WO2001075010A2 - Nouveau polypeptide, proteine humaine de transduction nucleaire 25 contenant un domaine structurel atp/gtp, et polynucleotide codant pour ce polypeptide - Google Patents

Nouveau polypeptide, proteine humaine de transduction nucleaire 25 contenant un domaine structurel atp/gtp, et polynucleotide codant pour ce polypeptide Download PDF

Info

Publication number
WO2001075010A2
WO2001075010A2 PCT/CN2001/000287 CN0100287W WO0175010A2 WO 2001075010 A2 WO2001075010 A2 WO 2001075010A2 CN 0100287 W CN0100287 W CN 0100287W WO 0175010 A2 WO0175010 A2 WO 0175010A2
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
polynucleotide
binding domain
protein
gtp binding
Prior art date
Application number
PCT/CN2001/000287
Other languages
English (en)
Chinese (zh)
Other versions
WO2001075010A3 (fr
Inventor
Yumin Mao
Yi Xie
Original Assignee
Biowindow Gene Development Inc. Shanghai
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Biowindow Gene Development Inc. Shanghai filed Critical Biowindow Gene Development Inc. Shanghai
Priority to AU46323/01A priority Critical patent/AU4632301A/en
Publication of WO2001075010A2 publication Critical patent/WO2001075010A2/fr
Publication of WO2001075010A3 publication Critical patent/WO2001075010A3/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals

Definitions

  • the present invention belongs to the field of biotechnology. Specifically, the present invention describes a new polypeptide, a human nuclear conversion protein 25 containing an ATP / GTP binding domain, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and polypeptide. Background technique
  • Sperm formation is a process in which a gamete is gradually differentiated and finally forms a mature sperm cell.
  • the first stage of sperm formation is the beginning of sperm cell development, and this stage is related to changes in chromatin structure; the second stage is to form a complete, transcriptionally inactive non-nucleus through fusion and aggregation of chromatin Body structure.
  • This fusion process involves the transformation of two proteins.
  • the first transformation is a histidine transformation and replacement process mediated by many sperm cell-specific proteins, and these proteins are replaced by one or two prolines in the second transformation process.
  • These sperm cell-specific proteins play an important regulatory role in the second stage of mature sperm formation.
  • TP1, TP2, TP3, and TP4 four transforming proteins have been cloned from rats and mice. The study of TP1 and TP2 is more detailed. Subsequently, human and bovine TP1 proteins similar to the mouse TP1 protein were cloned from humans and cattle.
  • the bovine TP1 protein contains a cysteine residue, while the human TP1 protein is similar to the mouse TP1 and does not contain a cysteine residue. These proteins all play important regulatory roles in the spermatogenesis of these organisms.
  • Nuclear transfer protein 1 is one of the sperm cell-specific proteins. The conversion protein is composed of 54 amino acid residues, and its sequence is highly conserved in mammals. We found a 7 amino acid long signal fragment at the 28th to 34th amino acid positions. The amino acid sequence of this fragment is as follows: S-KRKYR-K. The sequence fragment contains one tyrosine residue and four serine residues. These four sites are the sites of protein phosphorylation.
  • the tyrosine site affects chromatin during protein-DNA interaction. Instability is required; and the phosphorylation of the serine site is also necessary for protein-DNA interactions, which may regulate the correct binding of the protein to specific sites in the DNA.
  • the domain is expressed differently Often, it will directly lead to the abnormal function of the protein during spermatogenesis, which will cause various related reproductive system diseases.
  • ATP or GTP binding motif is a ubiquitous domain in various ATP / GTP binding proteins. Some ATP or GTP-binding proteins contain this conserved mo tif sequence more or less. This motif has conservative characteristics. Sequence fragment: [AG]-X (4) -GK- [ST] (where X is any amino acid residue). The most conservative of these mo t i f is the g l yc i ne enriched region, which forms a flexible loop between the ⁇ line and the ⁇ helix. This curved loop usually reacts with a certain phosphate group on the nucleotide. The motif sequence is often referred to as the "A" consensus sequence or the P-loop.
  • This motif is usually responsible for binding with ATP and GTP in the body, providing the energy required for the protein to perform biological functions and stabilizing the structure of the protein in the body, assisting the protein to complete its normal physiological function. Its abnormal expression will directly lead to the abnormal expression and function of some proteins, which will cause developmental disorders of various tissues, tumors and cancers.
  • the expression profile of the polypeptide of the present invention is very similar to the expression profile of human ATP / GTP binding domain-containing nuclear conversion protein 1 0, so the functions of the two may also be similar.
  • the present invention is named a human ATP / GTP binding domain-containing nuclear conversion protein 25.
  • the human ATP / GTP binding domain-containing nuclear transfer protein 25 protein plays an important role in regulating important functions of the body, such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes. More human ATP / GTP binding domain-containing nuclear conversion protein 25 proteins need to be identified, especially the amino acid sequence of this protein. Isolation of the ATP / GTP binding domain-containing nuclear conversion protein 25 protein encoding genes in newcomers also provides a basis for research to determine its role in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so it is important to isolate its coding DNA. Disclosure of invention
  • Another object of the invention is to provide a polynucleotide encoding the polypeptide.
  • Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding a human ATP / GTP binding domain-containing nuclear transduction protein 25.
  • Another object of the present invention is to provide a method for producing a human ATP / GTP binding domain-containing nuclear conversion protein 25.
  • Another object of the present invention is to provide an antibody against a human-to-human ATP / GTP binding domain-containing nuclear conversion protein 25 of the polypeptide of the present invention.
  • Another object of the present invention is to provide mimetic compounds, antagonists, agonists, and inhibitors of the nuclear conversion protein 25 containing the ATP / GTP binding domain of the polypeptide of the present invention.
  • the present invention relates to an isolated polypeptide, which is of human origin, and includes: a polypeptide having the amino acid sequence of SEQ ID D. 2, or a conservative variant, biologically active fragment, or derivative thereof.
  • the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
  • sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 65-736 in SEQ ID NO: 1; and (b) a sequence having positions 1-876 in SEQ ID NO: 1 Sequence of bits.
  • the present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
  • the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
  • the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit human ATP / GTP binding domain-containing nucleoprotein 25 protein activity, which comprises utilizing the polypeptide of the invention.
  • the invention also relates to compounds obtained by this method.
  • the invention also relates to a method for detecting a disease or disease susceptibility related to abnormal expression of a human ATP / GTP binding domain-containing nuclear conversion protein 25 protein in vitro, comprising detecting the polypeptide or a polynucleotide sequence encoding the same in a biological sample Mutations, or the amount or biological activity of a polypeptide of the invention in a biological sample.
  • the invention also relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
  • the invention also relates to the polypeptides and / or polynucleotides of the invention in the preparation for the treatment of cancer, developmental Use of diseases or immune diseases or other drugs caused by abnormal expression of human ATP / GTP binding domain-containing nuclear converter protein 25.
  • Nucleic acid sequence refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
  • amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
  • amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
  • a protein or polynucleotide "variant" refers to a protein or polynucleotide that has one or more amino acid or nucleotide changes
  • the changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence.
  • Variants can have "conservative" changes, in which the amino acid substituted has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine.
  • Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
  • “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
  • Insertion refers to an alteration in the amino acid sequence or nucleotide sequence that results in an increase in one or more amino acids or nucleotides compared to a naturally occurring molecule.
  • Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
  • Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
  • immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response in appropriate animals or cells and to bind to specific antibodies.
  • An "agonist” refers to a molecule that, when combined with a human ATP / GTP binding domain-containing nuclear conversion protein 25, can cause the protein to change, thereby regulating the activity of the protein.
  • An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that binds to a human ATP / GTP binding domain-containing nuclear conversion protein 25.
  • Antagonist refers to a nuclear conversion protein that blocks or regulates a human ATP / GTP binding domain-containing 2 when it binds to a human ATP / GTP binding domain-containing nuclear conversion protein 2 5 A biologically or immunologically active molecule.
  • Antagonists and inhibitors can include proteins, nucleic acids, carbohydrates Or any other molecule that can bind to human ATP / GTP binding domain-containing nuclear converter protein 25.
  • “Regulation” refers to a change in the function of a human ATP / GTP binding domain-containing nuclear transfer protein 25, including an increase or decrease in protein activity, a change in binding characteristics, and a human ATP / GTP binding domain-containing nuclear conversion protein 25 Of any other biological, functional or immune properties.
  • Substantially pure 1 'means substantially free of other proteins, lipids, carbohydrates or other substances with which it is naturally associated.
  • Those skilled in the art can purify human ATP / GTP binding domains using standard protein purification techniques.
  • Nuclear transfer protein 25 Essentially pure human nuclear transfer protein 25 containing an ATP / GTP binding domain produces a single main band on a non-reducing polyacrylamide gel. Human nuclear transfer containing an ATP / GTP binding domain The purity of protein 25 peptide can be analyzed by amino acid sequence.
  • Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
  • sequence C-T-G-A
  • complementary sequence G-A-C-T.
  • the complementarity between two single-stranded molecules may be partial or complete.
  • the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of interactions between nucleic acid strands.
  • “Homology” refers to the degree of complementarity, and may be partially homologous or completely homologous.
  • Partial homology refers to a partially complementary sequence that at least partially inhibits the intersection of a completely complementary sequence with a target nucleic acid. This inhibition of cross-talk can be detected by cross-linking (Southern imprinting or Northern blotting, etc.) under conditions of reduced stringency.
  • Substantially homologous sequences or cross probes can compete and inhibit the binding of fully homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that conditions with reduced stringency allow non-specific binding, because conditions with reduced stringency require that two sequences bind to each other as either specific or selective interactions.
  • Percent identity refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALIGN program; (Laser software package, DNASTAR, Inc., Madison Wis.). The MEGALIGN sequence can compare two or more sequences according to different methods such as the Cluster method (Higgins, DG and PM Sharp (1988) Gene 73: 237-244). 0 The Cluster method divides each group by checking the distance between all pairs. The sequences are arranged in clusters. The clusters are then assigned in pairs or groups.
  • sequence A and sequence B The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula: The number of matching residues between sequence A and sequence X 100 The number of residues in sequence A-the number of spacer residues in sequence A Number of interval residues in a sequence B
  • Nucleic acid sequences can also be determined by the Cluster method or by methods known in the art such as Jotun Hein The percentage of identity between ⁇ (He in J., (1 99 0) Me t hod sin emzumo l ogy 1 8 3: 625-645).
  • Similarity refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
  • Amino acids used for conservative substitutions for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
  • Antisense refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence.
  • Antisense strand refers to a nucleic acid strand that is complementary to a “sense strand.”
  • Derivative refers to a chemical modification of HFP or a nucleic acid encoding it. This chemical modification may be a substitution of a hydrogen atom with a fluorenyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
  • Antibody refers to a complete antibody molecule and its fragments, such as Fa,? (& 1) ') 2 and? ⁇ It can specifically bind to human epitopes of nuclear conversion protein 25 containing ATP / GTP binding domain.
  • a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
  • isolated refers to the removal of a substance from its original environment (for example, its natural environment if it is naturally occurring).
  • a naturally-occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
  • Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not part of its natural environment, they are still isolated.
  • isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
  • polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances in the natural state .
  • isolated human ATP / GTP binding domain-containing nuclear conversion protein 25 means that human ATP / GTP binding domain-containing nuclear conversion protein 25 is substantially free of other proteins, lipids, Sugars or other substances. Those skilled in the art can purify human ATP / GTP binding domain-containing nuclear conversion proteins 25 using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of the human ATP / GTP binding domain-containing nucleoprotein 25 polypeptide can be analyzed by amino acid sequence analysis.
  • the present invention provides a novel polypeptide-to-human nuclear conversion protein 25 containing an ATP / GTP binding domain, which is basically composed of the amino acid sequence shown in SEQ ID NO: 2.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
  • the polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques. Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
  • the invention also includes fragments, derivatives, and analogs of human ATP / GTP binding domain-containing nuclear conversion protein 25.
  • fragment refers to a polypeptide that substantially maintains the same biological function or activity of the human ATP / GTP binding domain-containing nuclear conversion protein 25 of the present invention.
  • a fragment, derivative or analog of the polypeptide of the present invention may be: U) a type in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substituted An amino acid may or may not be encoded by a genetic code; or (II) such a type in which a group on one or more amino acid residues is replaced by another group to include a substituent; or ( ⁇ ⁇ ) like this A type in which a mature polypeptide is fused to another compound (such as a compound that extends the half-life of a polypeptide, such as polyethylene glycol); or (IV) a type of polypeptide sequence in which an additional amino acid sequence is fused into a mature polypeptide (such as the leader sequence or secreted sequence or the sequence used to purify this polypeptide or protease sequence) As explained herein, such fragments, 00 derivatives and analogs are considered to be within the knowledge of those skilled in the art.
  • the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
  • the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a polynucleotide sequence with a total length of 876 bases, and its open reading frames 65-736 encode 223 amino acids.
  • this peptide has a similar expression profile to human ATP / GTP binding domain-containing nuclear conversion protein 10, and it can be inferred that the human ATP / GTP binding domain-containing nuclear conversion protein 25 has human ATP / GTP-binding domain of nuclear conversion protein 10 functions similarly.
  • the polynucleotide of the present invention may be in the form of DNA or RNA.
  • DNA forms include cDNA, genomic DNA, or synthetic DNA.
  • DNA can be single-stranded or double-stranded.
  • DNA can be coding or non-coding.
  • the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
  • a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
  • the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
  • polynucleotide encoding a polypeptide refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.
  • the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
  • Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
  • an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
  • the invention also relates to a polynucleotide that hybridizes to the sequence described above (there is at least 50%, preferably 70% identity between the two sequences).
  • the present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions.
  • "strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60 ° C; or (2) Add a denaturant, such as 5 0 »/, for hybridization. (V / v) formamide, 0.1% calf serum / 0.1 ° /.
  • hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
  • the invention also relates to nucleic acid fragments that hybridize to the sequences described above.
  • the length of the "nucleic acid fragment” may include 10 nucleotides, preferably 3 ⁇ 4 20-30 nucleotides, more preferably 50-60 nucleotides, and most preferably ⁇ 100. More than nucleotides. Nucleic acid fragments can also be used in nucleic acid amplification techniques, such as PCR, to identify and / or isolate polynucleotides encoding human ATP / GTP binding domain-containing nuclear conversion protein 25.
  • polypeptides and polynucleotides in the present invention are preferably provided in an isolated form, and are more preferably purified.
  • polynucleotide sequence of the present invention encoding human ATP / GTP binding domain-containing nuclear conversion protein 25 can be obtained by various methods.
  • polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
  • the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.
  • genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences.
  • the standard method for isolating cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage CDM library. There are many mature techniques for extracting mRNA, and kits are also commercially available (Qiagene;).
  • cDNA libraries are also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989).
  • Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
  • genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DNA-RNA hybridization; (2) the presence or absence of marker gene functions; (3) the determination of human ATP / GTP binding domain-containing nuclear conversion protein 25 The level of transcripts; (4) Detecting protein products expressed by genes by immunological techniques or by measuring biological activity. The above methods can be used alone or in combination.
  • the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
  • the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
  • the probe used here is usually a DM sequence chemically synthesized based on the gene sequence information of the present invention.
  • the genes or fragments of the present invention can of course be used as probes.
  • DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
  • the protein product of human ATP / GTP binding domain-containing nucleoprotein 25 gene expression can be detected by immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA). Wait.
  • immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA). Wait.
  • a method of applying a PCR technique to amplify DNA / RNA is preferably used to obtain the gene of the present invention.
  • the RACE method RACE-Rapid Amplification of cDNA Ends
  • the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Select and synthesize using conventional methods.
  • the amplified DNA / RM fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
  • polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, sequencing must be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
  • the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using a human ATP / GTP binding domain-containing nuclear conversion protein 25 coding sequence, and produced by recombinant technology A method of a polypeptide according to the invention.
  • a polynucleotide sequence encoding a human ATP / GTP binding domain-containing nuclear conversion protein 25 can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
  • vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
  • Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al.
  • any plasmid and vector can be used to construct a recombinant expression vector.
  • An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
  • DM sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis.
  • promoters are: the lac or trp promoter of E.
  • coli the PL promoter of lambda phage
  • eukaryotic promoters include the CMV immediate early promoter, the HSV thymidine kinase promoter, the early and late SV40 promoters, Retroviral LTRs and other known promoters that control the expression of genes in prokaryotic or eukaryotic cells or their viruses.
  • Expression vectors also include ribosome binding sites and transcription terminators for translation initiation. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells.
  • Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription.
  • Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers and adenovirus enhancers on the late side of the origin of replication.
  • the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • GFP fluorescent protein
  • tetracycline or ampicillin resistance for E. coli.
  • a polynucleotide encoding a human ATP / GTP binding domain-containing nuclear conversion protein 25 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a polynucleotide containing the polynucleotide or the recombinant vector. Genetically engineered host cells.
  • host cell refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell.
  • a prokaryotic cell such as a bacterial cell
  • a lower eukaryotic cell such as a yeast cell
  • a higher eukaryotic cell such as a mammalian cell.
  • Representative examples are: E. coli, Streptomyces; bacterial cells such as Salmonella typhimurium; fungal cells such as yeast; plant cells; insect cells such as fly S2 or Sf9; animal cells such as CH0, COS, or Bowes melanoma cells.
  • Transformation of a host cell with a DM sequence according to the present invention or a recombinant vector containing the DNA sequence can be performed by conventional techniques well known to those skilled in the art.
  • the host is a prokaryote such as E. coli
  • competent cells capable of DNA uptake can be in the exponential growth phase were harvested, treated with (Method 12, using the procedure well known in the art.
  • Alternative is MgC l 2.
  • transformation can also be performed by electroporation.
  • the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposomes Packaging, etc.
  • the polynucleotide sequence of the present invention can be used to express or produce recombinant human ATP / GTP binding domain-containing nuclear conversion protein 25 by conventional recombinant DNA technology (Scence, 1984; 224: 1431). Generally there are the following steps:
  • the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
  • a suitable method such as temperature conversion or chemical induction
  • the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell.
  • recombinant proteins can be isolated and purified by various separation methods using their physical, chemical, and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
  • conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromat
  • FIG. 1 is a comparison diagram of gene chip expression profiles of the present inventor's ATP / GTP binding domain-containing nuclear conversion protein 25 and human ATP / GTP binding domain-containing nuclear conversion protein 10.
  • the upper figure is a graph of the human ATP / GTP binding domain-containing nuclear conversion protein 25, and the lower sequence is the human ATP / GTP-binding domain 10 nuclear expression protein.
  • Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of an isolated human ATP / GTP binding domain-containing nuclear transfer protein 25. 25kDa is the molecular weight of the protein. The arrow indicates the isolated protein band. The best way to implement the invention
  • Total human fetal brain RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform.
  • Poly (A) mRNA was isolated from total RNA using Quik mRNA Isolation Kit (Qiegene). 2ug poly (A) mRNA is reverse transcribed to form cDNA. Use Smart cDNA Cloning Kit (purchased from Clontech). The 0 ⁇ fragment was inserted into the multicloning site of pBSK (+) vector (Clontech), and transformed into DH5 ⁇ to form a cDNA library.
  • Dye terminate cycle react ion sequencing kit Perkin-Elmer
  • ABI 377 automatic sequencer Perkin-Elmer
  • the determined cDNA sequence was compared with the existing public DM sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 0280g03 was new DNA.
  • a series of primers were synthesized to determine the inserted cDNA fragments of the clone in both directions.
  • Primer 1 5'- GTAGGAGGGTGCAGACTGCGGGCT -3 '(SEQ ID NO: 3)
  • Primer2 5'- GGGAACCACGCGTTTTAATCAACG -3, (SEQ ID NO: 4)
  • Primerl is a forward sequence starting at lbp of the 5th end of SEQ ID NO: 1;
  • Primer2 is the 3 'end reverse sequence in SEQ ID NO: 1.
  • Amplification conditions 50 mmol / L KC1, 10 mmol / L Tris-Cl, (pH 8.5), 1.5 mmol / L MgCl 2 , 200 ⁇ / L dNTP, lOpmol primer, 1U in a reaction volume of 50 ⁇ 1 Taq DNA polymerase (Clontech).
  • the reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) for 25 cycles under the following conditions: 94 ° C 30sec; 55 ° C 30sec; 72. C 2min.
  • RT-PCR set ⁇ -act in as a positive control and template blank as a negative control.
  • the amplified product was purified using a QIAGEN kit and ligated to a PCR vector using a TA cloning kit (Invitrogen).
  • the DNA sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as 1-876bp shown in SEQ ID NO: 1.
  • Example 3 Northern blot analysis of human ATP / GTP binding domain-containing nuclear transfer protein 25 gene expression:
  • RNA extraction in one step [Anal. Biochem 1987, 162, 156-159] 0
  • This method involves acid guanidinium thiocyanate-chloroform extraction. That is, the tissue is homogenized with 4M guanidinium isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1 ), Mix and centrifuge. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water.
  • a 32P-labeled probe (approximately 2 x 10 6 cpm / ml) was hybridized with a nitrocellulose membrane to which RNA was transferred at 42 ° C overnight in a solution containing 50% formamide-25mM KH 2 P0 4 ( ⁇ 7.4)-5 X SSC-5 X Denhardt's solution and 200 ⁇ g / ml salmon sperm DNA. After hybridization, the filter was placed at 1 X SSC-0.1 ° /. Wash in SDS at 55 ° C for 30 min. Then, Phosphor Imager was used for analysis and quantification.
  • Example 4 In vitro expression, isolation, and purification of recombinant human ATP / GTP binding domain-containing nuclear converter protein 25 Based on the sequence of the coding region shown in SEQ ID NO: 1 and Figure 1, a pair of specific amplification primers was designed Foreword The columns are as follows:
  • Primer3 5'- CCCCATATGATGGGACCCTCAGCCCGTCCTGTA -3 '(Seq ID No: 5)
  • Primer4 5'- CATGGATCCTCACTCTGCCGTTCTGCAGGGTGA -3, (Seq ID No: 6)
  • the 5' ends of these two primers contain Ndel and BamHI restriction sites, respectively.
  • the coding sequences for the 5 'and 3' ends of the gene of interest are followed, respectively.
  • the Ndel and BamHI restriction sites correspond to the selectivity within the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865.3). Digestion site.
  • the pBS-0280g03 plasmid containing the full-length target gene was used as a template for the PCR reaction.
  • the PCR reaction conditions were as follows: a total volume of 50 ⁇ 1 containing 10 pg of pBS- 0280g03 plasmid, 1 ⁇ 1 ⁇ 11161 "-3 and?] ⁇ 11161"-4 points and (11) 10 11101, Advantage polymerase Mix (Clontech) Product) 1 ⁇ 1.
  • Cycle parameters 94 ° C 20s, 60 ° C 30s, 68. C 2 min, a total of 25 cycles.
  • Ndel and BamHI were used to double-enzyme the amplification product and plasmid pET-28 (+), respectively.
  • the ligation product was transformed into Escherichia coli DH5 ⁇ by the calcium chloride method, cultured on LB plates containing kanamycin (final concentration 30 g / ml) overnight, and then colonized The positive clones were screened by PCR and sequenced. The positive clones (pET-0280g03) with the correct sequence were selected. The recombinant plasmid was transformed into E. coli BL21 (DE3) plySs (product of Novagen) using the calcium chloride method.
  • the host strain BL21 (pET-0280g03) was cultured at 37 ° C to the logarithmic growth phase, and IPTG was added to a final concentration of 1 ol / L, and the culture was continued for 5 hours. Collect the bacterial cells, sonicate the bacteria, and centrifuge to collect the supernatant. Histidine (6His-Tag) binding affinity chromatography His. Bind Quick Cartridge (product of Novagen) was chromatographed to obtain a purified nuclear conversion protein 25 containing the ATP / GTP binding domain of the target protein.
  • a peptide synthesizer (product of PE) was used to synthesize the following human ATP / GTP binding domain-containing nuclear conversion protein 25-specific peptides:
  • NH2-Met-Gly-Pro-Ser-Ala-Arg-Pro-Val-His-Gly-Ala-Gly-Cys-Thr-Val-C00H (SEQ ID NO: 7).
  • the polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex, respectively.
  • hemocyanin and bovine serum albumin For methods, see: Avrameas, et al. Immunochemistry, 1969; 6: 43. Rabbits were immunized with 1 ⁇ 2 g of the hemocyanin-polypeptide complex plus complete Freund's adjuvant, and 15 days later the hemocyanin-polypeptide complex plus incomplete Freund's adjuvant was used to boost immunity once.
  • a titer plate coated with 15 ⁇ g / ml bovine serum albumin peptide complex was used as an ELISA to determine the antibody titer in rabbit serum.
  • Total IgG was isolated from antibody-positive rabbit serum using protein A-Sepharose.
  • the peptide was bound to a cyanogen bromide-activated Sepharose4B column, and the total IgG Anti-peptide antibodies were isolated.
  • the immunoprecipitation method proved that the purified antibody could specifically bind to human ATP / GTP binding domain-containing nuclear conversion protein 25.
  • Example 6 Application of the polynucleotide fragment of the present invention as a hybridization probe
  • Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
  • the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
  • the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
  • the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method.
  • Filter hybridization methods include dot blotting, Sou thern imprinting, Nor thern blotting, and copying methods. They are all used to fix the polynucleotide sample to be tested on the filter and then hybridize using basically the same steps.
  • the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer to saturate the non-specific binding site of the sample on the filter with the carrier and the synthesized polymer.
  • the pre-hybridization solution is then replaced with a hybridization buffer containing labeled probes and incubated to hybridize the probes to the target nucleic acid.
  • the unhybridized probes are removed by a series of membrane washing steps.
  • This embodiment uses higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals.
  • the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention;
  • the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
  • the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
  • oligonucleotide fragments for use as hybridization probes from the polynucleotide SEQ ID NO: 1 of the present invention should follow the following principles and several aspects to be considered:
  • the preferred range of probe size is 18-50 nucleotides
  • Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements Region for homology comparison, if the homology with non-target molecular region is greater than 85% After 15 consecutive bases are identical, the primary probe should not be used in general;
  • Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
  • Probe 2 which belongs to the second type of probe, is equivalent to the replacement mutant sequence (41Nt) of the gene fragment or its complementary fragment of SEQ ID NO: 1:
  • PBS phosphate buffered saline
  • step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
  • NC membranes nitrocellulose membranes
  • the sample membrane was placed in a plastic bag, and 3-lOmg prehybridization solution (10xDenhardt's; 6xSSC 0.1mg / ml CT DNA (calf thymus DM)) was added. After the bag was sealed, it was shaken in a 68 ° C water bath for 2 hours.
  • probe 1 can be used to qualitatively and quantitatively analyze the presence and differential expression of the polynucleotide of the present invention in different tissues.
  • Gene chip or DNA microarray is a new technology that many national laboratories and large pharmaceutical companies are currently developing and developing. It refers to the orderly and high-density arrangement of large numbers of target gene fragments on glass, The data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software to achieve the purpose of rapid, efficient, and high-throughput analysis of biological information.
  • the polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research of new gene functions; search for and screen new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases .
  • the specific method steps have been reported in the literature, for example, refer to the literature DeRisi, JL, Lyer, V. & Brown, P.0. (1997) Science 278, 680-686. And the literature Helle, RA, Schema, M. , Chai, A., Shalom, D., (1997) PNAS 94: 2150-2155.
  • a total of 4,000 polynucleotide sequences of various full-length cDNAs are used as target DNA, including the polynucleotide of the present invention. They were amplified by PCR respectively. After purification, the amplified product was adjusted to a concentration of about 500 ng / ul, and spotted on a glass medium using a Cartesian 7500 spotter (purchased from Cartesian, USA). The distance is 280 ⁇ . The spotted slides were hydrated, dried, and cross-linked in a purple diplomatic coupling instrument. After elution, the DNA was fixed on a glass slide to prepare a chip. The specific method steps have been reported in the literature in various ways. The post-spot processing steps of this embodiment are:
  • the probes from the two types of tissues and the chip were hybridized in a UniHyb TM Hybridization Solution (purchased from TeleCheni) for 16 hours, and washed with a washing solution (1 x SSC, 0.2 SDS) at room temperature and scanned with ScanArray 3000.
  • the instrument purchased from General Scanning Company, USA
  • the scanned images were analyzed and processed with Imagene software (Biodiscovery Company, USA) to calculate the Cy3 / Cy5 ratio of each point.
  • the above specific tissues are thymus, testis, muscle, spleen, lung, skin, thyroid, liver, PMA + Ecv304 cell line, PMA-Ecv304 cell line, non-starved L02 cell line, Arsenic stimulated the L02 cell line and prostate tissue for 1 hour.
  • polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat malignant tumors, adrenal deficiency, skin diseases, various inflammations, HIV infections and immune diseases.
  • the first stage of mammalian spermatogenesis is the beginning of sperm cell development, and the second stage is the formation of a complete, transcriptionally inactive non-nucleosome structure through fusion and aggregation of chromatin.
  • This fusion process involves the conversion of proteins.
  • These specific conversion proteins play an important regulatory role in the second stage of mature sperm formation. Abnormal expression of these proteins will cause individuals to fail to form normal, mature sperm, which will cause various related reproductive system diseases [Frederic CHIRAT, Arlette MARTINAGE et al., Eur. J. Biochem. 1991, 198: 13-20].
  • Nuclear transfer protein 1 is a kind of sperm cell specific protein, which contains a specific nuclear transfer protein 1 domain. Abnormal expression of this domain will directly cause the protein to malfunction during sperm formation, which will trigger various related reproduction. Systemic diseases and disorders of embryonic development.
  • the expression of the human ATP / GTP binding domain-containing nuclear conversion protein 25 in the present invention is abnormal. Will produce a variety of diseases, especially diseases of the reproductive system and disorders of embryonic development, including but not limited to:
  • testicular and epididymal inflammation testicular tumors such as seminoma, embryonic cancer, teratoma, chorionic carcinoma, yolk sac tumor, testicular stromal cell tumor, epididymal tumor, etc.
  • Fetal developmental disorders spina bifida, craniocerebral fissure, anencephaly, cephalocele, foramen forebral malformation, Down syndrome, congenital hydrocephalus, aqueduct malformation, dwarfism of cartilage hypoplasia, dysplasia of the spine Disease, pseudochondral dysplasia, Langer-G i ed i on syndrome, funnel chest, gonad hypoplasia, congenital adrenal hyperplasia, upper urethral tract, crypt, accompanied by short stature such as Conrad i syndrome and Danbo l tC l os s syndrome, congenital glaucoma or cataract, congenital lens abnormality, congenital blepharoplasia, retinal dysplasia, congenital optic nerve atrophy, congenital sensorineural hearing loss, cracked hands and cracked feet, Teratosis, Wi lli ams syndrome, Al ag ille syndrome, Bayer syndrome, etc.
  • polypeptide of the present invention as well as its antagonists, agonists and inhibitors, can be directly used in the treatment of diseases, for example, it can treat various diseases, especially diseases of the reproductive system and disorders of embryonic development.
  • the invention also provides methods for screening compounds to identify agents that increase (agonist) or inhibit (antagonist) human ATP / GTP binding domain-containing nuclear converter proteins 25.
  • Agonists enhance human ATP / GTP binding domain-containing nuclear conversion protein 25 to stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
  • a mammalian cell or a membrane preparation expressing a human ATP / GTP binding domain-containing nuclear conversion protein 25 can be cultured with a labeled human ATP / GTP binding domain-containing nuclear conversion protein 25 in the presence of a drug. . The ability of the drug to increase or suppress this interaction is then determined.
  • Antagonists of human ATP / GTP binding domain-containing nucleoprotein 25 include selected antibodies, compounds, receptor deletions, and the like. Antagonists of human ATP / GTP binding domain-containing nuclear conversion protein 25 can bind to human ATP / GTP binding domain-containing nuclear conversion protein 25 and eliminate its function, or inhibit the production of the polypeptide, or with the polypeptide The active site binding prevents the polypeptide from performing biological functions.
  • human ATP / GTP binding domain-containing nuclear conversion protein 25 can be added to the bioanalytical assay, and the human ATP / GTP binding domain-containing nuclear conversion protein 25 and its receptors can be determined by measuring the compound.
  • Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds.
  • Polypeptide molecules capable of binding to human ATP / GTP binding domain-containing nuclear conversion protein 25 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. During screening, 25 nucleoproteins containing human ATP / GTP binding domains should be labeled.
  • the present invention provides a method for producing an antibody using a polypeptide, a fragment, a derivative, an analog thereof, or a cell thereof as an antigen.
  • These antibodies can be polyclonal or monoclonal antibodies.
  • the present invention also provides antibodies against human ATP / GTP binding domain-containing nuclear conversion protein 25 epitopes. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by Fab expression libraries.
  • Polyclonal antibodies can be produced by injecting human ATP / GTP binding domain-containing nuclear conversion protein 25 directly into immunized animals (such as rabbits, mice, rats, etc.).
  • immunized animals such as rabbits, mice, rats, etc.
  • a variety of adjuvants can be used to enhance immune responses, including But it is not limited to Freund's adjuvant.
  • Techniques for preparing human monoclonal antibodies containing ATP / GTP binding domain-containing nuclear transfer protein 25 include, but are not limited to, hybridoma technology (Kohler and Mil stein. Nature, 1975, 256: 495-497), triple tumor technology, human B -Cell hybridoma technology, EBV -hybridoma
  • Antibodies against human ATP / GTP binding domain-containing nuclear conversion protein 25 antibodies can be used in immunohistochemical techniques to detect human ATP / GTP binding domain-containing nuclear conversion protein 25 in biopsy specimens.
  • Monoclonal antibodies that bind to human ATP / GTP binding domain-containing nucleoprotein 25 can also be labeled with radioisotopes and injected into the body to track their location and distribution.
  • This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
  • Antibodies can also be used to design immunotoxins that target a particular part of the body.
  • human ATP / GTP binding domain-containing nucleoprotein 25 high affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
  • a common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
  • This hybrid antibody can be used to kill human ATP / GTP binding domain-containing Nuclear transfer protein 25 positive cells.
  • the antibodies of the present invention can be used to treat or prevent diseases associated with human ATP / GTP binding domain-containing nuclear transduction protein 25.
  • Administration of an appropriate dose of the antibody can stimulate or block the production or activity of human ATP / GTP binding domain-containing nuclear converter protein 25.
  • the invention also relates to a diagnostic test method for quantitatively and locally detecting the level of human nuclear transfer protein 25 containing an ATP / GTP binding domain.
  • tests are well known in the art and include FISH assays and radioimmunoassays.
  • the ATP / GTP binding domain-containing nuclear transfer protein 25 level detected in the test can be used to explain the importance of human ATP / GTP binding domain-containing nuclear transfer protein 25 in various diseases and to diagnose humans. Diseases in which the ATP / GTP binding domain-containing nuclear converter protein 25 functions.
  • the polypeptide of the present invention can also be used for peptide mapping analysis. For example, the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
  • Polynucleotides encoding human ATP / GTP binding domain-containing nuclear conversion protein 25 can also be used for a variety of therapeutic purposes.
  • Gene therapy technology can be used to treat abnormal cell proliferation, development, or metabolism caused by the non-expression or abnormal / inactive expression of human ATP / GTP binding domain-containing nuclear converter protein 25.
  • Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated human ATP / GTP binding domain-containing nucleoprotein 25 to inhibit endogenous human ATP / GTP binding domain-containing nucleoprotein 25 active.
  • a mutated human ATP / GTP binding domain-containing nuclear conversion protein 25 may be a shortened human ATP / GTP binding domain-containing nuclear conversion protein 25 that lacks a signaling domain. Substrate binding, but lacks signaling activity. Therefore, the recombinant gene therapy vector can be used for treating diseases caused by abnormal expression or activity of nuclear conversion protein 25 containing ATP / GTP binding domain.
  • Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to transfer a polynucleotide encoding a human ATP / GTP binding domain-containing nuclear conversion protein 25 to a cell Inside.
  • a method for constructing a recombinant viral vector carrying a polynucleotide encoding a human ATP / GTP-binding domain-containing nuclear-converting protein 25 can be found in the existing literature (Sambrook, et al.).
  • a recombinant polynucleotide encoding human ATP / GTP binding domain-containing nuclear conversion protein 25 can be packaged into liposomes and transferred into cells.
  • Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
  • a vector such as a virus, phage, or plasmid
  • Oligonucleotides that inhibit human ATP / GTP binding domain-containing nucleoprotein 25 mRNA
  • RNA and DNA are also within the scope of the invention.
  • a ribozyme is an enzyme-like RNA molecule that can specifically decompose specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA and performs endonucleation.
  • Antisense RNA, DNA, and ribozymes can be obtained using any existing RNA or DNA synthesis technology. For example, solid-phase phosphate amide chemical synthesis to synthesize oligonucleotides has been widely used.
  • Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA. This DNA sequence is integrated downstream of the vector's RNA polymerase promoter.
  • nucleic acid molecule In order to increase the stability of the nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the phosphorothioate or peptide bond rather than the phosphodiester bond is used for the ribonucleoside linkage.
  • Polynucleotides encoding human ATP / GTP binding domain-containing nuclear transfer protein 25 can be used to diagnose diseases related to human ATP / GTP binding domain-containing nuclear converting protein 25.
  • Coder with ATP / GTP junction Polynucleotide-binding domain-converting nuclear protein 25 can be used to detect the expression of human ATP / GTP-binding domain-containing nuclear-converting protein 25 or human ATP / GTP-binding domain-containing nuclear-converting protein 25 Abnormal expression.
  • a DNA sequence encoding a human ATP / GTP binding domain-containing nuclear transfer protein 25 can be used to hybridize biopsy specimens to determine the expression of human ATP / GTP binding domain-containing nuclear transfer protein 25.
  • Hybridization techniques include Sout hern blotting, Nor t hern blotting, and in situ hybridization. These techniques and methods are publicly available and mature, and related kits are commercially available.
  • a part or all of the polynucleotides of the present invention can be used as probes to be fixed on a microarray (Microcroix) or a DNA chip (also known as a "gene chip") for analyzing differential expression analysis of genes in tissues and Genetic diagnosis.
  • RNA-polymerase chain reaction (RT-PCR) in vitro amplification using human ATP / GTP binding domain-containing nuclear transfer protein 25 specific primers can also detect human ATP / GTP binding domain-containing nuclear transfer protein 25 transcription products .
  • Detection of mutations in the human ATP / GTP binding domain-containing nucleoprotein 25 gene can also be used to diagnose human ATP / GTP binding domain-containing nucleoprotein 25 related diseases.
  • Human ATP / GTP binding domain-containing nuclear conversion protein 25 mutant forms include point mutations, translocations, deletions, recombinations, and others compared to normal wild-type human ATP / GTP binding domain-containing nuclear conversion protein 25 DNA sequences Any exceptions etc. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression. Therefore, the Nort Hern blotting and Western blotting can be used to indirectly determine the presence or absence of mutations in a gene.
  • the sequences of the invention are also valuable for chromosome identification.
  • the sequence specifically targets a specific position on a human chromosome and can hybridize to it.
  • specific sites for each gene on the chromosome need to be identified.
  • only a few chromosome markers based on actual sequence data are available for marking chromosome positions.
  • an important first step is to locate these DNA sequences on a chromosome.
  • PCR primers (preferably 1-35 bp) are prepared based on cDNA, and the sequences can be located on chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
  • PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
  • oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
  • Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and hybrid pre-selection to construct chromosome-specific cDM libraries.
  • Fluorescent in situ hybridization (FI SH) of cDNA clones with metaphase chromosomes can be refined in one step Perform chromosomal mapping accurately.
  • FI SH Fluorescent in situ hybridization
  • the physical location of the sequence on the chromosome can be correlated with the genetic map data. These data can be found in, for example, V. Mckusick, Mendel ian Inheritance in Man (available online with Johns Hopkins University Welch Medical Library). Linkage analysis can then be used to determine the relationship between genes and diseases that have been mapped to chromosomal regions.
  • the difference in cDNA or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. Based on the resolution capabilities of current physical mapping and gene mapping technology, the CDM that is accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).
  • the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
  • suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
  • the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
  • the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell.
  • the polypeptides of the invention can be used in combination with other therapeutic compounds.
  • the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
  • Human ATP / GTP binding domain-containing nucleoprotein 25 is administered in an amount effective to treat and / or prevent a specific indication.
  • the amount and dose range of human ATP / GTP binding domain-containing nuclear converter protein 25 to be administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Toxicology (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

L'invention concerne un nouveau polypeptide, une protéine humaine de transduction nucléaire 25 contenant un domaine structurel ATP/GTP, et un polynucléotide codant pour ce polypeptide ainsi qu'un procédé d'obtention de ce polypeptide par des techniques recombinantes d'ADN. L'invention concerne en outre les applications de ce polypeptide dans le traitement de maladies, notamment des tumeurs malignes, de l'hémopathie, de l'infection par VIH, de maladies immunitaires et de diverses inflammations. L'invention concerne aussi l'antagoniste agissant contre le polypeptide et son action thérapeutique ainsi que les applications de ce polynucléotide codant pour la protéine humaine de transduction nucléaire 25 contenant un domaine structurel ATP/GTP.
PCT/CN2001/000287 2000-03-07 2001-02-26 Nouveau polypeptide, proteine humaine de transduction nucleaire 25 contenant un domaine structurel atp/gtp, et polynucleotide codant pour ce polypeptide WO2001075010A2 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU46323/01A AU4632301A (en) 2000-03-07 2001-02-26 A novel polypeptide, human nuclear transduction protein 25 containing a structural atp/gtp domain

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN00111913.3 2000-03-07
CN 00111913 CN1312270A (zh) 2000-03-07 2000-03-07 一种新的多肽——人含atp/gtp结合结构域的核转换蛋白25和编码这种多肽的多核苷酸

Publications (2)

Publication Number Publication Date
WO2001075010A2 true WO2001075010A2 (fr) 2001-10-11
WO2001075010A3 WO2001075010A3 (fr) 2002-03-07

Family

ID=4581809

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2001/000287 WO2001075010A2 (fr) 2000-03-07 2001-02-26 Nouveau polypeptide, proteine humaine de transduction nucleaire 25 contenant un domaine structurel atp/gtp, et polynucleotide codant pour ce polypeptide

Country Status (3)

Country Link
CN (1) CN1312270A (fr)
AU (1) AU4632301A (fr)
WO (1) WO2001075010A2 (fr)

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
DATABASE GENBANK [Online] 18 February 2000 POUSTKA A. ET AL. Retrieved from NCBI, accession no. GI:5911996 Database accession no. AL117495 *

Also Published As

Publication number Publication date
AU4632301A (en) 2001-10-15
WO2001075010A3 (fr) 2002-03-07
CN1312270A (zh) 2001-09-12

Similar Documents

Publication Publication Date Title
WO2001072786A1 (fr) Nouveau polypeptide, facteur d'inhibition tumorale 63, et polynucleotide codant pour ce polypeptide
WO2001083538A1 (fr) Nouveau polypeptide, proteine humaine 36 du gene k-ras, et polynucleotide codant pour ce polypeptide
WO2001075010A2 (fr) Nouveau polypeptide, proteine humaine de transduction nucleaire 25 contenant un domaine structurel atp/gtp, et polynucleotide codant pour ce polypeptide
WO2001072799A1 (fr) Nouveau polypeptide, proteine humaine a doigt de zinc 9, et polynucleotide codant pour ce polypeptide
WO2001079423A2 (fr) Nouveau polypeptide, proteine humaine bcr 10, et polynucleotide codant pour ce polypeptide
WO2001064721A1 (fr) Nouveau polypeptide, adenosine triphosphatase 30, et polynucleotide codant pour ce polypeptide
WO2001081594A1 (fr) Nouveau polypeptide, proteine pax humaine 17, et polynucleotide codant pour ce polypeptide
WO2001070796A1 (fr) Nouveau polypeptide, proteine humaine a doigt de zinc 78, et polynucleotide codant pour ce polypeptide
WO2001079434A2 (fr) Nouveau polypeptide, signal peptidase humaine 10, et polynucleotide codant pour ce polypeptide
WO2001064719A1 (fr) Nouveau polypeptide, facteur de regulation humain negatif 21 de la mort programmee des cellules, et polynucleotide codant pour ce polypeptide
WO2001090348A1 (fr) Nouveau polypeptide, chaine lourde de myoglobuline humaine 11, et polynucleotide codant ce polypeptide
WO2001079280A1 (fr) Nouveau polypeptide, proteine humaine 16 associee au represseur catabolique du carbone, et polynucleotide codant pour ce polypeptide
WO2001072800A1 (fr) Nouveau polypeptide, proteine humaine d'echange nucleotidique 13 contenant un domaine de liaison atp/gtp, et polynucleotide codant pour ce polypeptide
WO2001074868A1 (fr) Nouveau polypeptide, proteine humaine a doigt de zinc 10, et polynucleotide codant pour ce polypeptide
WO2001064918A1 (fr) Nouveau polypeptide, proteine humaine de translocation nucleaire 12 contenant un domaine de liaison atp/gtp, et polynucleotide codant pour ce polypeptide
WO2001081537A2 (fr) Nouveau polypeptide, sous-unite 49 humaine du facteur c(a1) 37kd de replication de l'adn, et polynucleotide codant pour ce polypeptide
WO2001072785A1 (fr) Nouveau polypeptide, proteine humaine helice-boucle-helice 17 (b-hlh), et polynucleotide codant pour ce polypeptide
WO2001068692A1 (fr) Nouveau polypeptide, proteine humaine conjuguee du cancer de la retine 9, et polynucleotide codant pour ce polypeptide
WO2001064732A1 (fr) Nouveau polypeptide, facteur humain associe a la retrotransposition 14, et polynucleotide codant pour ce polypeptide
WO2001066580A1 (fr) Nouveau polypeptide, proteine humaine 13 a doigt de zinc, et polynucleotide codant pour ce polypeptide
WO2001081571A1 (fr) Nouveau polypeptide, proteine humaine 11 contenant un site de conservation d'un recepteur lie a une proteine g, et polynucleotide codant pour ce polypeptide
WO2001079431A2 (fr) Nouveau polypeptide, proteine humaine d'interaction 15 avec la proteine huntingtine, et polynucleotide codant pour ce polypeptide
WO2001068691A1 (fr) Nouveau polypeptide, fd11 humaine, et polynucleotide codant pour ce polypeptide
WO2001081399A1 (fr) Nouveau polypeptide, proteine pax humaine 14, et polynucleotide codant pour ce polypeptide
WO2001070983A1 (fr) Nouveau polypeptide, proteine antigene prostatique specifique membranaire 9, et polynucleotide codant pour ce polypeptide

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
AK Designated states

Kind code of ref document: A3

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A3

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase in:

Ref country code: JP