WO2001055404A1 - Nouveau polypeptide, alcool deshydrogenase humaine 39, et polynucleotide codant pour ce polypeptide - Google Patents

Nouveau polypeptide, alcool deshydrogenase humaine 39, et polynucleotide codant pour ce polypeptide Download PDF

Info

Publication number
WO2001055404A1
WO2001055404A1 PCT/CN2001/000088 CN0100088W WO0155404A1 WO 2001055404 A1 WO2001055404 A1 WO 2001055404A1 CN 0100088 W CN0100088 W CN 0100088W WO 0155404 A1 WO0155404 A1 WO 0155404A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
polynucleotide
human
sequence
seq
Prior art date
Application number
PCT/CN2001/000088
Other languages
English (en)
Chinese (zh)
Inventor
Yumin Mao
Yi Xie
Original Assignee
Biodoor Gene Technology Ltd. Shanghai
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Biodoor Gene Technology Ltd. Shanghai filed Critical Biodoor Gene Technology Ltd. Shanghai
Priority to AU2001233564A priority Critical patent/AU2001233564A1/en
Publication of WO2001055404A1 publication Critical patent/WO2001055404A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/0006—Oxidoreductases (1.) acting on CH-OH groups as donors (1.1)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • the present invention belongs to the field of biotechnology. Specifically, the present invention describes a new polypeptide, human ethanol dehydrogenase 39, and a polynucleotide sequence encoding the polypeptide. The invention also relates to the preparation method and application of the polynucleotide and polypeptide. Background technique
  • Nicotinamide coenzyme is a biological equivalent of the reducing equivalent, that is, the electron. It plays the role of co-substrate rather than the real co-enzyme in most of the reactions it participates in. It is mainly a synergistic related enzyme function in the body.
  • the enzyme substrate accepts two electrons and one proton to become a reducing coenzyme (NADP) to coordinately complete various enzyme-catalyzed processes.
  • NADP reducing coenzyme
  • the alcohol dehydrogenase family is a large family, which contains a large number of enzymes, most of which are co-enzyme I or co-enzyme I oxidoreductases, which participate in various respiratory metabolic processes in the body.
  • the members of the enzyme family are widely distributed in organisms. People first cloned the members of the family from fruit flies. Later, members of the family were found in mammals, bacteria, fungi, and plants. Three different types of alcohol dehydrogenases have been found: long-chain alcohol dehydrogenases containing zinc atoms, short-chain alcohol dehydrogenases, and iron-containing alcohol dehydrogenases.
  • Alcohol dehydrogenases containing zinc atoms are usually dimeric or trimeric enzymes, each subunit of which binds two zinc atoms in the body. One zinc atom is necessary for the catalytic activity of the protein, while the other is not necessary. Both zinc atoms are bound to protein subunits through cysteine residues or histidine residues; a catalytically active zinc atom is coordinated by two cysteine residues and a histidine residue . Alcohol dehydrogenases containing zinc atoms have been cloned from bacteria, mammals, plants and fungi. This enzyme has at least one isoenzyme in many different biological species. For example, in humans, alcohol dehydrogenase contains at least six isozymes, and yeast contains at least three isozymes. Many other zinc-dependent dehydrogenases are highly similar to zinc-containing alcohol dehydrogenases.
  • sequences of the members of the alcohol dehydrogenase protein family all contain a highly conserved region.
  • the conserved region is composed of two conserved consensus sequence fragments as shown below: Sequence fragment 1: GHEX (2) -GX (5 )-[GA] -X (2)-[IVSAC]; Sequence fragment 2: [GSD]-[DEQH] -X (2) -LX (3)-[SA] (2) -GGXGX (4) -QX (2)-[KR]; wherein sequence fragment 1 contains a group of amino acid residues, the amino acid residues form a coordination bond between the protein and the second catalytically active zinc atom, so that the protein has catalytic activity Conformation to play an important role in normal physiological functions.
  • the mutation of the conserved sequence fragment will cause the protein to fail to bind to the zinc atom to form an active structural conformation, thereby causing various related metabolic disorders, such as respiratory metabolic disorders.
  • the novel human alcohol dehydrogenase of the present invention also contains highly conserved sequence fragments of the alcohol dehydrogenase family. It is a zinc-dependent dehydrogenase in the body, and works in synergy with nicotinamide coenzyme in the body. Participate in various physiological processes related to respiratory chain metabolism. The abnormal expression of this protein is usually closely related to the occurrence of various metabolic disorders in the body, various metabolic disorders of related substances, and tumors and cancers in some related tissues.
  • human ethanol dehydrogenase 39 protein plays an important role in important functions of the body as described above, and it is believed that a large number of proteins are involved in these regulatory processes, there has been a need in the art to identify more human ethanol dehydrogenases involved in these processes. 39 proteins, especially the amino acid sequence of this protein. Isolation of the new human alcohol dehydrogenase 3 protein encoding gene also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so it is important to isolate its coding for DM. Disclosure of invention
  • An object of the present invention is to provide an isolated novel polypeptide, namely human ethanol dehydrogenase 39 and fragments thereof,
  • Another object of the present invention is to provide a polynucleotide encoding the polypeptide.
  • Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding human ethanol dehydrogenase 39.
  • Another object of the present invention is to provide a method for producing human ethanol dehydrogenase 39.
  • Another object of the present invention is to provide an antibody against the polypeptide-human ethanol dehydrogenase 39 of the present invention.
  • Another object of the present invention is to provide mimetic compounds, antagonists, agonists, and inhibitors of human ethanol dehydrogenase 39, which are polypeptides of the present invention.
  • Another object of the present invention is to provide a method for diagnosing and treating diseases related to abnormalities of human alcohol dehydrogenase 39.
  • the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
  • the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
  • sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 147-1202 in SEQ ID NO: 1; and (b) a sequence having 1-161 in SEQ ID NO: 1 3-bit sequence.
  • the invention further relates to a vector, in particular an expression vector, containing the polynucleotide of the invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; and a method comprising culturing said Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
  • a vector in particular an expression vector, containing the polynucleotide of the invention
  • a host cell genetically engineered with the vector including a transformed, transduced or transfected host cell
  • a method comprising culturing said Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
  • the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
  • the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of human ethanol dehydrogenase 39 protein, which comprises utilizing the polypeptide of the invention.
  • the present invention also relates to a compound obtained by the method.
  • the present invention also relates to a method for detecting a disease or disease susceptibility related to abnormal expression of human ethanol dehydrogenase 39 protein in vitro, which comprises detecting the polypeptide or a multi-nucleus encoded therein in a biological sample Mutations in the nucleotide sequence, or the amount or biological activity of a polypeptide of the invention in a biological sample.
  • the invention also relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
  • the present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention in the preparation of a medicament for treating cancer, developmental disease or immune disease or other diseases caused by abnormal expression of human alcohol dehydrogenase 39.
  • Nucleic acid sequence refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DNA or RM, they can be single-stranded or double-stranded, representing the sense or antisense strand.
  • amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
  • amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
  • a protein or polynucleotide “variant” refers to an amino acid sequence having one or more amino acids or nucleotide changes, or a polynucleotide sequence encoding it.
  • the change may include an amino acid sequence or a nucleotide sequence Amino acid or nucleotide deletions, insertions or substitutions.
  • Variants may have "conservative" changes in which the substituted amino acid has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine. Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
  • “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
  • Insertion means that a change in the amino acid sequence or nucleotide sequence results in an increase in one or more amino acids or nucleotides compared to a molecule that exists in nature.
  • Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
  • Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
  • immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response in appropriate animals or cells and to bind to specific antibodies.
  • An "agonist” refers to a molecule that, when combined with human ethanol dehydrogenase 39, causes the protein to change, thereby regulating the activity of the protein.
  • An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that binds human ethanol dehydrogenase 39.
  • Antagonist refers to a molecule that, when combined with human ethanol dehydrogenase 39, can block or regulate the biological or immunological activity of human ethanol dehydrogenase 39.
  • Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates, or any other molecule that can bind human ethanol dehydrogenase 39.
  • Regular refers to a change in the function of human ethanol dehydrogenase 39, including an increase or decrease in protein activity, a change in binding characteristics, and any other biological, functional, or immunological changes in human ethanol dehydrogenase 39.
  • substantially pure ' means substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated.
  • Those skilled in the art can purify human ethanol dehydrogenase 39 using standard protein purification techniques. Basically Pure human ethanol dehydrogenase 39 can generate a single main band on a non-reducing polyacrylamide gel. The purity of human ethanol dehydrogenase 3 polypeptide can be analyzed by amino acid sequence.
  • Complementary refers to the natural binding of a nucleotide by base-pairing under conditions of acceptable salt concentration and temperature.
  • sequence "C-T-G-A” can be combined with the complementary sequence "G-A-C-T”.
  • the complementarity between two single-stranded molecules may be partial or complete.
  • the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
  • “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
  • Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. The inhibition of such hybridization can be detected by performing hybridization (Southern or Northern blotting, etc.) under conditions of reduced stringency. Substantially homologous sequences or hybridization probes can compete and inhibit completely homologous sequences from Binding of target sequences under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.
  • Percent identity refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALIGN program (Lasergene software package, DNASTAR, Inc., Madi son Wis.). The MEGALIGN program can compare two or more sequences according to different methods such as the Clus ter method (Higgins, D. G. and P. M. Sharp (1988) Gene 73: 237-244). The Clus ter method arranges groups of sequences into clusters by checking the distance between all pairs. The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by:
  • the assay may be Jotun Hein percent identity between nucleic acid sequences (Hein J "(1990) Methods in emz bacteria ology 183: 625-645) by Clus ter or a method known in the art 0
  • Similarity refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
  • Amino acids used for conservative substitutions for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
  • Antisense refers to a nucleotide sequence that is complementary to a particular DM or RM sequence.
  • Antisense strand refers to a nucleic acid strand that is complementary to the “sense strand”.
  • Derivative refers to a chemical modification of HFP or a nucleic acid encoding it. Such a chemical modification may be the replacement of a hydrogen atom with an alkyl group, an acyl group or an amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological characteristics of natural molecules.
  • Antibody refers to a complete antibody molecule and its fragments, such as Fa,? ( ⁇ ') 2 and?, which can specifically bind to the epitope of human alcohol dehydrogenase 39.
  • a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
  • isolated refers to the removal of a substance from its original environment (for example, its natural environment if it occurs naturally).
  • a naturally occurring polynucleotide or polypeptide is not isolated when it is present in a living animal, but the same polynucleotide or polypeptide coexists with some or all of it in a natural system.
  • the separation of matter is separation.
  • Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not a component of its natural environment, they are still isolated.
  • isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
  • polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances existing in the natural state. .
  • isolated human ethanol dehydrogenase 39 means that human ethanol dehydrogenase 39 is substantially free of other proteins, lipids, sugars, or other substances with which it is naturally associated. Those skilled in the art can purify human ethanol dehydrogenase 39 using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of human ethanol dehydrogenase 39 polypeptide can be separated by amino acid sequence.
  • the present invention provides a new polypeptide, human ethanol dehydrogenase 39, which is basically composed of the amino acid sequence shown in SEQ ID NO: 2.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
  • the polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques. Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
  • the invention also includes fragments, derivatives and analogs of human alcohol dehydrogenase 39.
  • fragment refers to a polypeptide that substantially maintains the same biological function or activity of the human alcohol dehydrogenase 39 of the present invention.
  • a fragment, derivative, or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution
  • the amino acid may or may not be encoded by a genetic codon; or ( ⁇ ) a type in which a group on one or more amino acid residues is substituted by another group to include a substituent; or ( ⁇ ⁇ )
  • Such a type in which the mature polypeptide is fused with another compound such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol
  • UV a type in which the additional amino acid sequence is fused into the mature polypeptide and formed by the polypeptide sequence ( Such as the leader sequence or secreted sequence or the sequence used to purify this polypeptide or protease sequence)
  • such fragments, derivatives and analogs are considered to be within the knowledge of those skilled in the art.
  • the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
  • Polynucleotides of the invention are found from a CDM library of human fetal brain tissue. Polynucleoside The full length of the acid sequence is 1613 bases, and its open reading frame 147-1202 encodes 351 amino acids.
  • This polypeptide has a characteristic sequence of the alcohol dehydrogenase family, and it can be deduced that the human alcohol dehydrogenase 39 has the structure and function represented by the alcohol dehydrogenase family.
  • the polynucleotide of the present invention may be in the form of DNA or RNA.
  • DM forms include cDNA, genomic DNA or synthetic DNA.
  • DNA can be single-stranded or double-stranded.
  • DNA can be coding or non-coding.
  • the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
  • a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
  • the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
  • polynucleotide encoding a polypeptide refers to a polynucleotide that includes the polypeptide and a polynucleotide that includes additional coding and / or non-coding sequences.
  • the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
  • This polynucleotide variant can be a naturally occurring allelic variant or a non-naturally occurring variant.
  • These nucleotide variants include substitution variants, deletion variants, and insertion variants.
  • an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
  • the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity between the two sequences).
  • the present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions.
  • “strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60 ° C; or (2) Add denaturants during hybridization, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% Fico ll, 42 ° C, etc .; or (3) only between two sequences Hybridization occurs only when the identity is at least 95%, and more preferably 97%.
  • the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
  • nucleic acid fragments that hybridize to the sequences described above.
  • a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 nuclei. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques such as PCR to identify and / or isolate polynucleotides encoding human ethanol dehydrogenase 39.
  • polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
  • the specific polynucleotide sequence encoding the human alcohol dehydrogenase 39 of the present invention can be obtained by various methods.
  • polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or CDM libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
  • the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.
  • genomic DNA isolation is the least commonly used. Direct chemical synthesis of DM sequences is often the method of choice.
  • the more commonly used method is the isolation of cDNA sequences.
  • the standard method for isolating a cDNA of interest is to isolate niRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library. There are many mature techniques for mRNA extraction. Kits are also commercially available (Qiagene).
  • the construction of cDNA libraries is also a common method (Sambrook, et al., Mol ecu lar Cling, A Labora tory Manua, Cold Spring Harbor Labora tory. New York, 1989).
  • Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
  • genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DM-RNA hybridization; (2) the presence or absence of marker gene functions; (3) determination of the level of human ethanol dehydrogenase 39 transcripts; (4) ) Detection of protein products expressed by genes through immunological techniques or determination of biological activity. The above methods can be used singly or in combination.
  • the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
  • the length of the probe is usually within 2,000 nucleotides, and preferably within 1,000 nucleotides.
  • the probe used here is usually a DM sequence chemically synthesized based on the gene sequence information of the present invention.
  • the genes or fragments of the present invention can of course be used as probes.
  • DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
  • immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELI SA) can be used to detect protein products expressed by the human ethanol dehydrogenase 39 gene.
  • ELI SA enzyme-linked immunosorbent assay
  • a method of applying a PCR technique to amplify DM / RNA is preferably used to obtain the gene of the present invention.
  • the RACE method RACE_cDNA terminal rapid amplification method
  • the primers for PCR may be appropriately based on the polynucleotide sequence information of the present invention disclosed herein.
  • the amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
  • Polynucleotide sequences of the gene of the present invention obtained as described above, or various DNA fragments can be used It is determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. To obtain the full-length CDM sequence, sequencing needs to be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
  • the present invention also relates to a vector comprising a polynucleotide of the present invention, and a host cell genetically engineered using the vector of the present invention or directly using a human alcohol dehydrogenase 39 coding sequence, and a method for producing a polypeptide of the present invention by recombinant technology. .
  • a polynucleotide sequence encoding human ethanol dehydrogenase 39 can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
  • vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
  • Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al.
  • any plasmid and vector can be used to construct a recombinant expression vector.
  • An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
  • Methods known to those skilled in the art can be used to construct expression vectors containing a DM sequence encoding human ethanol dehydrogenase 39 and appropriate transcription / translation regulatory elements. These methods include in vitro recombinant DNA technology, DNA synthesis technology, in vivo recombinant technology, etc. (Sambroook, etal. Mo l ecu l ar C lon ing, a Labora tory Manua l, co ld Spr ing Ha, rbor Labora t ory. New York, 1989).
  • the DNA sequence can be operably linked to an appropriate promoter in an expression vector to direct mRNA synthesis. Representative examples of these promoters are: the lac or trp promoter of E.
  • the expression vector also includes a ribosome binding site for translation initiation, a transcription terminator, and the like. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polytumor enhancers on the late side of the origin of replication, and adenoviral enhancers.
  • the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance for eukaryotic cell culture. And green fluorescent protein (GFP), or tetracycline or ampicillin resistance for E. coli.
  • selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance for eukaryotic cell culture.
  • GFP green fluorescent protein
  • tetracycline or ampicillin resistance for E. coli.
  • a polynucleotide encoding human ethanolase 39 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a genetically engineered host cell containing the polynucleotide or the recombinant vector.
  • the term "host cell” refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E.
  • coli Streptomyces
  • bacterial cells such as Salmonella typhimurium
  • fungal cells such as yeast
  • plant cells insect cells
  • fly S 2 or Sf 9 animal cells
  • animal cells such as CH0, COS or Bowes s melanoma cells Wait.
  • Transformation of a host cell with a DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art.
  • the host is a prokaryote such as E. coli
  • competent cells capable of DNA uptake can be harvested after exponential growth phase, with (: Treatment 1 2, steps well known in the art with alternative is MgC l 2
  • transformation can also be performed by electroporation.
  • the host is a eukaryote
  • the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and lipids. Body packaging, etc.
  • the polynucleotide sequence of the present invention can be used to express or produce recombinant human ethanol dehydrogenase 39 (Scieence, 1984; 224: 14 31). Generally there are the following steps:
  • the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
  • a suitable method such as temperature conversion or chemical induction
  • the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell.
  • recombinant proteins can be isolated and purified by various separation methods using their physical, chemical, and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
  • conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromat
  • Fig. 1 is a comparison diagram of the amino acid sequences of the functional domains of the alcohol dehydrogenase 39 and the alcohol dehydrogenase family of the present inventors.
  • Figure 1 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of human ethanol dehydrogenase 39 isolated.
  • 39KDa is the molecular weight of the protein.
  • the arrow indicates the isolated protein band. The best way to implement the invention
  • RNA Human fetal brain total RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform.
  • Poly (A) mRNA was isolated from total RNA using Quik mRNA I solat ion Kit (product of Qiegene). 2ug poly (A) mRNA is reverse transcribed to form cDNA.
  • the Smart cDNA cloning kit purchased from Clontech
  • Clontech was used to insert the 00 fragment into the multiple cloning site of the pBSK (+) vector (Clontech) to transform DH5 ⁇ .
  • the bacteria formed a cDNA library.
  • Dye terminate cycle reaction ion sequencing kit Perkin-Elmer
  • ABI 377 automatic sequencer Perkin-Elmer
  • the determined cDNA sequence was compared with the existing public DM sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 0578f04 was new DNA.
  • the inserted cDNA fragments contained in this clone were determined in both directions by synthesizing a series of primers.
  • the 0578f 04 clone contains a full-length cDNA of 1613bp (as shown in Seq ID NO: l), and has a 1056bp open reading frame (0RF) from 147bp to 1202bp, encoding a new protein (such as Seq ID NO: 2).
  • This clone pBS-0578f 04 and the encoded protein was named human ethanol dehydrogenase 39.
  • Example 2 Domain analysis of cDNA clones
  • the sequence of the human alcohol dehydrogenase 39 and its encoded protein sequence of the present invention were profiled by the GCF prof le scan program (Basiclocal Information search tool) [Altschul, SF et al. J. Mol. Biol. 1990; 215: 403-10], performing domain analysis in databases such as Prote.
  • the human alcohol dehydrogenase 39 of the present invention is homologous to the domain alcohol dehydrogenase family, and the results of the homology are shown in Figure 1.
  • Example 3 Cloning of the gene encoding human alcohol dehydrogenase 39 by RT-PCR
  • CDNA was synthesized using fetal brain cell total RM as a template and oligo-dT as a primer.
  • PCR amplification was performed with the following primers:
  • Primer 1 5'- GGCGGTCAGAGGGCCGAGGCCTGG -3 '(SEQ ID NO: 3)
  • Primer2 5'- TTCAACAAATCTTTACTCAGTGCC -3 '(SEQ ID NO: 4)
  • Primerl is a forward sequence starting at lbp of the 5th end of SEQ ID NO: 1;
  • Primer2 is the 3 'end reverse sequence in SEQ ID NO: 1.
  • Conditions for the amplification reaction 50 ol / L KC1, 10 mmol / L Tris-CI, (pH8.5), 1.5 mmol / L MgCl 2 , 200 ⁇ mol / L dNTP, lOpmol primer, 1U in a 50 ⁇ 1 reaction volume Taq DNA polymerase (C 1 on tech).
  • the reaction was performed on a PE9600 DNA thermal cycler (PerkinnElmer) for 25 cycles under the following conditions: 94 ° C 30sec; 55 ° C 30sec; 72 C 2min.
  • ⁇ -actin was set as a positive control and template blank was set as a negative control.
  • the amplified product was purified using a QIAGEN kit and ligated to a pCR vector (Invitrogen product) using a TA cloning kit.
  • the DNA sequence analysis results showed that the MA sequence of the PCR product was exactly the same as the 1-1616bp shown in SEQ ID NO: 1.
  • Example 4 Analysis of human alcohol dehydrogenase 39 gene expression by Northern blotting:
  • RNA extraction in one step [Anal. Biochem 1987, 162, 156-159] 0
  • This method involves acid guanidinium thiocyanate-chloroform extraction. That is, the tissue is homogenized with 4M guanidinium isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1 ), Mix and centrifuge. The aqueous phase was aspirated, isopropanol (0.8 vol) was added and the mixture was centrifuged to obtain a RM precipitate. The obtained RM precipitate was washed with 70% ethanol, dried and dissolved in water.
  • RNA was synthesized by electrophoresis on a 1.2% agarose gel containing 20 mM 3- (N-morpholino) propanesulfonic acid (pH 7.0)-5 mM sodium acetate-1 mM EDTA-2.2M formaldehyde. It was then transferred to a nitrocellulose membrane.
  • the DNA probe used was the PCR amplified human alcohol dehydrogenase 39 coding region sequence (147bp to 1202bp) shown in FIG. 1.
  • a 32P-labeled probe (approximately 2 x 10 6 cpm / ml) was hybridized with a nitrocellulose membrane to which RNA was transferred at 42 ° C overnight in a solution containing 50% formamide-25mM KH 2 P0 4 (pH7.4)-5 xSSC- 5 x Denhardt's solution and 200 ⁇ ⁇ / ⁇ salmon sperm DNA. After hybridization, the filter was washed in 1 x SSC-0.1% SDS at 55 C for 30 min. Then, Phosphor Imager was used for analysis and quantification.
  • Example 5 In vitro expression, isolation and purification of recombinant human ethanol dehydrogenase 39
  • Pr imer 3 5'- CCCCATATGATGATTGTTCAAAGAGTGGTATTG -3 '(Seq ID No: 5)
  • Primer4 5'- CCCAAGCTTTTACAAAGAGATTTCTTCTGAAAT -3' (Seq ID No: 6)
  • the 5 'ends of these two primers contain Ndel and Hindlll digestion sites, respectively Points, followed by the coding sequences of the 5 'and 3' ends of the gene of interest, respectively, and the Ndel and Hindll l digestion sites correspond to the expression vector plasmid pET
  • PCR was performed using the pBS-0578f 04 plasmid containing the full-length target gene as a template.
  • the PCR reaction conditions were as follows: 10 pg of pBS-0578f 04 plasmid contained in a total volume of 50 ⁇ 1, Primer-3 and Primer-4 primers were 10 pmol, Advantage polymerase Mix (Clontech) 1 ⁇ 1, respectively. Cycle parameters: 94 ° C 20s, 60 ° C 30s, 68. C 2 min, a total of 25 cycles.
  • Ndel and Hindll l were used to double-digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase.
  • the ligation product was transformed into E. coli DH5a by the calcium chloride method. After being cultured overnight on LB plates containing kanamycin (final concentration 30 g / ml), positive clones were screened by colony PCR method and sequenced. A positive clone (PET-0578f 04) with the correct sequence was selected, and the recombinant plasmid was transformed into E. coli BL21 (DE3) plySs (product of Novagen) by the calcium chloride method.
  • the host bacteria BL21 P BT-0578f 04 was cultured at 37 ° C to the logarithmic growth phase, and IPTG was added to a final concentration of 1 mmol / L , Continue to cultivate for 5 hours. The bacteria were collected by centrifugation, and the supernatant was collected by centrifugation. The supernatant was collected by centrifugation. Chromatography was performed using an affinity chromatography column His s. Bind Quick Cartr idge (product of Novagen) capable of binding to 6 histidines (6His-Tag). The purified target protein human ethanol dehydrogenase 39 was obtained.
  • Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
  • the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
  • the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
  • the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method.
  • Filter hybridization methods include dot blotting, Southern imprinting, Northern blotting, and copying methods. They all use the same steps to immobilize the polynucleotide sample to be tested on the filter.
  • the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer to saturate the non-specific binding site of the sample on the filter with the carrier and the synthesized polymer.
  • the pre-hybridization solution is then replaced with a hybridization buffer containing labeled probes and incubated to hybridize the probes to the target nucleic acid.
  • the unhybridized probes are removed by a series of membrane washing steps.
  • This embodiment uses higher-intensity washing conditions (such as lower salt concentration and higher temperature), so that the hybridization background is reduced and only strong specific signals are retained.
  • the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
  • the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
  • the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
  • oligonucleotide fragments from the polynucleotide SEQ ID NO: 1 of the present invention for use as hybridization probes should follow the following principles and several aspects to be considered:
  • the preferred range of probe size is 18-50 nucleotides
  • the GC content is 30% -70%, and the non-specific hybridization increases when it exceeds;
  • Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences The column and its complementary region are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, the primary probe should not be used generally
  • Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
  • Probe 2 which belongs to the second type of probe, is equivalent to the replacement mutant sequence of the gene fragment of SEQ ID NO: 1 or its complementary fragment (41Nt):
  • PBS phosphate buffered saline
  • step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
  • NC membranes nitrocellulose membranes
  • Two NC membranes are required for each probe, so that they can be used in the following experimental steps.
  • the film was washed with high-strength conditions and strength conditions, respectively.
  • probe 1 can be used to qualitatively and quantitatively analyze the presence and differential expression of the polynucleotide of the present invention in different tissues.
  • Example 8 DNA Microarray Gene microarrays or DNA microarrays are new technologies currently being developed by many national laboratories and large pharmaceutical companies.
  • the polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research of new gene functions; search for and screen new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases .
  • the specific method steps have been reported in the literature. For example, see DeRi si, JL, Lyer, V. & Brown, P. 0. (1997) Science 278, 680-686. And Hel le, RA, Schema, M., Chai, A., Sha lom, D., (1997) PNAS 94: 2150-2155.
  • a total of 4,000 polynucleotide sequences of various full-length cDMs are used as target DNA, including the polynucleotide of the present invention. They were amplified by PCR respectively. After purification, the amplified product was adjusted to a concentration of about 500 ng / ul, and spotted on a glass medium with a Cartesian 7500 spotter (purchased from Cartesian Company, USA). The distance between them is 280 ⁇ ⁇ . The spotted slides were hydrated, dried, and cross-linked in a purple diplomatic coupling instrument. After elution, the DNA was fixed on a glass slide to prepare a chip. The specific method steps have been reported in the literature in various ways. The post-spot processing steps of this embodiment are:
  • Total mRNA was extracted from normal liver and liver cancer in one step, and the mRNA was purified with Oligotex raRNA Midi Kit (purchased from QiaGen).
  • the fluorescent reagent Cy3dUTP (5- Amino- propargyl-2 ' -deoxyur idine 5'-tr iphate coupled to Cy3 f luorescent dye (purchased from Amersham Phamac ia Biotech) was used to label the mRNA of normal liver tissue, and the fluorescent reagent Cy5dUTP (5-Amino-propargyl-2'-deoxyur idine 5> -tr iphate cou led to Cy5 f luorescent dye (purchased from Amersham Phamacia Biotech) was used to label mRNA of liver cancer tissue, and the probe was prepared after purification.
  • Cy3dUTP 5- Amino- propargyl-2 ' -deoxyur idine 5'-tr iphate coupled
  • the probes from the above two types of tissues were hybridized with the chip in a UniHyb TM Hybridization Solution (purchased from TeleChem) hybridization solution for 16 hours, and washed with a washing solution (lx SSC, 0.2% SDS) at room temperature. After scanning with a ScanArray 3000 scanner (purchased from General Scanning, USA), the scanned images were analyzed by Imagene software (Biodi scovery, USA), and the Cy3 / Cy5 ratio of each point was calculated. The ratio was less than 0. Points greater than 5 are considered to be genes with differential expression.
  • polypeptides of the present invention as well as antagonists, agonists and inhibitors of the polypeptides, can be directly used in the treatment of diseases, for example, they can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection, and immune diseases.
  • the polypeptide of the present invention contains highly conserved sequence fragments of the alcohol dehydrogenase family, which is a zinc atom-dependent dehydrogenase in the body, cooperates with nicotinamide coenzyme, and participates in a variety of metabolism with the respiratory chain in the body Related physiological processes.
  • the abnormal expression of the polypeptide is usually closely related to the occurrence of various respiratory metabolic disorders in the body, the related metabolic disorders of various substances, and the tumors and cancers of some related tissues.
  • the abnormal expression of the human alcohol dehydrogenase 39 of the present invention will produce various diseases, especially material metabolism disorders, embryonic development disorders, growth and development disorders, tumors, and inflammation. These diseases include, but are not limited to:
  • Material metabolism disorders isovalerate, propionate, methylmalonic aciduria, combined carboxylase deficiency, glutarate type I, phenylketonuria, albinism, serotoninemia, Glycineemia, hypersarcosineemia, metabolic deficiency disease of the urea cycle, histidine metabolism deficiency disease, mucopolysaccharidosis, rheumatoid mucopolysaccharidosis, Ray-niney syndrome, xanthineuria, orotic aciduria, adenine deaminase deficiency, hyperlipoproteinemia, glycogen storage disease
  • Fetal developmental disorders congenital abortion, cleft palate, limb loss, limb differentiation disorder, cryptorchidism, congenital inguinal hernia, atrial septal defect, neural tube defect, congenital hydrocephalus, iris defect, congenital glaucoma or cataract, Congenital deafness
  • Growth disorders mental retardation, mental retardation, strabismus, skin, fat, and muscular dysplasia such as congenital skin laxity, albinism, premature aging, congenital hypokeratosis, bone and joint dysplasia such as Cartilage hypoplasia, epiphyseal dysplasia, metabolic bone disease, various metabolic defects, stunting, dwarfism, Cushing syndrome, sexual retardation
  • Tumors of various tissues gastric cancer, liver cancer, lung cancer, esophageal cancer, breast cancer, leukemia, lymphoma, thyroid tumor, uterine fibroids, neuroblastoma, astrocytoma, ependymoma, glial cells Tumors, neurofibromas, colon cancer, endometrial cancer, gallbladder cancer, colon cancer, thymic tumor, nasal cavity and sinus tumor, nasopharyngeal cancer, laryngeal cancer, tracheal tumor, fibroid, fibrosarcoma, lipoma, liposarcoma
  • Inflammation ⁇ Allergic reactions, bronchial asthma, adult respiratory distress syndrome, sarcoidosis, rheumatoid arthritis, rheumatoid arthritis, osteoarthritis, dermatomyositis, urticaria, specific dermatitis, polymyositis Addison's disease, Graves' disease, intestinal emergency syndrome, chronic rhinitis, atrophic gastritis, chronic gastritis, systemic lupus erythematosus, myasthenia gravis, multiple spinal cord sclerosis, Guillain-Barre syndrome Intracranial granuloma, multiple scleroderma, pancreatitis, cholecystitis, glomerulonephritis, chronic active hepatitis, myocarditis, cardiomyopathy, atherosclerosis, gastric ulcer, benign prostatic hyperplasia, cervicitis, Various infectious inflammations
  • human alcohol dehydrogenase 39 of the present invention will also produce certain hereditary, hematological and immune system diseases.
  • polypeptides of the present invention can be directly used in the treatment of diseases, for example, they can treat various diseases, especially material metabolic disorders, embryonic development disorders, growth disorders, tumors, Inflammation, some hereditary, hematological and immune system diseases.
  • the invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) human ethanol dehydrogenase 39.
  • Agonists enhance biological functions such as human alcohol dehydrogenase 39 to stimulate cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
  • mammalian cells or membrane preparations expressing human ethanol dehydrogenase 39 can be cultured together with labeled human ethanol dehydrogenase 39 in the presence of drugs. The ability of the drug to increase or block this interaction is then determined.
  • Antagonists of human alcohol dehydrogenase 39 include antibodies, compounds, receptor deletions, and the like that have been screened. Antagonists of human alcohol dehydrogenase 39 can bind to human alcohol dehydrogenase 39 and eliminate its function. Either the production of the polypeptide is inhibited or the active site of the polypeptide is combined so that the polypeptide cannot perform a biological function.
  • human alcohol dehydrogenase 39 can be added to the bioanalytical assay to determine whether the compound is an antagonist by measuring the effect of the compound on the interaction between human alcohol dehydrogenase 39 and its receptor. .
  • Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds.
  • Polypeptide molecules capable of binding to human ethanol dehydrogenase 39 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. In screening, the human ethanol dehydrogenase 39 molecule should generally be labeled.
  • the present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies.
  • the invention also provides antibodies directed against the human alcohol dehydrogenase 39 epitope. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments generated from Fab expression libraries.
  • Polyclonal antibodies can be produced by injecting human ethanol dehydrogenase 39 directly into immunized animals (such as rabbits, mice, rats, etc.).
  • immunized animals such as rabbits, mice, rats, etc.
  • a variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's adjuvant. Wait.
  • Techniques for preparing monoclonal antibodies to human alcohol dehydrogenase 39 include, but are not limited to, hybridoma technology (Kohl ei: and Miste in. Nature, 1975, 256: 495-497), triple tumor technology, human beta cells Hybridoma technology, EBV-hybridoma technology, etc.
  • Chimeric antibodies that bind human constant regions and non-human-derived variable regions can be produced using existing techniques (Morrison et al., PNAS, 1985, 81: 6851).
  • the existing technology for producing single chain antibodies (U.S. Pat No. 4946778) can also be used to produce single chain antibodies against human ethanol dehydrogenase 39.
  • Anti-human ethanol dehydrogenase 39 antibodies can be used in immunohistochemical techniques to detect human ethanol dehydrogenase 39 in biopsy specimens.
  • Monoclonal antibodies that bind to human ethanol dehydrogenase 39 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
  • Antibodies can also be used to design immunotoxins that target a particular part of the body.
  • human ethanol dehydrogenase 39 high affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
  • a common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
  • This hybrid antibody can be used to kill human ethanol dehydrogenase 39 positive cells .
  • the antibodies in the present invention can be used to treat or prevent diseases related to human alcohol dehydrogenase 39.
  • Administration of an appropriate dose of antibody can stimulate or block the production or activity of human alcohol dehydrogenase 39.
  • the invention also relates to a diagnostic test method for quantitatively and locally detecting the level of human ethanol dehydrogenase 39. These tests are well known in the art and include FISH assays and radioimmunoassays.
  • the level of human ethanol dehydrogenase 39 detected in the test can be used to explain the importance of human ethanol dehydrogenase 39 in various diseases and to diagnose diseases in which human ethanol dehydrogenase 39 functions.
  • the polypeptide of the present invention can also be used for peptide mapping analysis.
  • the polypeptide can be specifically cleaved by physical, chemical or enzyme, and can be analyzed by one-dimensional or two-dimensional or three-dimensional gel electrophoresis, and more preferably by mass spectrometry coding.
  • the polynucleotide of human alcohol dehydrogenase 39 can also be used for a variety of therapeutic purposes. Gene therapy technology can be used to treat abnormal cell proliferation, development or metabolism caused by the non-expression or abnormal / inactive expression of human alcohol dehydrogenase 39.
  • Recombinant gene therapy vectors can be designed to express mutated human alcohol dehydrogenase 39 to inhibit endogenous human alcohol dehydrogenase 39 activity.
  • a variant human ethanol dehydrogenase 39 may be a shortened human ethanol dehydrogenase 39 lacking a signaling domain, and although it can bind to a downstream substrate, it lacks signaling activity. Therefore, the recombinant gene therapy vector can be used for treating diseases caused by abnormal expression or activity of human alcohol dehydrogenase 39.
  • Virus-derived expression vectors such as retroviruses, adenoviruses, adenovirus-associated viruses, herpes simplex virus, and parvoviruses can be used to transfer the polynucleotide encoding human ethanol dehydrogenase 39 into cells.
  • Methods for constructing recombinant viral vectors carrying a polynucleotide encoding human alcohol dehydrogenase 39 can be found in the existing literature (Safflbrook, et al.).
  • the polynucleotide encoding human ethanol dehydrogenase 39 can be packaged into liposomes and transferred into cells.
  • Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
  • a vector such as a virus, phage, or plasmid
  • Oligonucleotides including antisense RNA and DM
  • ribozymes that inhibit human alcohol dehydrogenase 39 mRNA are also within the scope of the present invention.
  • a ribozyme is an enzyme-like RNA molecule that specifically decomposes a specific RM. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation.
  • Antisense RNA, DNA and ribozymes can be obtained by any RNA or DNA synthesis technology, such as solid-phase phosphate amide chemical synthesis to synthesize oligonucleotides.
  • Antisense RM molecules can be obtained by in vitro or in vivo transcription of DM sequences encoding the RNA.
  • This DNA sequence is integrated downstream of the vector's RNA polymerase promoter.
  • it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the linkage between ribonucleosides using phosphorothioate or peptide bonds instead of phosphodiester bonds.
  • the polynucleotide encoding human alcohol dehydrogenase 39 can be used for the diagnosis of diseases related to human alcohol dehydrogenase 39.
  • the polynucleotide encoding human alcohol dehydrogenase 39 can be used to detect the expression of human alcohol dehydrogenase 39 and No or abnormal expression of human alcohol dehydrogenase 39 in a disease state.
  • the DNA sequence encoding human alcohol dehydrogenase 39 can be used to hybridize biopsy specimens to determine the expression of human alcohol dehydrogenase 39.
  • Hybridization techniques include Southern blotting, Northern blotting, and in situ hybridization. These techniques and methods are publicly available and mature, and related kits are commercially available.
  • a part or all of the polynucleotides of the present invention can be used as probes to be fixed on a microarray (Microarray) or a DM chip (also known as a "gene chip") for analyzing differential expression analysis and gene diagnosis of genes in tissues.
  • Human ethanol dehydrogenase 39-specific primers can also be used to detect the transcription products of human alcohol dehydrogenase 39 by RNA-polymerase chain reaction (RT-PCR) in vitro amplification.
  • Detection of mutations in the human alcohol dehydrogenase 39 gene can also be used to diagnose human alcohol dehydrogenase 39-related diseases.
  • Human ethanol dehydrogenase 39 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type human ethanol dehydrogenase 39 DNA sequence. Mutations can be detected using well-known techniques such as Southern blotting, DM sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression. Therefore, Northern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
  • the sequences of the invention are also valuable for chromosome identification.
  • the sequence specifically targets a specific position on a human chromosome and can hybridize to it.
  • specific sites for each gene on the chromosome need to be identified.
  • only a few chromosome markers based on actual sequence data are available for marking chromosome positions.
  • an important first step is to locate these DM sequences on a chromosome.
  • a PCR primer (preferably 15-35bp) is prepared from the cDNA, and the sequence can be located on the chromosome. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
  • PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
  • oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
  • Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and hybrid pre-selection to construct chromosome-specific cDM libraries.
  • Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step.
  • FISH Fluorescent in situ hybridization
  • the physical location of the sequence on the chromosome can be correlated with the genetic map data. These data can be found in, for example, V. Mckusick, Mendel i an Inher i tance in Man (available through contact with Johns Hopkins Univers i ty Welch Medica l Library available online). Linkage analysis can then be used to determine the relationship between genes and diseases that are mapped to chromosomal regions.
  • the difference in cDM or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).
  • the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
  • suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
  • the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
  • the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell.
  • the polypeptides of the invention can be used in combination with other therapeutic compounds.
  • the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
  • Human alcohol dehydrogenase 39 is administered in an amount effective to treat and / or prevent a specific indication.
  • the amount and range of human ethanol dehydrogenase 39 to be administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician.

Abstract

L'invention concerne un nouveau polypeptide, une alcool déshydrogénase humaine 39, et un polynucléotide codant pour ce polypeptide ainsi qu'un procédé d'obtention de ce polypeptide par des techniques recombinantes d'ADN. L'invention concerne en outre les applications de ce polypeptide dans le traitement de maladies, notamment des tumeurs malignes, de l'hémopathie, de l'infection par VIH, de maladies immunitaires et de diverses inflammations. L'invention concerne aussi l'antagoniste agissant contre le polypeptide et son action thérapeutique ainsi que les applications de ce polynucléotide codant pour l'alcool déshydrogénase humaine 39.
PCT/CN2001/000088 2000-01-28 2001-01-21 Nouveau polypeptide, alcool deshydrogenase humaine 39, et polynucleotide codant pour ce polypeptide WO2001055404A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU2001233564A AU2001233564A1 (en) 2000-01-28 2001-01-21 A novel polypeptide, a human alcohol dehydrogenase 39 and the polynucleotide encoding the polypeptide

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN 00111616 CN1307115A (zh) 2000-01-28 2000-01-28 一种新的多肽——人乙醇脱氢酶39和编码这种多肽的多核苷酸
CN00111616.9 2000-01-28

Publications (1)

Publication Number Publication Date
WO2001055404A1 true WO2001055404A1 (fr) 2001-08-02

Family

ID=4581525

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2001/000088 WO2001055404A1 (fr) 2000-01-28 2001-01-21 Nouveau polypeptide, alcool deshydrogenase humaine 39, et polynucleotide codant pour ce polypeptide

Country Status (3)

Country Link
CN (1) CN1307115A (fr)
AU (1) AU2001233564A1 (fr)
WO (1) WO2001055404A1 (fr)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2002026951A2 (fr) * 2000-09-29 2002-04-04 Incyte Genomics Inc Oxydoreductases

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
HUE032045T2 (en) * 2011-07-20 2017-08-28 Evonik Degussa Gmbh Oxidation and amination of primary alcohols

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
DATABASE GENBANK [online] 2 November 1999 (1999-11-02), Database accession no. AF182373 *
DATABASE GENBANK [online] 27 October 1999 (1999-10-27), Database accession no. AC012392 *
DATABASE GENBANK [online] 6 November 1999 (1999-11-06), Database accession no. AC012477 *
GENOME RES., vol. 8, no. 11, November 1998 (1998-11-01), pages 1097 - 1108 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2002026951A2 (fr) * 2000-09-29 2002-04-04 Incyte Genomics Inc Oxydoreductases
WO2002026951A3 (fr) * 2000-09-29 2003-03-27 Incyte Genomics Inc Oxydoreductases

Also Published As

Publication number Publication date
AU2001233564A1 (en) 2001-08-07
CN1307115A (zh) 2001-08-08

Similar Documents

Publication Publication Date Title
WO2001055404A1 (fr) Nouveau polypeptide, alcool deshydrogenase humaine 39, et polynucleotide codant pour ce polypeptide
WO2001055189A1 (fr) NOUVEAU POLYPEPTIDE, SECp43, 32 S'ASSOCIANT AVEC L'ARNt DE LA SELENOCYSTEINE HUMAINE, ET POLYNUCLEOTIDE CODANT POUR CE POLYPEPTIDE
WO2001066707A1 (fr) Nouveau polypeptide, serine protease humaine atp-dependante 11, et polynucleotide codant pour ce polypeptide
WO2001046240A1 (fr) Nouveau polypeptide, mariner transposase 19 humaine, et polynucleotide codant pour ce polypeptide
WO2001075085A1 (fr) Nouveau polypeptide, serine hydrolase humaine atp-dependante 11.3, et polynucleotide codant pour ce polypeptide
WO2001053492A1 (fr) Nouveau polypeptide, s-adenosylmethionine synthetase 31, et polynucleotide codant pour ce polypeptide
WO2001046430A1 (fr) Nouveau polypeptide, peroxydase 12, et polynucleotide codant pour ce polypeptide
WO2002048356A1 (fr) Nouveau polypeptide, proteine humaine formee de cytochromes 45, et polynucleotide codant ce polypeptide
WO2001075023A2 (fr) Nouveau polypeptide, phosphatidylinositol-3 (ptdins 3) kinase humaine 9, et polynucleotide codant pour ce polypeptide
WO2002020606A1 (fr) Nouveau polypeptide, la proteine humaine 38.39 liee aux defauts d'audition, et polynucleotide codant pour elle
WO2001081382A1 (fr) Nouveau polypeptide, proteine hs1 humaine 16, et polynucleotide codant pour ce polypeptide
WO2001075024A2 (fr) Nouveau polypeptide, facteur humain 13 associe a nf-e2, et polynucleotide codant pour ce polypeptide
WO2001066591A1 (fr) Nouveau polypeptide, proteine humaine 11 de reception tyrosine phosphatase, et polynucleotide codant pour ce polypeptide
WO2001048198A1 (fr) Nouveau polypeptide, proteine ribosomale s4 8, et polynucleotide codant pour ce polypeptide
WO2001047993A1 (fr) Nouveau polypeptide, proteine d'echange anionique 9, et polynucleotide codant pour ce polypeptide
WO2001040288A1 (fr) Nouveau polypeptide, uteroglobine humaine 13, et polynucleotide codant pour ce polypeptide
WO2001072787A1 (fr) Nouveau polypeptide, facteur humain 10 induisant l'assemblage des peroxysomes, et polynucleotide codant pour ce polypeptide
WO2001081395A1 (fr) Nouveau polypeptide, adn topo-isomerase i-15, et polynucleotide codant pour ce polypeptide
WO2001055419A1 (fr) Nouveau polypeptide, site de liaison 27 d'arn s1, et polynucleotide codant pour ce polypeptide
WO2002026795A1 (fr) Nouveau polypeptide, dihydrooratase humaine 15.29, et polynucleotide codant ce polypeptide
WO2001066701A1 (fr) Nouveau polypeptide, nadh-deshydrogenase humaine 13, et polynucleotide codant pour ce polypeptide
WO2001075079A1 (fr) Nouveau polypeptide, dihydroorotase humaine 13, et polynucleotide codant pour ce polypeptide
WO2001075052A2 (fr) Nouveau polypeptide, sous-unite humaine i-17 de nadh-deshydrogenase, et polynucleotide codant pour ce polypeptide
WO2001081592A1 (fr) Nouveau polypeptide, proteine humaine 11 contenant un fragment de sequence particulier d'une signal peptidase i, et polynucleotide codant pour ce polypeptide
WO2001070795A1 (fr) Nouveau polypeptide, glycinamide ribonucleotide synthetase humaine 13, et polynucleotide codant pour ce polypeptide

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP