WO2001090175A1 - Nouveau polypeptide, chaperonine humaine cpn60 15, et polynucleotide codant pour ce polypeptide - Google Patents

Nouveau polypeptide, chaperonine humaine cpn60 15, et polynucleotide codant pour ce polypeptide Download PDF

Info

Publication number
WO2001090175A1
WO2001090175A1 PCT/CN2001/000847 CN0100847W WO0190175A1 WO 2001090175 A1 WO2001090175 A1 WO 2001090175A1 CN 0100847 W CN0100847 W CN 0100847W WO 0190175 A1 WO0190175 A1 WO 0190175A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
polynucleotide
molecular chaperone
protein
cpn60 protein
Prior art date
Application number
PCT/CN2001/000847
Other languages
English (en)
Chinese (zh)
Inventor
Yumin Mao
Yi Xie
Original Assignee
Shanghai Biowindow Gene Development Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shanghai Biowindow Gene Development Inc. filed Critical Shanghai Biowindow Gene Development Inc.
Priority to AU81685/01A priority Critical patent/AU8168501A/en
Publication of WO2001090175A1 publication Critical patent/WO2001090175A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals

Definitions

  • the present invention belongs to the field of biotechnology. Specifically, the present invention describes a novel polypeptide mate daughter cpn60 protein 15 and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and polypeptide.
  • Chaperone proteins are involved in many important biological processes such as protein folding and aggregation of oligomeric protein complexes, maintaining protein precursors in an unfolded state to facilitate protein transmembrane transport, and enabling denatured proteins to be disaggregated and repaired. It is mainly to help other peptides maintain the normal conformation to form the correct oligomeric structure, thereby exerting normal physiological functions. They are widely distributed, from bacteria to humans, animals and plants, and are abundant in prokaryotes, chloroplasts and mitochondria. The abnormal expression of such proteins in the organism will lead to the formation of normal conformations of some proteins, which will affect the normal physiological functions of various proteins and cause various diseases related to abnormal transport of substances, such as some metabolic disorders, immune disorders, etc. .
  • the chaperone forms an oligomeric complex consisting of two different subunits: a 60Kd protein, such as cpn60 (groEL in bacteria); and a 13Kd protein, such as cpnl O (groES in bacteria) ). They all interact with some proteins in the body to regulate the functions of various proteins in the body.
  • the cpn60 protein has weak ATPase activity. This subunit of all chaperone proteins consists of highly conserved 550-580 amino acid residues. The cpn60 protein contains a conserved consensus fragment of 12 amino acid residues, which is shown below:
  • This sequence fragment is an important part of the interaction of this subunit with other proteins to coordinate the molecular chaperone to perform normal physiological functions. This fragment is also an important part of the ATPase activity of this subunit. Mutations in this sequence segment will cause the subunit to malfunction, which will affect the function of the entire chaperone in the organism.
  • the protein can also combine with other related proteins in the body to play a variety of similar protein regulation. Therefore, it is closely related to the occurrence of diseases such as various metabolic disorders and immune system disorders in the body.
  • molecular chaperone cpn60 protein 15 protein plays an important role in regulating important functions of the body such as cell division and embryo development, and it is believed that a large number of proteins are involved in these regulatory processes, there has been a need in the art to identify more involved in these processes.
  • Molecular chaperone c P n60 protein 15 protein especially the amino acid sequence of this protein is identified.
  • the separation of the new molecular chaperone cpn60 protein 15 protein encoding gene also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for the disease, so it is important to isolate its code for MA.
  • Object of the invention is an important role in regulating important functions of the body such as cell division and embryo development, and it is believed that a large number of proteins are involved in these regulatory processes, there has been a need in the art to identify more involved in these processes.
  • Molecular chaperone c P n60 protein 15 protein especially the amino
  • Another object of the invention is to provide a polynucleotide encoding the polypeptide.
  • Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding a molecular chaperone cpn60 protein 15.
  • Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding a molecular chaperone cpn60 protein 15.
  • Another object of the present invention is to provide a method for producing the molecular chaperone cpn60 protein 15.
  • Another object of the present invention is to provide an antibody against cpn60 protein 15 which is a molecular chaperone of the polypeptide of the present invention.
  • Another object of the present invention is to provide mimic compounds, antagonists, agonists, and inhibitors against cpn60 protein 15 which is a molecular chaperone of the polypeptide of the present invention.
  • Another object of the present invention is to provide a method for diagnosing and treating diseases associated with abnormalities of the molecular chaperone cpn60 protein 15. Summary of invention
  • the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
  • the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
  • sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 521-331 in SEQ ID NO: 1; and (b) a sequence having 1-1175 in SEQ ID NO: 1 Sequence of bits.
  • the present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
  • the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
  • the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of the molecular chaperone cpn60 protein 15 protein, which comprises utilizing the polypeptide of the invention.
  • the invention also relates to compounds obtained by this method.
  • the invention also relates to a method for in vitro detection of a disease or susceptibility to disease associated with abnormal expression of the molecular chaperone cpn60 protein 15 protein, which comprises detecting a mutation in the polypeptide or a polynucleotide sequence encoding the same in a biological sample, or detecting a biological sample The amount or biological activity of a polypeptide of the invention.
  • the invention also relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
  • the present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention in the preparation of a medicament for treating cancer, developmental disease or immune disease or other diseases caused by abnormal expression of molecular chaperone cpn60 protein 15.
  • FIG. 1 is a comparison diagram of gene chip expression profiles of molecular chaperone cpn60 protein 15 and molecular chaperon cpn60 protein according to the present invention.
  • the upper graph is a graph of the expression profile of the molecular chaperone cpn60 protein 15.
  • the lower graph is the graph of the expression profile of the molecular chaperone cpn60 protein.
  • 1-bladder mucosa 2-PMA + Ecv304 cell line, 3-LPS + Ecv304 cell line thymus, 4-normal fibroblasts 1024NC, 5-Fibroblas t, growth factor stimulation, 1024NT, 6-scar into fc growth factor stimulation, 1013HT, 7-scar into fc stimulation without growth factor, 1013HC, 8-bladder cancer cell EJ, 9-bladder cancer, 10-bladder cancer, 11-liver cancer, 12- Liver cancer cell lines, 13-fetal skin, 14-spleen, 15-prostate cancer, 16-jejunum adenocarcinoma, 17 cardia cancer.
  • Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of the isolated molecular chaperone C pn60 protein 15. 15kDa is the molecular weight of the protein. The arrow indicates the isolated protein band. Summary of the invention
  • Nucleic acid sequence refers to oligonucleotides, nucleotides or polynucleotides and fragments or parts thereof, and may also refer to the genome or synthetic DM or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
  • amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
  • amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
  • a protein or polynucleotide “variant” refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it. The changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or the nucleotide sequence. Variants can have "conservative" changes in which the substituted amino acid has a structural or chemical property similar to the original amino acid, such as the replacement of isoleucine with leucine. Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
  • “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
  • Insertion means that a change in the amino acid sequence or nucleotide sequence results in an increase in one or more amino acids or nucleotides compared to a molecule that exists in nature.
  • Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
  • Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
  • immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response and to bind specific antibodies in a suitable animal or cell.
  • An "agonist” refers to a molecule that, when combined with the molecular chaperone cpn60 protein 15, causes a change in the protein to regulate the activity of the protein.
  • Agonists may include proteins, nucleic acids, carbohydrates, or any other molecule that can bind to the molecular chaperone cpn60 protein 15.
  • Antagonist refers to a molecule that, when combined with the molecular chaperone cpn60 protein 15, can block or regulate the biological or immunological activity of the molecular chaperone cpn60 protein 15.
  • Antagonist And inhibitors can include proteins, nucleic acids, carbohydrates or any other molecule that can bind to the molecular chaperone cpn60 protein 15.
  • “Regulation” refers to a change in the function of the molecular chaperone cpn60 protein 15, including an increase or decrease in protein activity, a change in binding properties, and any other biological, functional, or immune properties of the molecular chaperone cpn60 protein 15.
  • substantially pure means substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated.
  • Those skilled in the art can purify the molecular chaperone cpn60 protein 15 using standard protein purification techniques.
  • the substantially pure molecular chaperone cpn60 protein 15 produces a single main band on a non-reducing polyacrylamide gel.
  • Molecular chaperone cpn60 protein 15 peptide purity can be analyzed by amino acid sequence.
  • Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
  • sequence C-T-G-A
  • complementary sequence G-A-C-T.
  • the complementarity between two single-stranded molecules may be partial or complete.
  • the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
  • “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
  • Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Southern imprinting or Northern blotting, etc.) under conditions of reduced stringency. Substantially homologous sequences or hybridization probes can compete and inhibit the binding of fully homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.
  • Percent identity refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALIGN program (Lasergene sof tware package, DNASTAR, Inc., Madi son Wis.). The MEGALIGN program can compare two or more sequences according to different methods such as the Clus ter method (Higgins, DG and PM Sharp (1988) Gene 73: 237-244). 0. The Clus ter method compares each pair by checking the distance between all pairs. Group sequences are arranged in clusters. The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences, such as sequence A and sequence B, is calculated by the following formula: Number of residues matching between sequence ⁇
  • the number of residues in the sequence ⁇ -the number of spacer residues in the sequence-the number of spacer residues X in the sequence S can also be determined by the Clus ter method or by a method known in the art such as Jotun Hein (Hein L (1990) Methods in enzymology 183: 625-645). "Similarity” refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
  • Amino acids used for conservative substitution may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
  • Antisense refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence.
  • Antisense strand refers to a nucleic acid strand that is complementary to a “sense strand.”
  • Derivative refers to HFP or a chemical modification of its nucleic acid. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
  • Antibody refers to a complete antibody molecule and its fragments, such as Fa,? ( ⁇ ) 2 and? , It can specifically bind to the epitope of the molecular chaperone cpn60 protein 15.
  • a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
  • isolated refers to the removal of a substance from its original environment (for example, its natural environment if it is naturally occurring).
  • a naturally-occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
  • Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not part of its natural environment, they are still isolated.
  • isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
  • polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances in the natural state .
  • isolated molecular chaperone cpn60 protein 15 means that the molecular chaperone cpn60 protein 15 is substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated. Those skilled in the art can purify the molecular chaperone cpn60 protein 15 using standard protein purification techniques. Substantially pure peptides produce a single main band on a non-reducing polyacrylamide gel. The purity of molecular chaperone cpn60 protein 15 peptide can be analyzed by amino acid sequence.
  • the present invention provides a new polypeptide, the molecular chaperone cpn60 protein 15, which is basically composed of the amino acid sequence shown in SEQ ID NO: 2.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
  • the polypeptide of the present invention may be a naturally purified product or a chemically synthesized product Or from recombinant cells using prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells). Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
  • the invention also includes fragments, derivatives and analogs of the molecular chaperone cpn60 protein 15.
  • fragment refers to a polypeptide that substantially maintains the same biological function or activity of the molecular chaperone C pn60 protein 15 of the present invention.
  • a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution
  • the amino acid may or may not be encoded by a genetic codon; or ( ⁇ ) a type in which a group on one or more amino acid residues is replaced by another group to include a substituent; or ( ⁇ ⁇ )
  • Such a polypeptide sequence in which the mature polypeptide is fused with another compound such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol
  • a polypeptide sequence in which an additional amino acid sequence is fused into the mature polypeptide (Such as the leader or secretory sequence or the sequence used to purify the polypeptide or protease sequence).
  • such fragments, derivatives and analogs are considered to be within the knowledge of those skilled in the art.
  • the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
  • Polynucleotides of the invention are found from a CDM library of human fetal brain tissue. It contains a polynucleotide sequence of 1175 bases in length and its open reading frame 521-3931 encodes 136 amino acids.
  • this peptide has a similar expression profile with the molecular chaperone cpn60 protein, and it can be deduced that the molecular chaperone cpn60 protein 15 has a similar function as the molecular chaperone C pn60 protein.
  • the polynucleotide of the present invention may be in the form of DM or RNA.
  • DNA forms include cDNA, genomic DNA, or synthetic DNA.
  • DNA can be single-stranded or double-stranded.
  • DNA can be coding or non-coding.
  • the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
  • a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO. ⁇ 1 in the present invention.
  • the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence. '
  • polynucleotide encoding a polypeptide means including a polynucleotide encoding the polypeptide and including additional Coding and / or non-coding polynucleotides.
  • the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
  • Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
  • an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
  • the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity, between the two sequences).
  • the present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions.
  • "strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1 »/. SDS, 60 ° C; or (2) Add a denaturant, such as 50 ° /, for hybridization. (V / v) formamide, 0.1% calf serum /0.1°/.
  • Hybridization occurs only when the identity between the two sequences is at least 95% or more, and more preferably 97% or more.
  • the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
  • nucleic acid fragments that hybridize to the sequences described above.
  • a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 cores. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques (such as PCR) to identify and / or isolate polynucleotides encoding the chaperone cpn60 protein 15.
  • polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
  • the specific polynucleotide sequence encoding the molecular chaperone cpn60 protein 15 of the present invention can be obtained by various methods.
  • polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or CDM libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
  • the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) separating the double-stranded DM sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.
  • genomic DM is the least commonly used. Direct chemical synthesis of DM sequences is often the method of choice. The more commonly used method is the separation of the CDM sequences.
  • the standard method for isolating the cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage CDM library.
  • piRNA extraction There are many mature techniques for piRNA extraction, and kits are also commercially available (Qiagene).
  • construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989).
  • Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
  • genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DM-DNA or DM-RM hybridization; (2) the appearance or loss of marker gene function; (3) determination of the level of the transcript of the molecular chaperone cpn60 protein 15; (4) Detection of gene-expressed protein products by immunological techniques or determination of biological activity. The above methods can be used singly or in combination.
  • the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
  • the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
  • the probes used herein are generally MA sequences chemically synthesized based on the gene sequence information of the present invention.
  • the genes or fragments of the present invention can of course be used as probes.
  • DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
  • immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) can be used to detect protein products expressed by the molecular chaperone cpn60 protein 15 gene expression protein.
  • ELISA enzyme-linked immunosorbent assay
  • a method (Saiki, et al. Science 1985; 230: 1 350-1354) using PCR technology to amplify DNA / RNA is preferably used to obtain the gene of the present invention.
  • the RACE method RACE-rapid amplification of cDNA ends
  • the primers for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein Select and synthesize using conventional methods.
  • the amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
  • polynucleotide sequence of the gene of the present invention or various DM fragments and the like obtained as described above can be measured by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, sequencing needs to be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
  • the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using the molecular chaperone cpn60 protein 15 coding sequence, and a method for producing the polypeptide of the present invention by recombinant technology. .
  • a polynucleotide sequence encoding the molecular chaperone cpn60 protein 15 may be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
  • vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
  • Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al.
  • any plasmid and vector can be used to construct a recombinant expression vector.
  • An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
  • Methods known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding the molecular chaperone cpn60 protein 15 and appropriate transcriptional / translational regulatory elements. These methods include in vitro recombinant DNA technology, DNA synthesis technology, in vivo recombination technology, etc. (Sambroook, et al. Molecular Cloning, a Labora tory Manua, Cold Spring Harbor Laboratory. New York, 1989).
  • the DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide mRM synthesis. Representative examples of these promoters are: the lac or trp promoter of E.
  • the expression vector also includes a ribosome binding site for translation initiation, a transcription terminator, and the like. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers and adenovirus enhancers on the late side of the origin of replication.
  • the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • GFP fluorescent protein
  • tetracycline or ampicillin resistance for E. coli.
  • a polynucleotide encoding a molecular chaperone cpn60 protein 15 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a genetically engineered host cell containing the polynucleotide or the recombinant vector.
  • the term "host cell” refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E.
  • coli Streptomyces
  • bacterial cells such as Salmonella typhimurium
  • fungal cells such as yeast
  • plant cells such as fly S2 or Sf 9
  • animal cells such as CH0, COS or Bowes melanoma cells.
  • Transformation of a host cell with a DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art.
  • the host is a prokaryote such as E. coli
  • Competent cells that absorb DM can be harvested after the exponential growth phase and treated with the CaCl 2 method.
  • the steps used are well known in the art.
  • MgCl 2 is used.
  • transformation can also be performed by electroporation.
  • the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
  • the polynucleotide sequence of the present invention can be used to express or produce recombinant molecular chaperone cpn60 protein 15 (Science, 1984; 224: 1431). Generally there are the following steps:
  • the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
  • a suitable method such as temperature conversion or chemical induction
  • the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If necessary, the recombinant protein can be isolated and purified by various separation methods using its physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
  • conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid
  • polypeptides of the present invention as well as antagonists, agonists and inhibitors of the polypeptides, can be directly used in the treatment of diseases, for example, they can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection, and immune diseases.
  • Chaperone proteins are involved in many important biological processes such as protein folding and aggregation of oligomeric protein complexes, maintaining protein precursors in an unfolded state to facilitate protein transmembrane transport, and enabling denatured proteins to be disaggregated and repaired. It is mainly to assist other peptides to maintain the normal conformation to form the correct oligomeric structure, thereby exerting normal physiological functions.
  • the specific sequence of the molecular chaperone subunit cpn60 protein is an important part of its interaction with other proteins to coordinate the normal chaperone function of the molecular chaperone. This fragment is also an important part of the ATPase activity of this subunit. Mutations in this sequence segment will cause the subunit to malfunction, which will affect the function of the entire chaperone in the organism.
  • the abnormal expression of the molecular chaperone cpn60 protein 13 of the present invention will produce various diseases, especially various tumors, embryonic developmental disorders, growth disorders, and inflammation. These diseases include, but are not limited to:
  • Embryonic disorders congenital abortion, cleft palate, limb loss, limb differentiation disorder, hyaline membrane disease, atelectasis, polycystic kidney, double ureter, cryptorchidism, congenital inguinal hernia, double uterus, vaginal atresia, suburethral Fissure, hermaphroditism, atrial septal defect, ventricular septal defect, pulmonary stenosis, arterial duct occlusion, neural tube defect, congenital hydrocephalus, iris defect, congenital cataract, congenital glaucoma or cataract, congenital deafness
  • Growth and development disorders mental retardation, cerebral palsy, brain development disorders, mental retardation, familial cerebral nucleus dysplasia syndrome, strabismus, skin, fat and muscular dysplasia such as congenital skin laxity, premature aging Disease, congenital keratosis, various metabolic defects such as various amino acid metabolic defects, stunting, dwarfism, sexual retardation
  • Tumors of various tissues gastric cancer, liver cancer, lung cancer, esophageal cancer, breast cancer, leukemia, lymphoma, thyroid tumor, uterine fibroids, neuroblastoma, astrocytoma, ependymoma, glioblastoma, Colon cancer, melanoma, adrenal cancer, bladder cancer, bone cancer, osteosarcoma, myeloma, bone marrow cancer, brain cancer, uterine cancer, endometrial cancer, gallbladder cancer, thymic tumor, nasal cavity and sinus cancer, nasopharyngeal cancer, Laryngeal cancer, tracheal tumor, fibroma, fibrosarcoma, lipoma, liposarcoma, leiomyoma
  • Inflammation various infections, allergic reactions, bronchial asthma, adult respiratory distress syndrome, rheumatoid arthritis, rheumatoid arthritis, osteoarthritis, glomerulonephritis, immune complex glomerulonephritis, Osteoporosis, dermatomyositis, urticaria, atopic dermatitis, hemochromatosis, polymyositis, Addison's disease, Graves' disease, chronic active hepatitis, intestinal emergency syndrome, atrophic gastritis , Systemic lupus erythematosus, myasthenia gravis, cerebrospinal multiple sclerosis, Guillain-Barre syndrome, intracranial granulomatosis, Wegener's granulomatosis, autoimmune thyroiditis, pancreatitis, myocarditis, atherosclerosis, multiple Scleroderma: various infections, allergic reactions, bronchial asthma, adult respiratory distress syndrome, rhe
  • Abnormal expression of the molecular chaperone cpn60 protein 15 of the present invention will also produce certain hereditary, hematological and immune system diseases.
  • the invention also provides methods of screening compounds to identify agents that increase (agonist) or suppress (antagonist) the molecular chaperone cpn60 protein 15.
  • Agonists enhance biological functions such as molecular chaperone cpn60 protein 15 to stimulate cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
  • mammalian cells or a membrane preparation expressing the molecular chaperone cpn60 protein 15 can be cultured together with the labeled molecular chaperone cpn60 protein 15 in the presence of a drug. The ability of the drug to increase or block this interaction is then determined.
  • Antagonists of the molecular chaperone CP n60 protein 15 include antibodies, compounds, receptor deletions, and the like that have been screened.
  • the antagonist of the molecular chaperone C pn60 protein 15 can bind to the molecular chaperone cpn60 protein 15 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot perform biological functions.
  • the molecular chaperone cpn60 protein 15 can be added to a bioanalytical assay to determine whether the compound is an antagonist by measuring the effect of the compound on the interaction between the molecular chaperone cpn60 protein 15 and its receptor. Receptor deletions and analogs that act as antagonists can be screened in the same way as for screening compounds described above.
  • Peptide molecules capable of binding to the molecular chaperone cpn60 protein 15 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. During screening, the molecular chaperone cpn60 protein 15 molecules should generally be labeled.
  • the present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies.
  • the invention also provides antibodies directed against the molecular chaperone cpn60 protein 15 epitope. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments generated from Fab expression libraries.
  • Polyclonal antibodies can be produced by injecting immunized animals (such as rabbits, mice, rats, etc.) with the molecular chaperone cpn60 protein 15 directly.
  • immunized animals such as rabbits, mice, rats, etc.
  • a variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's adjuvant.
  • Techniques for preparing monoclonal antibodies for the molecular chaperone cpn60 protein 15 include, but are not limited to, hybridoma technology (Kohler and Miste in. Nature, 1975, 256: 495-497), triple tumor technology, human beta-cell hybridoma technology , EBV-hybridoma technology, etc.
  • Chimeric antibodies that bind human constant regions to non-human variable regions can be produced using existing techniques (Morrison et al, PNAS, 1985, 81: 6851). 0 Existing techniques for producing single-chain antibodies (US Pat No. 4946778) can also be used to produce single chain antibodies against the molecular chaperone cpn60 protein 15.
  • Anti-molecular chaperone cpn60 protein 15 antibodies can be used in immunohistochemistry to detect molecular chaperone cpn60 protein 15 in biopsy specimens.
  • Monoclonal antibodies that bind to the molecular chaperone cpn60 protein 15 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
  • Antibodies can also be used to design immunotoxins that target a particular part of the body.
  • As chaperone cpn60 Protein 15 High affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
  • a common method is to attack the amino group of an antibody with a thiol crosslinker such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
  • This hybrid antibody can be used to kill the molecular partner cpn60 protein 15 positive cells.
  • the antibodies of the present invention can be used to treat or prevent diseases related to the molecular chaperone cpn60 protein 15.
  • Administration of appropriate doses of antibodies can stimulate or block the production or activity of the molecular chaperone cpn60 protein 15.
  • the present invention also relates to a diagnostic test method for quantitatively and locally detecting the molecular chaperone cpn60 protein 15 level.
  • These tests are well known in the art and include FISH assays and radioimmunoassays.
  • the molecular chaperone cpn60 protein 15 levels detected in the test can be used to explain the importance of molecular chaperone cpn60 protein 15 in various diseases and to diagnose diseases in which molecular chaperone cpn60 protein 15 plays a role.
  • polypeptide of the present invention can also be used for peptide mapping analysis.
  • the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
  • the polynucleotide encoding the molecular chaperone cpn60 protein 15 can also be used for a variety of therapeutic purposes. Gene therapy technology can be used to treat abnormal cell proliferation, development or metabolism caused by the non-expression or abnormal / inactive expression of the molecular chaperone cpn60 protein 15.
  • Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated molecular chaperone cpn60 protein 15 to inhibit endogenous molecular chaperone cpn60 protein 15 activity.
  • a mutated molecular chaperone cpn60 protein 15 may be a shortened molecular chaperone cpn60 protein 15 that lacks a signal transduction domain.
  • the recombinant gene therapy vector can be used to treat diseases caused by abnormal expression or activity of molecular chaperone cpn60 protein 15.
  • Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to transfer a polynucleotide encoding the molecular chaperone cpn60 protein 15 into cells.
  • Methods for constructing recombinant viral vectors carrying a polynucleotide encoding a molecular chaperone cpn60 protein 15 can be found in the existing literature (Sambrook, et al.).
  • a recombinant polynucleotide encoding the molecular chaperone cpn60 protein 15 can be packaged into liposomes and transferred into cells.
  • Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
  • a vector such as a virus, phage, or plasmid
  • Oligonucleotides including antisense RM and DNA
  • ribozymes that inhibit the molecular chaperone cpn60 protein 15 mRNA are also within the scope of the present invention.
  • a ribozyme is an enzyme-like RM molecule that can specifically decompose a specific MA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RM to perform endonucleation.
  • Antisense RNA and DM and ribozymes can be obtained using any existing RNA or DM synthesis techniques, such as solid phase phosphorus The technology of synthesizing oligonucleotides by acid amide chemical synthesis has been widely used.
  • Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RM. This DM sequence has been integrated downstream of the RM polymerase promoter of the vector. In order to increase the stability of a nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the ribonucleoside linkages should use phosphate thioester or peptide bonds instead of phosphodiester bonds.
  • the polynucleotide encoding the molecular chaperone cpn60 protein 15 can be used for the diagnosis of diseases related to the molecular chaperone cpn60 protein 15.
  • the polynucleotide encoding the molecular chaperone cpn60 protein 15 can be used to detect the expression of the molecular chaperone cpn60 protein 15 or the abnormal expression of the molecular chaperone cpn60 protein 15 in a disease state.
  • the DNA sequence encoding molecular chaperone cpn60 protein 15 can be used to hybridize biopsy specimens to determine the expression of molecular chaperone cpn60 protein 15.
  • Hybridization techniques include Southern blotting, Nor thern blotting, and in situ hybridization. These techniques and methods are publicly available and mature, and the relevant kits are commercially available.
  • a part or all of the polynucleotides of the present invention can be used as probes to be fixed on a microarray or a DM chip (also called a "gene chip") for analyzing differential expression analysis and gene diagnosis of genes in tissues.
  • the molecular chaperone cpn60 protein 15 specific primers can be used to perform RM-polymerase chain reaction (RT-PCR) in vitro amplification to detect the transcription products of the molecular chaperone cpn60 protein 15.
  • Detection of mutations in the molecular chaperone cpn60 protein 15 gene can also be used to diagnose molecular chaperone cpn60 protein 15-related diseases.
  • Molecular chaperone cpn60 protein 15 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type molecular chaperone cpn60 protein 15 DNA sequence. Mutations can be detected using well-known techniques such as Southern blotting, DM sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression. Therefore, the Nor thern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
  • sequences of the invention are also valuable for chromosome identification. This sequence will specifically target a specific position on a human chromosome and can hybridize to it. Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for marking chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DM sequences on a chromosome.
  • the PCR primers (preferably 15-35b P ) are prepared based on the cDNA, and the sequence can be mapped on the chromosome. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those hybrid cells that contain the human gene corresponding to the primer will produce amplified fragments.
  • PCR localization of somatic hybrid cells is a quick way to localize DM to specific chromosomes.
  • oligonucleotide primers of the present invention by a similar method, a set of fragments from a specific chromosome can be utilized Or a large number of genomic clones to achieve sublocalization.
  • Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and hybrid pre-selection to construct chromosome-specific cDNA libraries.
  • Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step.
  • FISH Fluorescent in situ hybridization
  • cDM or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, cDNAs that are accurately mapped to disease-related chromosomal regions can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).
  • the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
  • suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
  • the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
  • the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell.
  • the polypeptides of the invention can be used in combination with other therapeutic compounds.
  • the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
  • the molecular chaperone cpn60 protein 15 is administered in an amount effective to treat and / or prevent a specific indication.
  • the amount and dose range of the molecular chaperone cpn60 protein 15 administered to the patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician.
  • RNA Human fetal brain total RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform.
  • Poly (A) mRNA was isolated from total RNA using Quik mRNA Isolat ion Kit (product of Qiegene). 2ug poly (A) mRNA is reverse transcribed to form cDNA.
  • the Smart cDNA cloning kit purchased from Clontech
  • the bacteria formed a cDNA library.
  • Dye terminate cycle react ion sequencing kit Perkin-Elmer
  • ABI 377 automatic sequencer Perkin-Elmer
  • the determined cDM sequence was compared with the existing public DM sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 0028gl0 was a new DM.
  • the inserted cDNA fragments contained in this clone were determined in both directions by synthesizing a series of primers.
  • CDNA was synthesized using fetal brain total RNA as a template and ol igo-dT as a primer for reverse transcription reaction. After purification with Qiagene's kit, the following primers were used for PCR amplification:
  • Primerl 5'- CAAGACGCAGCTTGAAGGACTGTC -3 '(SEQ ID NO: 3)
  • Primer2 5,-ACCACTTATTTTATTTTATTAGAG -3 '(SEQ ID NO: 4)
  • Primerl is a forward sequence located at the 5th end of SEQ ID NO: 1, starting at lbp;
  • Primer 2 is the 3, terminal reverse sequence of SEQ ID NO: 1.
  • Amplification reaction conditions 50 ⁇ l / L C1, 10 mmol / L Tris-HCl, pH 8. 5, 1.5 mmol / L MgCl 2 , 200 ⁇ 1 / ⁇ dNTP, lOpmol primer, 1U Taq in a 50 ⁇ 1 reaction volume DNA polymerase (Clontech).
  • the reaction was performed on a PE9600 DM thermal cycler (Perkin-Elmer) under the following conditions for 25 cycles: 94 ° C 30sec; 55 ° C 30sec; 72 ° C 2min.
  • ⁇ -act in was set as a positive control and template blank was set as a negative control.
  • the amplified product was purified using a QIAGEN kit and ligated to a pCR vector (Invitrogen) using a TA cloning kit.
  • DM sequence analysis results showed that PCR
  • the MA sequence of the product is exactly the same as 1-1175bp shown in SEQ ID NO: 1.
  • Example 3 Northern blot analysis of the expression of the molecular chaperone cpn60 protein 15 gene Total RNA was extracted in one step [Anal. Biochem 1987, 162, 156-159] 0 This method involves acid guanidinium thiocyanate-chloroform extraction.
  • the tissue is homogenized with 4M guanidine isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH 4.0), and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1 ), Mix and centrifuge. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. The obtained RM precipitate was washed with 70% ethanol, dried and dissolved in water.
  • a 32P-labeled probe (approximately 2 x 10 6 cpm / ml) was hybridized with a nitrocellulose membrane to which RNA was transferred at 42 ° C overnight in a solution containing 50% formamide-25mM H 2 P0 4 (pH7.4)-5 x SSC-5 Denhardt's solution and 200 g / ml salmon sperm DM. After hybridization, filter was placed in 1 x SSC-0.1% SDS at 55. C for 30 min. Then, Phosphor Imager was used for analysis and quantification.
  • Example 4 In vitro expression, isolation and purification of recombinant molecular chaperone cpn60 protein 15
  • Primer3 5'-CATGCTAGCATGCAGCTGGGCTGTGGAGGGCCT-3 '(Seq ID No: 5)
  • Primer4 5'-CATGGATCCTCATATGTCTCTGGTGACCATATA-3' (Seq ID No: 6)
  • the 5 'ends of these two primers contain Nhel and BamHI restriction sites, respectively.
  • the coding sequences for the 5 ,, and 3 'ends of the gene of interest are followed, respectively.
  • the Nhel and BamHI restriction sites correspond to the selectivity within the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865.3). Digestion site.
  • the PCR reaction was performed using the pBS-0028glO plasmid containing the full-length target gene as a template.
  • the PCR reaction conditions were as follows: 10 pg of pBS-0028gl0-containing plasmid in a total volume of 50 ⁇ 1, primers Primer-3 and Primer-4 were lOpmol, Advantage polymerase Mix (Clontech) 1 ⁇ 1, respectively. Cycle parameters: 94. C 20s, 60. C 30s, 68 ° C 2 min, a total of 25 cycles. Nhel and BamHI were used to double-digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase.
  • the ligated product was transformed into E. coli DH5a using the calcium chloride method. After being cultured overnight on LB plates containing kanamycin (final concentration 3 ( ⁇ g / ml)), positive clones were screened by colony PCR method and sequenced. The correct positive clone (pET-0028 g 10) was used to transform the recombinant plasmid into E. coli BL21 (DE3) plySs (product of Novagen) by calcium chloride method.
  • Polypeptide synthesizer (product of PE company) was used to synthesize the following molecular chaperone cpn60 protein 15-specific peptides: Ser-I le- C00H (SEQ ID NO: 7).
  • the polypeptide is coupled with hemocyanin and bovine serum albumin to form a complex, respectively.
  • Rabbits were immunized with 4 mg of the hemocyanin polypeptide complex plus complete Freund's adjuvant, and 15 days later, the hemocyanin polypeptide complex plus incomplete Freund's adjuvant was used to boost immunity once.
  • the suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in various aspects.
  • the probes can be used to hybridize to the genome or CDM library of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
  • the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
  • the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by using a filter hybridization method.
  • Filter hybridization methods include dot blotting, Southern blotting, Northern blotting, and copying methods. They all use the same steps of hybridization after fixing the polynucleotide sample to be tested on the filter.
  • the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer so that the non-specific binding site of the sample on the filter is loaded And synthetic polymers.
  • the pre-hybridization solution is then replaced with a hybridization buffer containing the labeled probe and incubated to hybridize the probe to the target nucleic acid.
  • the unhybridized probes are removed by a series of membrane washing steps.
  • This embodiment utilizes higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals.
  • the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
  • the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
  • the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
  • oligonucleotide fragments from the polynucleotide SEQ ID NO: 1 of the present invention for use as hybridization probes should follow the following principles and several aspects to be considered:
  • the preferred range of probe size is 18-50 nucleotides
  • Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other unknown genomic sequences and their complements The regions are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, the primary probe should not be used;
  • Probe 1 (probel), which belongs to the first type of probe, is completely homologous or complementary to the gene / ⁇ of SEQ ID NO: 1 (41Nt):
  • Probe 2 which belongs to the second type of probe, is equivalent to the replacement mutation sequence (41Nt) of the gene fragment of SEQ ID NO: 1 or its complementary fragment:
  • PBS phosphate buffered saline
  • step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
  • NC membranes nitrocellulose membranes
  • Two NC membranes are required for each probe, so that they can be used in the following experimental steps.
  • the film was washed with high-strength conditions and strength conditions, respectively.
  • Pre-hybridization Place the membrane in a plastic bag and add 3-10 mg of pre-hybridization solution (10xDenhardt's; 6xSSC, 0.1 mg / ml CT DM (calf thymus DNA)). After sealing the mouth of the bag, shake at 68 ° C for 2 hours.
  • pre-hybridization solution 10xDenhardt's; 6xSSC, 0.1 mg / ml CT DM (calf thymus DNA).
  • Gene chip or DNA microarray is a new technology that many national laboratories and large pharmaceutical companies are currently developing and developing. It refers to the orderly and high-density arrangement of a large number of target gene fragments on glass, The data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software to achieve the purpose of fast, efficient, and high-throughput analysis of biological information.
  • the polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research of new gene functions; search for and screen new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as heredity disease. The specific methods and steps have been reported in the literature.
  • a total of 4,000 polynucleotide sequences of various full-length cDNAs are used as target DM, including the polynucleotide of the present invention. They were respectively amplified by PCR. After purification, the concentration of the amplified product was adjusted to about 500 ng / ul, and spotted on a glass medium with a Cartesian 7500 spotter (purchased from Cartesian Company, USA). In nature, the distance between points is 280 ⁇ m. The spotted slides were hydrated, dried, and cross-linked in a UV cross-linking instrument. After elution, the DNA was fixed on a glass slide to prepare a chip. The specific method steps have been reported in the literature. The sample post-processing steps in this embodiment are:
  • Total mRNA was extracted from the human mixed tissue and specific tissues (or stimulated cell lines) in one step, and the mRNA was purified using Ol igotex mRNA Midi [it (purchased from QiaGen), and separated by reverse transcription!]
  • the fluorescent reagent Cy3dUTP (5-Amino-propargyl-2--deoxyuridine 5 '-triphate coupled to Cy3 f luorescent dye, purchased from Amersham Phamacia Biotech) was used to label mRM of human mixed tissue, and the fluorescent reagent Cy5dUTP (5-Amino- Propargyl-2'-deoxyuridine 5'-triphate coupled to Cy5 fluorescent dye, purchased from Amersham Phamacia Biotech, labeled the body's specific tissue (or stimulated cell line) mRM, and purified the probe to prepare a probe.
  • Cy3dUTP 5-Amino-propargyl-2--deoxyuridine 5 '-triphate coupled to Cy3
  • the probes from the above two tissues and the chip were respectively hybridized in a UniHyb TM Hybridizat ion Solut ion (purchased from TeleChem) hybridization solution for 16 hours, and washed with a washing solution (lx SSC, 0.2% SDS) at room temperature. Scanning was performed with a ScanArray 3000 scanner (purchased from General Scanning, USA), and the scanned images were analyzed and processed with Imagene software (Biodiscovery, USA) to calculate the Cy3 / Cy5 ratio of each point.
  • the above specific tissues are bladder mucosa, PMA + Ecv304 cell line, LPS + Ecv304 cell line thymus, normal fibroblasts 1024NC, Fibroblas t, growth factor stimulation, 1024NT, scar-like fc growth factor Stimulation, 1013HT, scar into fc without stimulation with growth factors, 1013HC, bladder cancer cell EJ, bladder cancer, bladder cancer, liver cancer, liver cancer cell line, fetal skin, Spleen, prostate cancer, jejunum adenocarcinoma, cardia cancer. Draw a chart based on these 17 Cy3 / Cy5 ratios. . (figure 1 ) . It can be seen from the figure that the molecular chaperone cpn60 protein 15 and the molecular chaperone cpn60 protein expression profiles according to the present invention are very similar.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Toxicology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Peptides Or Proteins (AREA)

Abstract

L'invention concerne un nouveau polypeptide, une chaperonine humaine cpn60 15, et un polynucléotide codant pour ce polypeptide ainsi qu'un procédé d'obtention de ce polypeptide par des techniques recombinantes d'ADN. L'invention concerne en outre les applications de ce polypeptide dans le traitement de maladies, notamment des tumeurs malignes, de l'hémopathie, de l'infection par VIH, de maladies immunitaires et de diverses inflammations. L'invention concerne aussi l'antagoniste agissant contre le polypeptide et son action thérapeutique ainsi que les applications de ce polynucléotide codant pour la chaperonine humaine cpn60 15.
PCT/CN2001/000847 2000-05-24 2001-05-21 Nouveau polypeptide, chaperonine humaine cpn60 15, et polynucleotide codant pour ce polypeptide WO2001090175A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU81685/01A AU8168501A (en) 2000-05-24 2001-05-21 A novel polypeptide, a molecular chaperone cpn60 protein 15 and the polynucleotide encoding the polypeptide

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN 00115851 CN1324816A (zh) 2000-05-24 2000-05-24 一种新的多肽——分子伴侣cpn60蛋白15和编码这种多肽的多核苷酸
CN00115851.1 2000-05-24

Publications (1)

Publication Number Publication Date
WO2001090175A1 true WO2001090175A1 (fr) 2001-11-29

Family

ID=4585293

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2001/000847 WO2001090175A1 (fr) 2000-05-24 2001-05-21 Nouveau polypeptide, chaperonine humaine cpn60 15, et polynucleotide codant pour ce polypeptide

Country Status (3)

Country Link
CN (1) CN1324816A (fr)
AU (1) AU8168501A (fr)
WO (1) WO2001090175A1 (fr)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0774512A2 (fr) * 1995-09-14 1997-05-21 Tadayuki Imanaka Procédé de production de protéines utilisant de chaperon
CN1234446A (zh) * 1998-12-03 1999-11-10 中山大学 苏云金杆菌分子伴侣基因、含有该基因的载体及菌株

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0774512A2 (fr) * 1995-09-14 1997-05-21 Tadayuki Imanaka Procédé de production de protéines utilisant de chaperon
CN1234446A (zh) * 1998-12-03 1999-11-10 中山大学 苏云金杆菌分子伴侣基因、含有该基因的载体及菌株

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
NAGATA K., MATRIX BIOL., vol. 16, no. 7, February 1998 (1998-02-01), pages 379 - 386 *

Also Published As

Publication number Publication date
AU8168501A (en) 2001-12-03
CN1324816A (zh) 2001-12-05

Similar Documents

Publication Publication Date Title
WO2002014510A1 (fr) Nouveau polypeptide, proteine cbp20 humaine 47.74, et polynucleotide codant ce polypeptide
WO2001090175A1 (fr) Nouveau polypeptide, chaperonine humaine cpn60 15, et polynucleotide codant pour ce polypeptide
WO2001046410A1 (fr) Nouveau polypeptide, proteine 13 du sous-groupe moleculaire cpn60, et polynucleotide codant pour ce polypeptide
WO2001088084A2 (fr) Nouveau polypeptide, superoxyde dismutase 11, et polynucleotide codant pour ce polypeptide
WO2001075048A2 (fr) Nouveau polypeptide, proteine ribosomale humaine s11 23, et polynucleotide codant pour ce polypeptide
WO2001090173A1 (fr) Nouveau polypeptide, chaperonine humaine cpn60 10, et polynucleotide codant pour ce polypeptide
WO2001092515A1 (fr) Nouveau polypeptide, facteur humain de transcription 29.26, et polynucleotide codant ce polypeptide
WO2001090352A1 (fr) Nouveau polypeptide, proteine 110.12 de liaison avec le centrosome nek-2, et polynucleotide codant ce polypeptide
WO2001090177A1 (fr) Nouveau polypeptide, activateur humain de la mort naturelle des cellules b13.64, et polynucleotide codant ce polypeptide
WO2001092517A1 (fr) Nouveau polypeptide, proteine humaine 29.15 du gene transducteur-2-beta, et polynucleotide codant ce polypeptide
WO2001072801A1 (fr) Nouveau polypeptide, proteine ribosomale humaine s11 12, et polynucleotide codant pour ce polypeptide
WO2001079432A2 (fr) Nouveau polypeptide, facteur humain de transcription de la differentiation cellulaire 58, et polynucleotide codant pour ce polypeptide
WO2001092518A1 (fr) Nouveau polypeptide, proteine humaine 9.5 associee a la ccr4, et polynucleotide codant ce polypeptide
WO2001090133A1 (fr) Nouveau polypeptide, uracil desoxyribonucleotide glycosylase humaine 22, et polynucleotide codant ce polypeptide
WO2001075101A1 (fr) Nouveau polypeptide, proteine humaine de regulation de la transcription 8, et polynucleotide codant pour ce polypeptide
WO2002006470A1 (fr) Nouveau polypeptide, myoglobuline humaine ixa11.88, et polynucleotide codant ce polypeptide
WO2001070965A1 (fr) Nouveau polypeptide, facteur humain de regulation de la transcription 15, et polynucleotide codant pour ce polypeptide
WO2001087963A1 (fr) Proteine s18-12 ribosomale, polypeptide humain, et polynucleotide la codant
WO2001092324A1 (fr) Nouveau polypeptide, nucleoproteine humaine 10.78 basophile, et polynucleotide codant ce polypeptide
WO2001075003A2 (fr) Nouveau polypeptide, protéine humaine d'utérus associé à une molécule cpn 60 26, et polynucléotide codant pour ce polypeptide
WO2001090172A1 (fr) Nouveau polypeptide, proteine ribosomale l39 13, et polynucleotide codant ce polypeptide
WO2001075053A2 (fr) Nouveau polypeptide, chaperonine humaine 14, et polynucleotide codant pour ce polypeptide
WO2002012308A1 (fr) Nouveau polypeptide, proteine rs3 humaine 18, et polynucleotide codant ce polypeptide
WO2001090178A1 (fr) Nouveau polypeptide, dihydroorotase humaine 11, et polynucleotide codant ce polypeptide
WO2001092516A1 (fr) Nouveau polypeptide, proteine ribosomale s19e 13, et polynucleotide codant ce polypeptide

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP