WO2002020604A1 - Nouveau polypeptide, proteine humaine 11 associee a l'arn a double helice, et polynucleotide codant ce polypeptide - Google Patents

Nouveau polypeptide, proteine humaine 11 associee a l'arn a double helice, et polynucleotide codant ce polypeptide Download PDF

Info

Publication number
WO2002020604A1
WO2002020604A1 PCT/CN2001/001148 CN0101148W WO0220604A1 WO 2002020604 A1 WO2002020604 A1 WO 2002020604A1 CN 0101148 W CN0101148 W CN 0101148W WO 0220604 A1 WO0220604 A1 WO 0220604A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
polynucleotide
binding protein
stranded rna
human double
Prior art date
Application number
PCT/CN2001/001148
Other languages
English (en)
Chinese (zh)
Inventor
Yumin Mao
Yi Xie
Original Assignee
Biowindow Gene Development Inc. Shanghai
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Biowindow Gene Development Inc. Shanghai filed Critical Biowindow Gene Development Inc. Shanghai
Priority to AU2002213746A priority Critical patent/AU2002213746A1/en
Publication of WO2002020604A1 publication Critical patent/WO2002020604A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • the present invention belongs to the field of biotechnology. Specifically, the present invention describes a new polypeptide, a human double-stranded RNA binding protein 11, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and polypeptide. Background technique
  • protein kinases There is a large class of protein kinases in cells. Activation of these protein kinases requires autophosphorylation in the presence of double-stranded RNA or heparin.
  • the most representative substrate for these protein kinases is the eukaryotic promoter elF-2. Protein kinases phosphorylate elF-2 to promote intracellular protein synthesis.
  • elF-2 eukaryotic promoter
  • Protein kinases phosphorylate elF-2 to promote intracellular protein synthesis.
  • These protein kinases play important regulatory roles in a variety of cellular processes in the organism, such as transcriptional signals, programmed cell death, cell growth, and cell differentiation. It can be seen that this type of protein kinase has a very important role in the body, and its mutation or abnormal expression will directly cause the abnormality of related metabolic pathways in the body, and then cause various related diseases.
  • This class of protein kinases is a subclass of the double-stranded RNA-binding protein family and is highly conserved in many organisms, including viruses, fruit flies, mice, and humans.
  • the amino acid sequences of these proteins contain a similar double-stranded RNA-binding structural motif, which is an important site for the protein to bind and activate the double-stranded RNA to exert its normal biological activity. Mutations or deletions at this site will lead to the inactivation of the protein in the body, and then affect the occurrence of related biological processes, that is, trigger various metabolic and developmental disorders.
  • RNA-activated protein kinases have been cloned from many different organisms, and the structure and function of these proteins have been studied. In 1999, Rekha et al. Cloned a new double-stranded RNA binding protein DRBP76 from humans. The protein is also a double-stranded RNA-activated protein kinase that is involved in regulating a variety of important cellular metabolic pathways in the body.
  • the amino acid sequence of the protein contains a conserved nuclear localization signal fragment, two conserved double-stranded RNA binding structural motifs, a potential cell cycle M-phase specific phosphorylation site, and two potential cell cycle-dependent proteins Kinase phosphorylation site and a RG-2 structural motif.
  • the double-stranded RNA binding structural motif is the site where the protein binds to the double-stranded RNA and is activated to exert its physiological activity.
  • This protein is involved in regulating the phosphorylation of various related proteins in the body to regulate the occurrence of related cellular pathways in the body. Its mutation or abnormal expression will directly affect the abnormality of related metabolic pathways in the body, and then cause various related diseases [Rekha C. Patel, Deborah J. Ves ta letal., 1999, J Bi ol Chem, 274 (29): 20432-20437] 0
  • This protein is usually closely related to the development of related tissues and the development of metabolic disorders, related tissue tumors and cancer. It can also be used to diagnose the various related diseases mentioned above.
  • the human double-stranded RNA binding protein 11 protein plays an important role in regulating important functions of the body such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes, so there has been a need in the art to identify more involved in these Process the human double-stranded RNA-binding protein 11 protein, specifically identifying the amino acid sequence of this protein.
  • Isolation of the novel double-stranded MA-binding protein 11 protein-encoding gene also provides a basis for the study to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so it is important to isolate its coding DNA. Disclosure of invention
  • Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding a human double-stranded RNA-binding protein 11.
  • Another object of the present invention is to provide a method for producing human double-stranded RNA binding protein 11.
  • Another object of the present invention is to provide an antibody against the polypeptide-human double-stranded RM binding protein 11 of the present invention.
  • Another object of the present invention is to provide mimetic compounds, antagonists, agonists, and inhibitors directed to the polypeptide of the present invention-human double-stranded MA binding protein 11.
  • Another object of the present invention is to provide a method for diagnosing and treating a disease associated with abnormality of human double-stranded RM binding protein 11.
  • the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
  • the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
  • sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 1289-1591 in SEQ ID NO: 1; and (b) a sequence having 1-3307 in SEQ ID NO: 1 Sequence of bits.
  • the invention further relates to a vector, in particular an expression vector, containing the polynucleotide of the invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; and a method comprising culturing said Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
  • a vector in particular an expression vector, containing the polynucleotide of the invention
  • a host cell genetically engineered with the vector including a transformed, transduced or transfected host cell
  • a method comprising culturing said Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
  • the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
  • the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of human double-stranded RM binding protein 11 protein, which comprises utilizing the polypeptide of the invention.
  • the invention also relates to compounds obtained by this method.
  • the invention also relates to a method for in vitro detection of a disease or disease susceptibility associated with abnormal expression of a human double-stranded RNA binding protein 11 protein, which comprises detecting a mutation in the polypeptide or a polynucleotide sequence encoding the same in a biological sample, or detecting The amount or biological activity of a polypeptide of the invention in a biological sample.
  • the present invention also relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a polypeptide of the present invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
  • the present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention in the preparation of a medicament for the treatment of ⁇ cancer, developmental disease or immune disease ⁇ or other diseases caused by abnormal expression of human double-stranded RNA binding protein 11.
  • Nucleic acid sequence refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
  • amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
  • amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
  • a protein or polynucleotide “variant” refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it. The changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence. Variants can have "conservative" changes in which the substituted amino acid has a structural or chemical property similar to the original amino acid, such as the replacement of isoleucine with leucine. Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
  • “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
  • “Insertion” or “addition” refers to an alteration in the amino acid sequence or nucleotide sequence that results in an increase in one or more amino acids or nucleotides compared to a naturally occurring molecule.
  • “Replacement” refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
  • Bioly active refers to a protein that has the structure, regulatory, or biochemical function of a natural molecule.
  • immunologically active refers to the ability of natural, recombinant, or synthetic proteins and fragments thereof to induce a specific immune response and to bind specific antibodies in a suitable animal or cell.
  • An "agonist” refers to a molecule that, when combined with human double-stranded RNA-binding protein 11, can cause the protein to change, thereby regulating the activity of the protein.
  • An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that can bind human double-stranded RNA binding protein 11.
  • Antagonist refers to a molecule that can block or regulate the biological or immunological activity of human double-stranded RNA-binding protein 11 when bound to human double-stranded RNA-binding protein 11.
  • Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates or any other molecule that can bind human double-stranded RNA binding protein 11.
  • Regular refers to a change in the function of human double-stranded RNA binding protein 11, including an increase or decrease in protein activity, a change in binding characteristics, and any other biological, functional, or immune properties of human double-stranded RNA-binding protein 11. change.
  • Those skilled in the art can purify human double-stranded RNA binding protein 11 using standard protein purification techniques. Basic The pure human double-stranded RNA-binding protein 11 can generate a single main band on a non-reducing polyacrylamide gel. The purity of the human double-stranded RNA-binding protein 11 polypeptide can be analyzed by amino acid sequence.
  • Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
  • sequence C-T-G-A
  • complementary sequence G-A-C-T
  • the complementarity between two single-stranded molecules can be partial or complete.
  • the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
  • “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
  • Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. Inhibition of such hybridization can be detected by performing hybridization (Southern blotting or Nor thern blotting, etc.) under conditions of reduced stringency.
  • Substantially homologous sequences or hybridization probes can compete and inhibit the binding of completely homologous sequences to target sequences under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences be combined with each other as a specific or selective interaction.
  • Percent identity refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALI GN program (La sergenes of tware package, DNASTAR, Inc., Madis on Wi s.). MEGALIGN program can be different according to Methods such as the Clus ter method to compare two or more sequences (Hi ggins, DG and PM Sharp (1988) Gene 73: 237-244). 0 The Clus ter method arranges groups of sequences into clusters by checking the distance between all pairs. . The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula: The number of matching residues between sequence A and sequence B
  • the number of residues in sequence A-the number of spacer residues in sequence A-the number of spacer residues in sequence B can also be determined by the Clus ter method or using methods known in the art such as Jotun Hein (Hein J ., (1990) Methods in erazuraology 183: 625-645).
  • Similarity refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
  • Amino acids used for conservative substitutions for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
  • Antisense refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence.
  • Antisense strand refers to a nucleic acid strand that is complementary to the “sense strand”.
  • Derivative refers to a chemical modification of HFP or a nucleic acid encoding it. Such a chemical modification may be a substitution of a hydrogen atom with a fluorenyl group, an acyl group or an amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological characteristics of natural molecules.
  • Antibody refers to a complete antibody molecule and its fragments, such as Fa,? ( ⁇ ') 2 and? 7. It can specifically bind to the epitope of human double-stranded RNA binding protein 11.
  • a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
  • isolated refers to the removal of matter from its original environment (for example, its natural environment if it is naturally occurring).
  • a naturally occurring polynucleotide or polypeptide is not isolated when it is present in a living animal, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist in the natural system.
  • Such a polynucleotide may be part of a vector, or such a polynucleotide or polypeptide may be part of a composition. Since the carrier or composition is not part of its natural environment, they are still isolated.
  • isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
  • polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are the same as those in the natural state. Other materials are separated and purified.
  • isolated human double-stranded RNA binding protein 11 means that human double-stranded RM-binding protein 11 is substantially free of other proteins, lipids, sugars, or other substances with which it is naturally associated. Those skilled in the art can purify human double-stranded RNA binding protein 11 using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of human double-stranded RNA binding protein 11 peptide can be analyzed by amino acid sequence.
  • the present invention provides a new polypeptide, a human double-stranded RNA binding protein 11, which is basically composed of the amino acid sequence shown in SEQ ID NO: 2.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
  • the polypeptides of the present invention may be naturally purified products or chemically synthesized products, or produced using recombinant techniques from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells). Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
  • the invention also includes fragments, derivatives, and analogs of human double-stranded RNA-binding protein 11.
  • fragment refers to a polypeptide that substantially maintains the same biological function or activity of the human double-stranded RNA binding protein 11 of the present invention.
  • a fragment, derivative or analog of the polypeptide of the present invention may be: U) a type in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substituted
  • the amino acid may or may not be encoded by the genetic code; or ( ⁇ ) such that a group on one or more amino acid residues is substituted by another group to include a substituent; or ( ⁇ ⁇ ) like this One, in which the mature polypeptide is fused to another compound (such as a compound that extends the half-life of the polypeptide, such as polyethylene glycol); or (IV) such a polypeptide sequence in which the additional amino acid sequence is fused into the mature polypeptide ( Such as leader sequences or secreted sequences or sequences used to purify this polypeptide or protease sequences) 'As set forth herein, such fragments, derivatives and analogs are considered to be within the knowledge of those skilled in the art.
  • the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
  • the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a polynucleotide sequence of 3307 bases in length and its open reading frame of 1289-1591 encodes 100 amino acids.
  • this polypeptide has a similar expression profile to that of human double-stranded MA-activated protein kinase, and it can be deduced that the human double-stranded RNA-binding protein 11 has a function similar to that of human double-stranded RM-activated protein kinase.
  • the polynucleotide of the present invention may be in the form of DNA or RNA.
  • DNA forms include cDNA, genomic DNA, or synthetic DNA.
  • DNA can be single-stranded or double-stranded.
  • DNA can be a coding strand or Non-coding chain.
  • the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
  • a "degenerate variant” refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
  • the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
  • polynucleotide encoding a polypeptide refers to a polynucleotide that includes the polypeptide and a polynucleotide that includes additional coding and / or non-coding sequences.
  • the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
  • This polynucleotide variant can be a naturally occurring allelic variant or a non-naturally occurring variant.
  • These nucleotide variants include substitution variants, deletion variants, and insertion variants.
  • an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
  • the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity between the two sequences).
  • the present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions.
  • "strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.
  • the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
  • nucleic acid fragments that hybridize to the sequences described above.
  • a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 cores. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques, such as PCR, to identify and / or isolate polynucleotides encoding human double-stranded RNA-binding protein 11.
  • polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
  • the specific polynucleotide sequence encoding the human double-stranded RNA-binding protein 11 of the present invention can be obtained by various methods.
  • polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
  • the DM fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the DM of the genome; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.
  • genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences.
  • the standard method for isolating the cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library. There are many proven techniques for extracting mRM. Kits are also commercially available (Qiagene).
  • the construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989).
  • Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When combined with polymerase reaction technology, even very small expression products can be cloned.
  • genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DNA-RNA hybrids; (2) the presence or absence of marker gene functions; (3) determining the level of transcripts of human double-stranded RNA binding protein 11; 4) Detecting gene-expressed protein products by immunological techniques or by measuring biological activity. The above methods can be used singly or in combination.
  • the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
  • the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
  • the probe used here is generally a DNA sequence chemically synthesized based on the gene sequence information of the present invention.
  • the genes or fragments of the present invention can of course be used as probes.
  • DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
  • immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) can be used to detect protein products expressed by the human double-stranded RNA-binding protein 11 gene.
  • ELISA enzyme-linked immunosorbent assay
  • a method of applying a PCR technique to amplify DNA / RNA is preferably used to obtain the gene of the present invention.
  • the RACE method RACE-rapid cDNA end rapid amplification method
  • the primers for PCR may be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Select and synthesize using conventional methods.
  • the amplified DNA / RM fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
  • polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. To obtain the full-length CDM sequence, sequencing needs to be repeated. Sometimes it is necessary to determine the CDM sequence of multiple clones in order to splice into a full-length cDNA sequence.
  • the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell that is genetically engineered using the vector of the present invention or directly using a human double-stranded RNA binding protein 11 coding sequence, and a recombinant technology for producing the polypeptide of the present invention. method.
  • the polynucleotide sequence encoding the human double-stranded RNA-binding protein 11 can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
  • vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
  • Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors expressed in bacteria (Rosenberg, et al.
  • pMSXND expression vectors expressed in mammalian cells Lee and Na thans, J Bio Chem. 263: 3521, 1988
  • baculovirus-derived vectors expressed in insect cells in short, as long as it can be replicated and stabilized in the host, any plasmid and vector can be used to construct a recombinant expression vector.
  • An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
  • Methods known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding human double-stranded RNA binding protein 11 and appropriate transcription / translation regulatory elements. These methods include in vitro recombination DM technology, DNA synthesis technology, in vivo recombination technology, etc. (Sambroook, e. T. A. Mol. Molecular Cloning, a Labora tory Manua 1, cod Spring Harbor Labora tory. New York, 1989).
  • the DNA sequence can be operably linked to an appropriate promoter in an expression vector to direct mRNA synthesis. Representative examples of these promoters are: the l ac or trp promoter of E.
  • the expression vector also includes a ribosome binding site for translation initiation and a transcription terminator. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Examples include 100 to 270 base pair SV40 enhancers on the late side of the origin of replication, polyoma enhancers and adenovirus enhancers on the late side of the origin of replication.
  • the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • GFP fluorescent protein
  • tetracycline or ampicillin resistance for E. coli.
  • a polynucleotide encoding human double-stranded RNA-binding protein 11 or a heavyweight containing the polynucleotide A set of vectors can be transformed or transduced into a host cell to form a genetically engineered host cell containing the polynucleotide or a recombinant vector.
  • the term "host cell” refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E.
  • coli Streptomyces
  • bacterial cells such as Salmonella typhimurium
  • fungal cells such as yeast
  • plant cells such as fly S2 or Sf 9
  • animal cells such as CH0, COS, or Bowes melanoma cells.
  • Transformation of a host cell with a DM sequence according to the present invention or a recombinant vector containing the DNA sequence can be performed by conventional techniques well known to those skilled in the art.
  • the host is a prokaryote such as E. coli
  • competent cells capable of DNA uptake can be in the exponential growth phase were harvested, treated with CaC l 2 method used in steps well known in the art. Alternatively, MgCl 2 is used.
  • transformation can also be performed by electroporation.
  • the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
  • the polynucleotide sequence of the present invention can be used to express or produce recombinant human double-stranded RNA binding protein 11 (Scence, 1984; 224: 1431). Generally there are the following steps:
  • the medium used in the culture may be selected from various conventional mediums according to the host cells used. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
  • a suitable method such as temperature conversion or chemical induction
  • the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell.
  • recombinant proteins can be isolated and purified by various separation methods using their physical, chemical, and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
  • conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromat
  • FIG. 1 is a gene chip table of human double-stranded RNA binding protein 11 and human double-stranded RNA-activated protein kinase of the present invention Comparison chart.
  • the upper graph is a graph of the expression profile of human double-stranded MA binding protein 11, and the lower graph is the graph of the expression profile of human double-stranded RNA-activated protein kinase.
  • Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of the isolated human double-stranded RNA-binding protein 11.
  • l lkDa is the molecular weight of the protein.
  • the arrow indicates the isolated protein band.
  • Total RM of human fetal brain was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform.
  • Poly (A) mRNA was isolated from total RNA using Quik mRNA Isolat ion Kit (product of Qiegene). 2ug poly (A) mRNA was formed into cDNA by reverse transcription. The Smart cDNA cloning kit (purchased from Clontech) was used to insert the cDNA fragment into the multiple cloning site of the pBSK (+) vector (Clontech) to transform DH5 ⁇ . The bacteria formed a cDM library.
  • Dye terminate cycle react ion sequencing kit Perkin-Elmer
  • ABI 377 automated sequencer Perkin-Elmer
  • the determined cDNA sequence was compared with the existing public DNA sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 0056 ⁇ 1 was new DNA.
  • the inserted cDM fragments contained in this clone were assayed in both directions by synthesizing a series of primers.
  • the 0056 ⁇ 1 clone contains a full-length cDNA of 3307bp (as shown in Seq ID NO: 1), and has a 302bp open reading frame (0RF) from 1289bp to 1591bp, encoding a new protein (such as Seq ID NO : Shown in 2).
  • This clone pBS_0056fll and the encoded protein was named human double-stranded RM binding protein 11.
  • Example 2 Cloning of a gene encoding human double-stranded RNA-binding protein 11 by RT-PCR
  • CDNA was synthesized using fetal brain total RNA as a template and ol igo-dT as a primer for reverse transcription reaction.
  • PCR amplification was performed with the following primers:
  • Pr imerl 5, —GTCTTAGAAAATTCTTATCTCTCT— 3, (SEQ ID NO: 3)
  • Primer 2 5'-GCACGGCTGCGAGAAGACGAAGCT-3 '(SEQ ID NO: 4)
  • Primerl is a forward sequence located at the 5th, lbp end of SEQ ID NO: 1;
  • Primer2 is the 3, terminal reverse sequence of SEQ ID NO: 1.
  • Amplification reaction conditions 50 ⁇ l reaction volume containing 50 ol / L KC1, 10ramol / L Tris-CI, (pH8.5), 1.5raraol / L MgCl 2 , 200 ⁇ mol / L dNTP, lOpmol Primer, 1U of Taq DM polymerase (Clontech). Reaction was performed on a PE OO DNA thermal cycler (Perkin-Elmer) under the following conditions for 25 cycles: 94 ° C 30sec; 55. C 30sec; 72 ° C 2min. At-? 0, set-& 0 ⁇ 11 as a positive control and template blank as a negative control.
  • the amplified product was purified using a QIAGEN kit and ligated to a PCR vector (Invitrogen product) using a TA cloning kit.
  • the DNA sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as the 3307bp shown in SEQ ID NO: 1.
  • Example 3 Northern blot analysis of human double-stranded RNA binding protein 11 gene expression:
  • RNA extraction in one step [Anal. Biochem 1987, 162, 156-159] 0
  • This method involves acid guanidinium thiocyanate-chloroform extraction. That is, the tissue was homogenized with 4M guanidine isothiocyanate-25raM sodium citrate, 0.2M sodium acetate (pH 4. G), and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1) were added. ), Mix and centrifuge. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. The obtained RM precipitate was washed with 70% ethanol, dried and dissolved in water.
  • a 32P-labeled probe (about 2 x 10 6 cpm / ml) was hybridized with a nitrocellulose membrane to which RNA was transferred at 42 ° C overnight in a solution containing 50% formamide-25mM KH 2 P0 4 (pH7.4) -5 SSC-5 Denhardt's solution and 200 g / ml salmon sperm DNA. After hybridization, place the filter at 1 x SSC-0.1 ° /. Wash in SDS for 30 min at 55 ° C. Then, Phosphor Imager was used for analysis and quantification.
  • Example 4 In vitro expression, isolation and purification of recombinant human double-stranded RM binding protein 11
  • Primer3 5'- CATGCTAGCATGATAGTTGTACATTTTTTTCTA- 3, (Seq ID No: 5)
  • Priraer 4 5'-CATGGATCCTTACAAAAATAGAATAAACATGTT -3, (Seq ID No: 6)
  • the 5 'ends of these two primers contain Ndel and BamHI restriction sites, respectively.
  • the coding sequences of the 5 ', 3 ' and 3 'ends of the target gene are followed, respectively.
  • the Ndel and BamHI restriction sites correspond to the expression vector plasmid pET-28b (+) (Novagen Corporation Product, Cat. No. 69865. 3).
  • the PCR reaction was performed using the pBS-0056fll plasmid containing the full-length target gene as a template.
  • the PCR reaction conditions are as follows: a total volume of 50 ⁇ 1 contains 10 pg of pBS- 0056f 11 plasmid, primers ⁇ 1 ⁇ 1116: 1: -3 and ⁇ 1 1116]: -4 points and another!] Is 1 1.
  • Advantage polymerase Mix (Clontech) 1 ⁇ 1.
  • Cycle parameters 94. C 20s, 60 ° C 30s, 68 ° C 2 min, a total of 25 cycles.
  • Ndel and BamHI were used to double digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase.
  • the ligation product was transformed into E. coli DH5a by the calcium chloride method. After being cultured overnight on LB plates containing kanamycin (final concentration 30 g / ml), positive clones were screened by colony PCR and sequenced. A positive clone (pET-0056f 11) with the correct sequence was selected, and the recombinant plasmid was transformed into E. coli BL21 (DE3) plySs (product of Novagen) by the calcium chloride method.
  • the host strain BL21 (pET-0056fll) was cultured at 37 ° C to the logarithmic growth phase, and IPTG was added to a final concentration of 1 ol / L, continue to cultivate for 5 hours.
  • the cells were collected by centrifugation, and the supernatant was collected by centrifugation.
  • the supernatant was collected by centrifugation, and the layers were layered with an affinity column His s.
  • Bind Quick Cartr idge product of Novagen capable of binding to 6 histidines (6His-Tag).
  • the purified human double-stranded MA binding protein 11 was obtained.
  • RNA binding protein 11 The following peptides specific for human double-stranded RNA binding protein 11 were synthesized using a peptide synthesizer (product of PE): NH2-Met-I le-Va l-Val-Hi s-Phe-Phe-Leu-Met-Gly-Phe -Phe-Phe-Ser-Phe-C00H (SEQ ID NO: 7).
  • the polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex, respectively.
  • Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in various aspects.
  • the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected. Further, the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissues or Whether the expression in tissue cells is abnormal.
  • the purpose of this embodiment is to select a suitable * nucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention for use as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method.
  • Filter hybridization methods include dot blotting, Southern blotting, Northern blotting, and copying methods. They are all used to fix the polynucleotide sample to be tested on the filter and then hybridize using basically the same steps.
  • the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer, so that the non-specific binding site of the sample on the filter is saturated with the carrier and the synthetic polymer.
  • the pre-hybridization solution is then replaced with a hybridization buffer containing the labeled probe and incubated to hybridize the probe to the target nucleic acid.
  • the unhybridized probes are removed by a series of membrane washing steps.
  • This embodiment utilizes higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals.
  • the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
  • the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
  • the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
  • oligonucleotide fragments for use as hybridization probes from the polynucleotide SEQ ID NO: 1 of the present invention should follow the following principles and several aspects to be considered:
  • the preferred range of probe size is 18-50 nucleotides
  • Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements The regions are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, then the primary probe should not be used;
  • Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
  • Probe 2 (probe2), which belongs to the second type of probe, is equivalent to the replacement mutant sequence of the gene fragment of SEQ ID NO: 1 or its complementary fragment (41Nt):
  • PBS phosphate buffered saline
  • step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
  • NC membrane nitrocellulose membrane
  • the 32 P-Probe (the second peak is free ⁇ - 32 P-dATP) is prepared.
  • the sample membrane was placed in a plastic bag, and 3-10 mg of prehybridization solution (lOxDenhardt's; 6xSSC, 0.1 mg / ml was added).
  • CT DNA (calf thymus DNA).
  • Gene chip or DNA microarray is a new technology that many national laboratories and large pharmaceutical companies are currently developing and developing. It refers to the orderly and high-density arrangement of large numbers of target gene fragments on glass, The data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software to achieve the purpose of rapid, efficient, and high-throughput analysis of biological information.
  • the polynucleotide of the present invention can be used as a target DM for gene chip technology for high-throughput research of new gene functions; finding and screening new tissue-specific new genes in particular New genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases.
  • the specific method steps have been reported in the literature, for example, see the literature DeRi si, JL, Lyer, V. & Brown, P. 0.
  • a total of 4,000 polynucleotide sequences of various full-length cDNAs are used as target DNA, including the polynucleotide of the present invention. They were respectively amplified by PCR. After purification, the concentration of the amplified product was adjusted to about 500 ng / ul, and spotted on a glass medium with a Cartesian 7500 spotter (purchased from Cartesian Company, USA). The distance between them is 280 ⁇ ⁇ . The spotted slides were hydrated, dried, and cross-linked in a UV cross-linking instrument. After elution, the slides were fixed to fix the DNA on the glass slides to prepare chips. The specific method steps have been variously reported in the literature. The post-spot processing steps of this embodiment are:
  • Total mRNA was extracted from human mixed tissues and specific tissues (or stimulated cell lines) in one step, and mRM was purified with Ol igotex mRNA Midi Kit (purchased from QiaGen).
  • the fluorescent test Cy3dUTP (5-Amino-propargy 1-2 '-deoxyur dine 5'-tr iphate coupled to Cy3 f luorescent dye, purchased from Amersham Phamacia Biotech) was used to label the mRNA of human mixed tissue, and the fluorescent reagent Cy5dUTP (5-Amino- propargyl- 2'- deoxyur idine 5'-triphate coupled to Cy5 f luorescent dye, purchased from Amersham Phamacia Biotech) to mark the body's specific tissues (or stimulated cell lines) mRM. needle.
  • Cy3dUTP 5-Amino-propargy 1-2 '-deoxyur dine 5'-tr iphate coupled to Cy3 f
  • the above specific tissues are fetal brain, bladder mucosa, PMA + Ecv304 cell line, LPS + Ecv304 cell line thymus, normal fibroblasts 1024NC, Fibroblas t, growth factor stimulation, 1024NT, scar formation fc growth factor stimulation, 1013HT, scar into fc without growth factor stimulation, 1013HC, bladder cancer construct cell EJ, bladder cancer, bladder cancer, liver cancer, liver cancer cell line, fetal skin, spleen, prostate cancer, jejunal adenocarcinoma, Cardiac cancer. Draw a graph based on these 18 Cy3 / Cy5 ratios. (figure 1 ) . It can be seen from the figure that the expression profile of human double-stranded RNA binding protein 11 and human double-stranded RNA-activated protein kinase according to the present invention are very similar. Industrial applicability
  • polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat malignant tumors, adrenal deficiency, skin diseases, various inflammations, HIV infections and immune diseases.
  • Human double-stranded RNA binding protein is involved in regulating the phosphorylation of various related proteins in vivo to regulate the occurrence of related cellular pathways in vivo. Its abnormal expression can directly affect the abnormality of related metabolic pathways in the body, and then lead to the occurrence of related diseases. '
  • the expression profile of the polypeptide of the present invention is consistent with the expression profile of human double-stranded RNA binding protein, and both have similar biological functions.
  • the polypeptide of the present invention is involved in regulating the phosphorylation process of various related proteins in vivo to regulate the occurrence of related cellular pathways in vivo. Its abnormal expression can cause abnormal metabolism pathways in the body, which leads to the occurrence of disorders of protein metabolism. These diseases include but are not limited to:
  • Protein peptide hormone dysfunction can cause the following diseases:
  • Insulin and glucagon diabetes, hypoglycemia, etc .;
  • hypothalamus and pituitary hormones Giant disease, dwarfism, acromegaly, Cortisol syndrome (Cushing's syndrome), primary hyperaldosteronism, secondary chronic adrenal insufficiency, hyperthyroidism Hypothyroidism (stingle disease, juvenile hypothyroidism, adult hypothyroidism), male / female infertility, menstrual disorders (functional uterine bleeding, amenorrhea, polycystic ovary syndrome, premenstrual tension syndrome, Menopause syndrome), sexual development disorder, diabetes insipidus, inappropriate antidiuretic hormone secretion syndrome, abnormal lactation, etc .; 3) parathyroid hormone: hyperparathyroidism, hypoparathyroidism, etc .;
  • Gastrointestinal hormones peptic ulcer, chronic indigestion, chronic gastritis, etc .;
  • Arrhythmia shock, insanity, epilepsy, chorea, hepatic encephalopathy (norepinephrine, Y-aminobutyric acid, serotonin, glutamine), motion sickness, type I allergic disease (net Measles, hay fever, allergic rhinitis, skin allergies), peptic ulcer (histamine), hypercholesterolemia (taurine), tumors (polyamines), etc .;
  • hemoglobin diseases anemia, jaundice, tissue hypoxia-induced organic acidemia
  • various coagulation factor deficiency various hemoglobin diseases (anemia, jaundice, tissue hypoxia-induced organic acidemia), various coagulation factor deficiency
  • polypeptide of the present invention and its antagonist, agonist and inhibitor can be directly used in a variety of Treatment of diseases, such as disorders of protein metabolism.
  • the invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) human double-stranded RNA binding protein 11.
  • Agonists enhance human double-stranded RNA-binding protein 11 to stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation such as various cancers.
  • mammalian cells or membrane preparations expressing human double-stranded MA-binding protein 11 can be cultured with labeled human double-stranded RNA-binding protein 11 in the presence of a drug. The ability of the drug to increase or block this interaction is then measured.
  • Antagonists of human double-stranded RM-binding protein 11 include antibodies, compounds, receptor deletions, and the like that have been screened. Antagonists of human double-stranded RNA binding protein 11 can bind to human double-stranded RNA-binding protein 11 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot exert its biology Features.
  • human double-stranded RNA-binding protein 11 can be added to a bioanalytical assay to determine whether a compound is a compound by measuring its effect on the interaction between human double-stranded MA-binding protein 11 and its receptor. Antagonist. Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds.
  • Peptide molecules capable of binding to human double-stranded RNA binding protein 11 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. When screening, 11 molecules of human double-stranded MA-binding protein should generally be labeled.
  • the present invention provides a method for producing an antibody using a polypeptide, a fragment, a derivative, an analog thereof, or a cell thereof as an antigen.
  • These antibodies can be polyclonal or monoclonal antibodies.
  • the invention also provides antibodies against human double-stranded RNA binding protein 11 epitopes. These antibodies include (but are not limited to): Dok Antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by Fab expression libraries.
  • Polyclonal antibodies can be produced by injecting human double-chain MA-binding protein 11 directly into immunized animals (such as rabbits, mice, rats, etc.).
  • immunized animals such as rabbits, mice, rats, etc.
  • a variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's Agent.
  • Techniques for preparing monoclonal antibodies to human double-stranded RNA-binding protein 11 include, but are not limited to, hybridoma technology (Kohler and Miste in. Nature, 1975, 256: 495-497), triple tumor technology, human beta cells Hybridoma technology, EBV-hybridoma technology, etc.
  • Chimeric antibodies that combine human constant regions with non-human-derived variable regions can be produced using known techniques (Morrison et al, PNAS, 1985, 81: 6851).
  • the existing technology for producing single-chain antibodies U.S. Pat No. 4946778, can also be used to produce single-chain antibodies against human double-chain RM-binding protein 11.
  • Antibodies against human double-stranded RNA-binding protein 11 can be used in immunohistochemistry to detect human double-stranded RNA-binding protein 11 in biopsy specimens.
  • Monoclonal antibodies that bind to human double-stranded RNA-binding protein 11 can also be labeled with radioisotopes and injected into the body to track their location and distribution.
  • This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
  • Antibodies can also be used to design immunotoxins that target a particular part of the body.
  • human double-stranded RNA-binding protein 11 high-affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
  • a common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
  • This hybrid antibody can be used to kill human double-stranded RNA binding protein 11 positive cell.
  • the antibodies of the present invention can be used to treat or prevent diseases related to human double-stranded RNA binding protein 11.
  • Administration of an appropriate dose of the antibody can stimulate or block the production or activity of human double-stranded RNA binding protein 11.
  • the invention also relates to a diagnostic test method for quantitatively and locally detecting the level of human double-stranded RNA binding protein 11.
  • tests are well known in the art and include FISH assays and radioimmunoassays.
  • the level of human double-stranded RNA binding protein 11 detected in the test can be used to explain the importance of human double-stranded RNA binding protein 11 in various diseases and to diagnose diseases in which human double-stranded RNA-binding protein 11 plays a role.
  • polypeptide of the present invention can also be used for peptide mapping analysis.
  • the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry.
  • the polynucleotide encoding human double-stranded RNA binding protein 11 can also be used for a variety of therapeutic purposes. Gene therapy technology can be used to treat abnormal cell proliferation, development or metabolism caused by the non-expression or abnormal / inactive expression of human double-stranded RNA binding protein 11.
  • Recombinant gene therapy vectors (such as viral vectors) can be designed to express variant human double-stranded RNA-binding protein 11 to inhibit endogenous human double-stranded RNA-binding protein 11 activity.
  • a variant human double-stranded RNA-binding protein 11 may be a shortened human double-stranded RNA-binding protein 11 lacking a signaling domain, and although it can bind to a downstream substrate, it lacks signaling activity.
  • recombinant gene therapy vectors can be used to treat diseases caused by abnormal expression or activity of human double-stranded A-binding protein 11.
  • Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to transfer a polynucleotide encoding human double-stranded RNA binding protein 11 into a cell.
  • Methods for constructing recombinant viral vectors carrying a polynucleotide encoding human double-stranded RNA-binding protein 11 can be found in existing literature (Sambrook, et al.).
  • a recombinant polynucleotide encoding human double-stranded RNA binding protein 11 can be packaged into liposomes and transferred into cells.
  • Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
  • a vector such as a virus, phage, or plasmid
  • Oligonucleotides including antisense RM and DNA
  • ribozymes that inhibit human double-stranded RNA binding protein 11 mRNA are also within the scope of the present invention.
  • a ribozyme is an enzyme-like RNA molecule that specifically decomposes specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation.
  • Antisense RNA, DNA, and ribozymes can be obtained using any existing RNA or DNA synthesis technology, such as solid-phase phosphoramidation synthesis of oligonucleotides.
  • Antisense RM molecules can be obtained by in vitro or in vivo transcription of DM sequences encoding the MA.
  • This DNA sequence is integrated downstream of the vector's RNA polymerase promoter.
  • it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the phosphorothioate or peptide bond instead of the phosphodiester bond is used for the ribonucleoside linkage.
  • the polynucleotide encoding human double-stranded RNA binding protein 11 can be used for diagnosis of diseases related to human double-stranded RNA binding protein 11.
  • a polynucleotide encoding human double-stranded RNA-binding protein 11 can be used to detect the expression of human double-stranded RNA-binding protein 11 or the abnormal expression of human double-stranded RM-binding protein 11 in a disease state.
  • the DNA sequence encoding human double-stranded RNA binding protein 11 can be used to hybridize biopsy specimens to determine the expression of human double-stranded RNA-binding protein 11.
  • Hybridization techniques include Sou thern blotting, Nor thern blotting, and in situ hybridization.
  • a part or all of the polynucleotides of the present invention can be used as probes to be fixed on a micro array or a DNA chip (also called a "gene chip") for analyzing differential expression analysis and gene diagnosis of genes in tissues.
  • Human double-stranded MA-binding protein 11 specific primers can be used to perform RM-polymerase chain reaction (RT-PCR) in vitro amplification to detect human double-stranded RNA-binding protein 11 transcription products.
  • RT-PCR RM-polymerase chain reaction
  • Detection of mutations in the human double-stranded RNA-binding protein 11 gene can also be used to diagnose human double-stranded RNA-binding protein 11-related diseases.
  • Human double-stranded RNA-binding protein 11 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type human double-stranded RNA-binding protein 11 DNA sequence.
  • Can Mutations are detected using well-known techniques such as Southern blotting, DM sequence analysis, PCR and in situ hybridization.
  • the mutation may affect the expression of the protein, so the Nor thern blotting and Western blotting can be used to indirectly determine whether there is a mutation in the gene.
  • the sequences of the invention are also valuable for chromosome identification.
  • the sequence specifically targets a specific position on a human chromosome and can hybridize to it.
  • specific sites for each gene on the chromosome need to be identified.
  • only a few chromosome markers based on actual sequence data are available for marking chromosome positions.
  • an important first step is to locate these DNA sequences on a chromosome.
  • PCR primers (preferably 15-35bp) are prepared according to cDM, and the sequences can be located on chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
  • PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
  • oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
  • Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.
  • Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step.
  • FISH Fluorescent in situ hybridization
  • the physical location of the sequence on the chromosome can be correlated with the genetic map data. These data can be found in, for example, V. Mckusick, Mendelian Iher Intance in Man (available online with Johns Hopkins University Welch Medi Library). Linkage analysis can then be used to determine the relationship between genes and diseases that have been mapped to chromosomal regions.
  • the difference in cDNA or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. Based on the resolution capabilities of current physical mapping and gene mapping technology, the CDM that is accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution Capacity and each 20kb corresponds to a gene).
  • polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be combined with Use after appropriate drug combination.
  • These carriers can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
  • the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients that do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
  • the present invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the present invention.
  • a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the present invention.
  • these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which reminders permit their administration on the human body by government agencies that manufacture, use, or sell them.
  • the polypeptide of the present invention can be used in combination with other therapeutic compounds.
  • the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
  • Human double-stranded RNA binding protein 11 is administered in an amount effective to treat and / or prevent a specific indication.
  • the amount and dose range of human double-stranded RNA-binding protein 11 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Veterinary Medicine (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Public Health (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Zoology (AREA)
  • Biophysics (AREA)
  • Immunology (AREA)
  • Toxicology (AREA)
  • Engineering & Computer Science (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Genetics & Genomics (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

L'invention concerne un nouveau polypeptide, une protéine humaine 11 associée à l'ARN à double hélice, et un polynucléotide codant ce polypeptide ainsi qu'un procédé d'obtention de ce polypeptide par des techniques recombinantes d'ADN. L'invention concerne en outre les applications de ce polypeptide dans le traitement de maladies, notamment de troubles du métabolisme des protéines. L'invention concerne aussi l'antagoniste agissant contre le polypeptide et son action thérapeutique ainsi que les applications de ce polynucléotide codant la protéine humaine 11 associée à l'ARN à double hélice.
PCT/CN2001/001148 2000-07-07 2001-07-02 Nouveau polypeptide, proteine humaine 11 associee a l'arn a double helice, et polynucleotide codant ce polypeptide WO2002020604A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU2002213746A AU2002213746A1 (en) 2000-07-07 2001-07-02 A new polypeptide- human double-stranded rna binding protein 11 and the polynucleotide encoding it

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN00119423A CN1333291A (zh) 2000-07-07 2000-07-07 一种新的多肽——人双链rna结合蛋白11和编码这种多肽的多核苷酸
CN00119423.2 2000-07-07

Publications (1)

Publication Number Publication Date
WO2002020604A1 true WO2002020604A1 (fr) 2002-03-14

Family

ID=4587670

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2001/001148 WO2002020604A1 (fr) 2000-07-07 2001-07-02 Nouveau polypeptide, proteine humaine 11 associee a l'arn a double helice, et polynucleotide codant ce polypeptide

Country Status (3)

Country Link
CN (1) CN1333291A (fr)
AU (1) AU2002213746A1 (fr)
WO (1) WO2002020604A1 (fr)

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
CLAVERIE J.M. AND MAKALOWSKI W.: "Alu alert", NATURE, vol. 371, no. 6500, 1994, pages 752 *
JACKSON F.R. ET AL.: "A novel zinc finger-containing RNA-binding protein conserved from fruitflies to humans", GENOMICS, vol. 41, no. 3, 1997, pages 444 - 452 *
NEWBY L.M. AND JACKSON F.R.: "Regulation of a specific circadian clock output pathway by lark, a putative RNA-binding protein with repressor activity", J. NEUROBIOL., vol. 13, 1996 *
SULSTON J.E. AND WATERSTON R.: "Toward a complete human genome sequence", GENOME RES., vol. 8, no. 11, 1998, pages 1097 - 1108 *

Also Published As

Publication number Publication date
AU2002213746A1 (en) 2002-03-22
CN1333291A (zh) 2002-01-30

Similar Documents

Publication Publication Date Title
WO2001072786A1 (fr) Nouveau polypeptide, facteur d'inhibition tumorale 63, et polynucleotide codant pour ce polypeptide
WO2001083538A1 (fr) Nouveau polypeptide, proteine humaine 36 du gene k-ras, et polynucleotide codant pour ce polypeptide
WO2002020604A1 (fr) Nouveau polypeptide, proteine humaine 11 associee a l'arn a double helice, et polynucleotide codant ce polypeptide
WO2001046240A1 (fr) Nouveau polypeptide, mariner transposase 19 humaine, et polynucleotide codant pour ce polypeptide
WO2001088084A2 (fr) Nouveau polypeptide, superoxyde dismutase 11, et polynucleotide codant pour ce polypeptide
WO2002012297A1 (fr) Nouveau polypeptide, proteine humaine 9 de liaison a la tropomoduline, et polynucleotide codant ce polypeptide
WO2001092518A1 (fr) Nouveau polypeptide, proteine humaine 9.5 associee a la ccr4, et polynucleotide codant ce polypeptide
WO2001071003A1 (fr) Nouveau polypeptide, serine protease humaine 8, et polynucleotide codant pour ce polypeptide
WO2001085752A1 (fr) Polynucleotide codant un peptide de myosine
WO2001079423A2 (fr) Nouveau polypeptide, proteine humaine bcr 10, et polynucleotide codant pour ce polypeptide
WO2001081382A1 (fr) Nouveau polypeptide, proteine hs1 humaine 16, et polynucleotide codant pour ce polypeptide
WO2001038364A1 (fr) Nouvelle proteine 68 regulatrice de la proteine phosphatase 1 polypeptidique-humaine, et polynucleotide codant le polypeptide
WO2001072785A1 (fr) Nouveau polypeptide, proteine humaine helice-boucle-helice 17 (b-hlh), et polynucleotide codant pour ce polypeptide
WO2001064868A1 (fr) Nouveau polypeptide, recepteur humain de cytokine 12, et polynucleotide codant pour ce polypeptide
WO2001075005A2 (fr) Nouveau polypeptide, sous-unite c de l'atpase pompe a protons vacuolaire (v-atpase) 12, et polynucleotide codant pour ce polypeptide
WO2001075059A2 (fr) Nouveau polypeptide, proteine humaine 11 de regulation de gtp, et polynucleotide codant pour ce polypeptide
WO2001047993A1 (fr) Nouveau polypeptide, proteine d'echange anionique 9, et polynucleotide codant pour ce polypeptide
WO2001081537A2 (fr) Nouveau polypeptide, sous-unite 49 humaine du facteur c(a1) 37kd de replication de l'adn, et polynucleotide codant pour ce polypeptide
WO2001066588A1 (fr) Nouveau polypeptide, facteur humain 1-12 de liaison intensive de leucocytes, et polynucleotide codant pour ce polypeptide
WO2002026971A1 (fr) Nouveau polypeptide, facteur de transcription humain lcr-f112.1, et polynucleotide codant ce polypeptide
WO2001075010A2 (fr) Nouveau polypeptide, proteine humaine de transduction nucleaire 25 contenant un domaine structurel atp/gtp, et polynucleotide codant pour ce polypeptide
WO2001083542A1 (fr) Nouveau polypeptide, proteine humaine p18 21, et polynucleotide codant pour ce polypeptide
WO2001040287A1 (fr) Nouveau polypeptide, sous-unite beta 10 de la pompe a sodium, et polynucleotide codant pour ce polypeptide
WO2001075029A2 (fr) Nouveau polypeptide, facteur humain 11 associe a nf-e2, et polynucleotide codant pour ce polypeptide
WO2001081571A1 (fr) Nouveau polypeptide, proteine humaine 11 contenant un site de conservation d'un recepteur lie a une proteine g, et polynucleotide codant pour ce polypeptide

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP