulation factor deficiency (bleeding), muscle spasms, muscle forcing, muscle paralysis (actin), hyperlipoproteinemia, etc .
  • MADM Human non-integrin-metal protease
  • the expression profile of the polypeptide of the present invention is consistent with the expression profile of human non-integrin-metalloproteinase (MADM), both of which have similar biological functions.
  • the polypeptide of the present invention participates in the extracellular protein metabolism process in vivo, and its abnormal expression can cause the body to inactivate some abnormal proteins, and then lead to the occurrence of related diseases, including but not limited to:
  • the polypeptide of the present invention and its antagonists, agonists and inhibitors can be directly used in the treatment of various diseases, such as protein metabolism Disorder-related diseases, various tumor diseases, etc.
  • the invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) human non-integrin-metalloproteinase 11.11.
  • Agonists enhance human non-integrin-metalloproteinases 11. 11 Stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to cell proliferation, such as various cancers.
  • mammalian cells or membrane preparations expressing human non-integrin-metalloproteinase 11.11 can be cultured together with labeled human non-integrin-metalloproteinase 1 1.11 in the presence of drugs. The ability of the drug to increase or block this interaction is then determined.
  • Antagonists of human non-integrin-metalloproteinase 11.11 include antibodies, compounds, receptor deletions, and the like that have been screened. Antagonists of human non-integrin-metalloproteinase 11.11 can bind to human non-integrin-metalloproteinase 11.11 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that The polypeptide cannot perform biological functions.
  • human non-integrin-metalloproteinase 11.11 When screening compounds as antagonists, human non-integrin-metalloproteinase 11.11 can be added to the bioanalytical assay, and the interaction between human non-integrin-metalloproteinase 11.11 and its receptor can be determined by determining the compound Influence to determine if a compound is an antagonist. Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds. Human non-integrin-gold The peptides bound by the protease 11.11 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. Human non-integrin-metalloproteinase
  • the present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies.
  • the invention also provides antibodies against human non-integrin-metalloproteinase 11.11 epitopes. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments generated from Fab expression libraries.
  • polyclonal antibodies can be obtained by direct injection of human non-integrin-metalloproteinase 11.11 into immunized animals (such as rabbits, mice, rats, etc.).
  • immunized animals such as rabbits, mice, rats, etc.
  • adjuvants can be used to enhance the immune response, including but not limited to Freund's adjuvant, etc.
  • Techniques for preparing monoclonal antibodies to human non-integrin-metalloproteinase 11.11 include, but are not limited to, hybridoma technology (Kohler and Miste in. Nature, 1975, 256: 495-497), triple tumor technology, human B-cell hybridoma technology, EBV-hybridoma technology, etc.
  • the chimeric human antibody constant region and the variable region of non-human origin may be used in combination Pat some production techniques (Morr i son et al, PNAS , 1985, 81: 6851) 0 Ersi some production techniques of single chain antibodies ( US Pat. No. 4946778) can also be used to produce single chain antibodies against human non-integrin-metalloproteinase 11.11.
  • Antibodies against human non-integrin-metalloproteinase 11. 11 can be used in immunohistochemical techniques to detect human non-integrin-metalloproteinase 11.11 in biopsy specimens.
  • Monoclonal antibodies that bind to human non-integrin-metalloproteinase 11.11 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
  • Antibodies can also be used to design immunotoxins that target a particular part of the body. Such as human non-integrin-metal protease 11. 11 High affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.). A common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds. This hybrid antibody can be used to kill human non-integrin-metalloproteinase 11. 11 positive cells.
  • a thiol cross-linking agent such as SPDP
  • the antibodies of the present invention can be used to treat or prevent human non-integrin-metalloproteinase 11.11-related diseases. Administration of appropriate doses of antibodies can stimulate or block the production or activity of human non-integrin-metalloproteinase 11.11.
  • the invention also relates to a diagnostic test method for quantitative and localized detection of human non-integrin-metalloproteinase 11.11 levels.
  • tests are well known in the art and include FISH assays and radioimmunoassays.
  • the level of human non-integrin-metalloproteinase 11.11 detected in the test can be used to explain human non-integrin The importance of white-metalloproteinase 11.11 in various diseases and for the diagnosis of diseases in which human non-integrin-metalloproteinase 11.11 plays a role.
  • polypeptide of the present invention can also be used for peptide mapping analysis.
  • the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
  • Polynucleotides encoding human non-integrin-metalloproteinase 11.11 can also be used for a variety of therapeutic purposes. Gene therapy technology can be used to treat human non-integrin-metalloproteinase 11.11 expression or abnormality
  • Recombinant gene therapy vectors can be designed to express mutated human non-integrin-metalloproteinase 11.11 to inhibit endogenous human non-integrin-metalloproteinase 11.11 activity.
  • a variant human non-integrin-metalloproteinase 11.11 may be a shortened human non-integrin-metalloproteinase 11.11 that lacks a signaling domain, although it can bind to downstream substrates, but lacks Signaling activity. Therefore, the recombinant gene therapy vector can be used to treat diseases caused by abnormal expression or activity of human non-integrin-metalloproteinase 11.11.
  • Virus-derived expression vectors such as retroviruses, adenoviruses, adenovirus-associated viruses, herpes simplex virus, and parvoviruses can be used to transfer polynucleotides encoding human non-integrin-metalloproteinase 11.11 into cells.
  • Methods for constructing a recombinant viral vector carrying a polynucleotide encoding human non-integrin-metalloproteinase 11.11 can be found in the existing literature (Sanibrook, et al.).
  • a recombinant polynucleotide encoding human non-integrin-metalloproteinase 11.11 can be packaged into liposomes and transferred into cells.
  • Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
  • a vector such as a virus, phage, or plasmid
  • Oligonucleotides including antisense RNA and DNA
  • ribozymes that inhibit human non-integrin-metalloproteinase 11.11 mRNA are also within the scope of the present invention.
  • a ribozyme is an enzyme-like RNA molecule that can specifically decompose a specific RM. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target MA to perform endonucleation.
  • Antisense RNA, DNA, and ribozymes can be obtained using any existing RNA or DNA synthesis technology, such as solid-phase phosphoramidite chemical synthesis to synthesize oligonucleotides.
  • Antisense RNA molecules can be obtained by in vitro or in vivo transcription of DM sequences encoding the RNA. This DNA sequence is integrated downstream of the vector's RNA polymerase promoter. In order to increase the stability of the nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the linkage between ribonucleosides using phosphate thioester or peptide bonds instead of phosphodiester bonds.
  • the polynucleotide encoding human non-integrin-metalloproteinase 11.11 can be used for the diagnosis of diseases related to human non-integrin-metalloproteinase 11.11.
  • Encoding human non-integrin-metalloproteinase 11.11 The polynucleotide can be used to detect the expression of human non-integrin-metalloproteinase 11.11 or the abnormal expression of human non-integrin-metalloproteinase 11.11 in a disease state.
  • the DNA sequence encoding human non-integrin-metalloproteinase 11.11 can be used to hybridize biopsy specimens to determine the expression of human non-integrin-metalloproteinase 11.11.
  • Hybridization techniques include Southern blotting, Nor thern blotting, and in situ hybridization. These techniques and methods are publicly available and mature, and related kits are commercially available. Some or all of the polynucleotides of the present invention can be used as probes to be fixed on a micro array or a DM chip (also known as a "gene chip") for analyzing differential expression analysis and gene diagnosis of genes in tissues.
  • Human non-integrin-metalloproteinase 11.11 specific primers for RI-polymerase chain reaction (RT-PCR) in vitro amplification can also detect human non-integrin-metalloproteinase 11.11 transcription products.
  • Human non-integrin-metalloproteinase 11.11 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to normal wild-type human non-integrin-metalloproteinase 11.11 DM sequences. Mutations can be detected using well-known techniques such as Sou thern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression. Therefore, the Nor thern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
  • the sequences of the invention are also valuable for chromosome identification.
  • the sequence specifically targets a specific position on a human chromosome and can hybridize to it.
  • specific sites for each gene on the chromosome need to be identified.
  • only a few chromosome markers based on actual sequence data are available for marking chromosome positions.
  • an important first step is to locate these DM sequences on a chromosome.
  • PCR primers (preferably 15-35bp) are prepared based on cDNA, and the sequences can be located on chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
  • PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
  • oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
  • Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct a chromosome-specific library.
  • Fluorescent in situ hybridization of cDNA clones to metaphase chromosomes allows precise chromosomal localization in one step.
  • FISH Fluorescent in situ hybridization
  • cDNA or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. Based on the resolution capabilities of current physical mapping and gene mapping technologies, cDNAs that are accurately mapped to disease-related chromosomal regions can be one of 50 to 500 potentially pathogenic genes (assuming
  • the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
  • suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
  • the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
  • the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell.
  • the polypeptides of the invention can be used in combination with other therapeutic compounds.
  • the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
  • Human non-integrin-metalloproteinase 11. 11 is administered in an amount effective to treat and / or prevent a specific indication.
  • the amount and range of human non-integrin-metalloproteinase 11.11 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Public Health (AREA)
  • Wood Science & Technology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • General Chemical & Material Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Zoology (AREA)
  • Veterinary Medicine (AREA)
  • Biomedical Technology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Genetics & Genomics (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Immunology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

L'invention concerne un nouveau polypeptide, une désintégrine-métalloprotéase humaine 11.11, et un polynucléotide codant ce polypeptide ainsi qu'un procédé d'obtention de ce polypeptide par des techniques recombinantes d'ADN. L'invention concerne en outre les applications de ce polypeptide dans le traitement de maladies, notamment de maladies associées aux troubles du métabolisme protéique et de diverses tumeurs. L'invention concerne aussi l'antagoniste agissant contre le polypeptide et son action thérapeutique ainsi que les applications de ce polynucléotide codant la désintégrine-métalloprotéase humaine 11.11.
PCT/CN2001/000990 2000-06-19 2001-06-18 Nouveau polypeptide, desintegrine-metalloprotease humaine 11.11, et polynucleotide codant ce polypeptide WO2002012458A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU93625/01A AU9362501A (en) 2000-06-19 2001-06-18 A new polypeptide-human non-integration protein-metalloprotease 11.11 and the polynucleotide encoding it

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN00116589.5 2000-06-19
CN00116589A CN1329166A (zh) 2000-06-19 2000-06-19 一种新的多肽——人非整合蛋白－金属蛋白酶11.11和编码这种多肽的多核苷酸

Publications (1)

Publication Number Publication Date
WO2002012458A1 true WO2002012458A1 (fr) 2002-02-14

Family

ID=4585993

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2001/000990 WO2002012458A1 (fr) 2000-06-19 2001-06-18 Nouveau polypeptide, desintegrine-metalloprotease humaine 11.11, et polynucleotide codant ce polypeptide

Country Status (3)

Country Link
CN (1) CN1329166A (fr)
AU (1) AU9362501A (fr)
WO (1) WO2002012458A1 (fr)

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
"Genome sequence of the nematode C. elegans: A platform for investigating biology. The C. elegans sequencing consortium", SCIENCE, vol. 282, no. 5396, 1998, pages 2012 - 2018 *
KUNST F. ET AL.: "The complete genome sequence of the gram-positive bacterium bacillus subtilis", NATURE, vol. 390, no. 6657, 1997, pages 249 - 256 *

Also Published As

Publication number Publication date
CN1329166A (zh) 2002-01-02
AU9362501A (en) 2002-02-18

Similar Documents

Publication Publication Date Title
WO2002012458A1 (fr) Nouveau polypeptide, desintegrine-metalloprotease humaine 11.11, et polynucleotide codant ce polypeptide
WO2001083538A1 (fr) Nouveau polypeptide, proteine humaine 36 du gene k-ras, et polynucleotide codant pour ce polypeptide
WO2001088084A2 (fr) Nouveau polypeptide, superoxyde dismutase 11, et polynucleotide codant pour ce polypeptide
WO2001046240A1 (fr) Nouveau polypeptide, mariner transposase 19 humaine, et polynucleotide codant pour ce polypeptide
WO2002012306A1 (fr) Nouveau polypeptide, desintegrine-metalloprotease humaine 10.67, et polynucleotide codant ce polypeptide
WO2001071003A1 (fr) Nouveau polypeptide, serine protease humaine 8, et polynucleotide codant pour ce polypeptide
WO2001092515A1 (fr) Nouveau polypeptide, facteur humain de transcription 29.26, et polynucleotide codant ce polypeptide
WO2002040523A1 (fr) Nouveau polypeptide, glutaryl-coa deshydrogenase humaine 15.51, et polynucleotide codant ce polypeptide
WO2001092517A1 (fr) Nouveau polypeptide, proteine humaine 29.15 du gene transducteur-2-beta, et polynucleotide codant ce polypeptide
WO2002026794A1 (fr) Nouveau polypeptide, proteine ribosomale humaine l7a20.57, et polynucleotide codant ce polypeptide
WO2001073041A1 (fr) Nouveau polypeptide, adn ligase humaine 15, et polynucleotide codant pour ce polypeptide
WO2001090131A1 (fr) Nouveau polypeptide, proteine humaine 10.56 du gene cancerigene tre, et polynucleotide codant ce polypeptide
WO2001077286A2 (fr) Nouveau polypeptide, globine humaine 58 de l'uterus, et un polynucleotide codant pour ce polypeptide
WO2001072792A1 (fr) Nouveau polypeptide, proteine humaine 13 analogue a l'ubiquitine, et polynucleotide codant pour ce polypeptide
WO2001081396A1 (fr) Nouveau polypeptide, proteine ribosomale s7 humaine 14, et polynucleotide codant pour ce polypeptide
WO2001077165A1 (fr) Nouveau polypeptide, proteine humaine de liaison 12 d'une proteine precurseur de l'amyloide, et polynucleotide codant pour ce polypeptide
WO2001087916A1 (fr) Nouveau polypeptide, proteine ribosomale humaine s5-13, et polynucleotide codant pour ce polypeptide
WO2001048199A1 (fr) Nouveau polypeptide, proteine ribosomale s10 14, et polynucleotide codant pour ce polypeptide
WO2001081571A1 (fr) Nouveau polypeptide, proteine humaine 11 contenant un site de conservation d'un recepteur lie a une proteine g, et polynucleotide codant pour ce polypeptide
WO2001068872A1 (fr) Nouveau polypeptide, sous-unite c humaine de la pompe a proton vacuolaire atpase 22, et polynucleotide codant pour ce polypeptide
WO2001081386A1 (fr) Nouveau polypeptide, proteine pax humaine 12.5, et polynucleotide codant pour ce polypeptide
WO2002020604A1 (fr) Nouveau polypeptide, proteine humaine 11 associee a l'arn a double helice, et polynucleotide codant ce polypeptide
WO2001083741A1 (fr) Nouveau polypeptide, proteine myb humaine 10, et polynucleotide codant pour ce polypeptide
WO2001094534A2 (fr) Nouveau polypeptide, facteur humain de transcription 9.57, et polynucleotide codant ce polypeptide
WO2001070789A1 (fr) Nouveau polypeptide, proteine ribosomale humaine s5-17, et polynucleotide codant pour ce polypeptide

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP