WO2001075052A2 - Nouveau polypeptide, sous-unite humaine i-17 de nadh-deshydrogenase, et polynucleotide codant pour ce polypeptide - Google Patents

Nouveau polypeptide, sous-unite humaine i-17 de nadh-deshydrogenase, et polynucleotide codant pour ce polypeptide Download PDF

Info

Publication number
WO2001075052A2
WO2001075052A2 PCT/CN2001/000498 CN0100498W WO0175052A2 WO 2001075052 A2 WO2001075052 A2 WO 2001075052A2 CN 0100498 W CN0100498 W CN 0100498W WO 0175052 A2 WO0175052 A2 WO 0175052A2
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
polynucleotide
nadh dehydrogenase
sequence
human
Prior art date
Application number
PCT/CN2001/000498
Other languages
English (en)
Chinese (zh)
Other versions
WO2001075052A3 (fr
Inventor
Yumin Mao
Yi Xie
Original Assignee
Shanghai Biowindow Gene Development Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shanghai Biowindow Gene Development Inc. filed Critical Shanghai Biowindow Gene Development Inc.
Priority to AU63726/01A priority Critical patent/AU6372601A/en
Publication of WO2001075052A2 publication Critical patent/WO2001075052A2/fr
Publication of WO2001075052A3 publication Critical patent/WO2001075052A3/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/0012—Oxidoreductases (1.) acting on nitrogen containing compounds as donors (1.4, 1.5, 1.6, 1.7)
    • C12N9/0036—Oxidoreductases (1.) acting on nitrogen containing compounds as donors (1.4, 1.5, 1.6, 1.7) acting on NADH or NADPH (1.6)

Definitions

  • the present invention belongs to the field of biotechnology. Specifically, the present invention describes a new polypeptide, a human NADH dehydrogenation subunit 1-17, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a method and application for preparing such polynucleotides and polypeptides.
  • NADH dehydropeptone also known as compound graze I or NADH-co-Q redox
  • the respiratory chain NADH dehydropeptone is a polymerase complex that exists in the inner mitochondrial inner membrane, chloroplast, and orchid bacteria. In cyanobacteria, it is redoxed as a NADH-plasmid quinone ⁇ .
  • the complex consists of 25-30 polypeptide chain subunits, of which 15 subunits exist on the membrane, and 7 of these 15 subunits have mitochondrial and chloroplast genomes in many different species Edit.
  • subunit 1 encoded by the ND1 gene in mitochondria and the NDH1 gene in chloroplasts
  • subunit 2 contains a coenzyme Q binding site
  • the ND1 subunit of the NADH dehydrogenase complex in the respiratory chain is highly similar to the subunit 4 of dehydrogenase and the subunit C of dehydrogenase 4 in E. coli.
  • the coenzyme Q oxidoreductase subunit is also a member of the NADH dehydrogenase subunit I family.
  • Members of this protein family participate in various respiratory chain reactions in the body, as intermediates for electron transfer, responsible for transferring electrons to oxygen It generates oxygen ions and combines with 2H + to form H 2 0.
  • the respiratory chain is an important way of electron transfer and energy conversion in the body, and the role of various enzymes in the respiratory chain reaction process. These different enzymes coordinate in the respiratory chain process to promote the completion of the respiratory metabolic process. Mutation or abnormal expression of any of these substances will cause the abnormal function of the respiratory chain. Therefore, the NADH dehydrogenase complex acts as the respiratory chain. Important components also play an important regulatory role in this process, and its abnormal expression will lead to disturbances in energy metabolism of the respiratory chain in the organism, thus triggering various related metabolic disorders.
  • the members of the enzyme subunit family contain both of the above-mentioned conserved These two sequence fragments may be the active interaction centers of the enzyme complex subunit I. Its mutation will cause abnormal expression of the subunit, and cannot properly bind to coenzyme Q, thereby affecting its role in the respiratory chain. .
  • the abnormal expression of members of this protein family is usually related to diseases such as developmental metabolic disorders and material metabolic disorders in various branches of the body that are related to the respiratory chain.
  • the expression profile of the polypeptide of the present invention is very similar to the expression profile of human NADH dehydrogenase subunit 1-1 1 and therefore their functions may be similar.
  • the invention is named human NADH dehydrogenase subunits 1-17.
  • the human NADH dehydrogenase subunit I-17 protein plays an important role in regulating important functions of the body such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes, so identification in the art has been required. More human NADH dehydrogenase subunit proteins are involved in these processes, especially the amino acid sequence of this protein. Isolation of the new human NADH dehydrogenase subunit I-17 protein coding gene also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so isolation of its coding DNA is important. Object of the invention
  • Another object of the invention is to provide a polynucleotide encoding the polypeptide.
  • Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding human NADH dehydrogenase subunits 1 to 17.
  • Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding human NADH dehydrogenase subunits 1 to 17.
  • Another object of the present invention is to provide a method for producing human NADH dehydrogenase subunits 1-1 to 17.
  • Another object of the present invention is to provide antibodies against the polypeptide of the present invention, human NADH dehydrogenase subunits 1-17.
  • Another object of the present invention is to provide mimetic compounds, antagonists, agonists, and inhibitors against the polypeptide of the present invention, human NADH dehydrogenase subunit I-17.
  • Another object of the present invention is to provide a method for diagnosing and treating diseases related to abnormalities in human NADH dehydrogenase subunits 1 to 17. Summary of invention
  • the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
  • the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the present invention also relates to an isolated polynucleotide comprising a nucleotide sequence selected from the group consisting of: Its variant:
  • sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 814-1269 in SEQ ID NO: 1; and (b) a sequence having 1-2300 in SEQ ID NO: 1 Sequence of bits.
  • the present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
  • the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
  • the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of human DH dehydrogenase subunit I-II protein, which comprises utilizing the polypeptide of the invention.
  • the invention also relates to compounds obtained by this method.
  • the present invention also relates to a method for in vitro detection of a disease or disease susceptibility associated with abnormal expression of human NADH dehydrogenase subunit 1-17 protein, comprising detecting mutations in the polypeptide or a polynucleotide sequence encoding the same in a biological sample. Or detecting the amount or biological activity of a polypeptide of the invention in a biological sample.
  • the invention also relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
  • the present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention in the preparation of a medicament for the treatment of cancer, developmental disease or immune disease or other diseases caused by abnormal expression of human MDH dehydrogenase subunits 1-17. .
  • Fig. 1 is a comparison diagram of gene chip expression profiles of the inventors' NADH dehydrogenase subunits 1-17 and human NADH dehydrogenase subunits 1-11.
  • the upper graph is a graph of the expression profile of human NADH dehydrogenase subunits 1-17, and the lower graph is the graph of the expression profile of human MDH dehydrogenase subunits 1-11.
  • FIG. 2 is a polyacrylamide gel electrophoresis image (SDS-PAGE) of isolated human MDH dehydrogenase subunits 1-17.
  • OkDa is the molecular weight of the protein.
  • the arrow indicates the isolated protein band.
  • Nucleic acid sequence refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
  • amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
  • amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
  • a “variant" of a protein or polynucleotide refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it.
  • the changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence.
  • Variants can have "conservative" changes, in which the amino acid substituted has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine.
  • Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
  • “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
  • Insertion means that a change in the amino acid sequence or nucleotide sequence results in an increase in one or more amino acids or nucleotides compared to a molecule that exists in nature.
  • Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
  • Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
  • immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response and to bind specific antibodies in a suitable animal or cell.
  • An "agonist” refers to a molecule that, when combined with human MDH dehydrogenase subunits 1-17, causes a change in the protein to regulate the activity of the protein.
  • Agonists may include proteins, nucleic acids, carbohydrates, or any other molecule that binds human NADH dehydrogenase subunits 1-17.
  • Antagonist refers to a biological or immunological activity that blocks or regulates human NADH dehydrogenase subunits 1-17 when combined with human NADH dehydrogenase subunits 1-17.
  • Molecule Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates or any other molecule that binds human NADH dehydrogenase subunits 1-1 to 17.
  • Regular refers to changes in the function of human NADH dehydrogenase subunits 1-17, including an increase or decrease in protein activity, changes in binding characteristics, and any other biology of human NADH dehydrogenase subunits 1-17 Changes in nature, function, or immune properties.
  • Substantially pure ' means substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated.
  • Those skilled in the art can purify human NADH dehydrogenase subunit I- using standard protein purification techniques- ⁇ .
  • Substantially pure human NADH dehydrogenase subunits 1-17 can produce a single main band on a non-reducing polyacrylamide gel.
  • the purity of human NADH dehydrogenase subunit 1-17 polypeptide can be analyzed by amino acid sequence.
  • Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
  • sequence "C-T- G-A” can be combined with the complementary sequence "G-A-C-T”.
  • the complementarity between two single-stranded molecules may be partial or complete.
  • the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
  • “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
  • Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Southern imprinting or Nor thern blotting, etc.) under conditions of reduced stringency.
  • Substantially homologous sequences or hybridization probes can compete and inhibit the binding of fully homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.
  • Percent identity refers to the percentage of sequences that are the same or similar in a comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as through the MEGALIGN program (Lasergene sof tware package, DNASTAR, Inc., Madi son Wis.). The MEGALIGN program can compare two or more sequences according to different methods such as the Clus ter method (Higgins, DG and PM Sharp (1988) Gene 73: 237-244). The Clus ter method checks the distance between all pairs The groups of sequences are arranged into clusters. The clusters are then allocated in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula:
  • the method may also be used as well known in the art Jotun He in measuring the percentage of identity between nucleic acid sequences (He in J., (1990) Methods in enzymo logy 183: 625-645) or by method C lus ter 0
  • Similarity refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
  • Amino acids used for conservative substitution for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
  • Antisense refers to a nucleotide sequence that is complementary to a particular DM or RNA sequence.
  • Antisense strand refers to a nucleic acid strand that is complementary to a “sense strand.”
  • Derivative refers to HFP or a chemical modification of its nucleic acid. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
  • Antibody refers to a complete antibody molecule and its fragments, such as Fa,? ( ⁇ ) 2 and? Which can be specific sexually binds to the epitope of human NADH dehydrogenase subunit I-17.
  • a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
  • isolated refers to the removal of a substance from its original environment (for example, its natural environment if it is naturally occurring).
  • a naturally-occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
  • Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not part of its natural environment, they are still isolated.
  • isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
  • polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances in the natural state .
  • isolated human NADH dehydrogenase subunits 1-17 means that human NADH dehydrogenase subunits 1-17 are substantially free of other proteins, lipids, sugars, or other substances with which they are naturally associated. Those skilled in the art can purify human NADH dehydrogenase subunits 1-17 using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of human NADH dehydrogenase subunit 1-17 polypeptide can be analyzed by amino acid sequence.
  • the present invention provides a new polypeptide, human NADH dehydrogenase subunits 1-17, which basically consists of the amino acid sequence shown in SEQ ID NO: 2.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
  • the polypeptides of the present invention may be naturally purified products, or chemically synthesized products, or produced using recombinant techniques from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, phytoplasma, and mammalian cells). Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude initial methionine residues.
  • the invention also includes fragments, derivatives and analogs of human DH dehydrogenase subunits 1-17.
  • fragment refers to a polypeptide that substantially maintains the same biological function or activity of the human NADH dehydrogenase subunits 1-17 of the present invention.
  • a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution
  • the amino acid may or may not be encoded by a genetic codon; or (II) a type in which a group on one or more amino acid residues is replaced by another group to include a substituent; or (III) this One type in which the mature polypeptide is fused to another compound (such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol); or (IV) such a polypeptide sequence in which an additional amino acid sequence is fused to the mature polypeptide (Such as the leader or secretory sequence or the sequence used to purify the polypeptide or protease sequence).
  • such fragments, derivatives and analogs are considered to be within the knowledge of those skilled in the art.
  • the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
  • the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a polynucleotide sequence of 2300 bases in length and its open reading frame 814-1269 encodes 151 amino acids.
  • this peptide has a similar expression profile to human MDH dehydrogenase subunit 1-1 1 and it can be inferred that the human NADH dehydrogenase subunit 1-1 7 has human NADH dehydrogenase subunit Units 1-11 have similar functions.
  • the polynucleotide of the present invention may be in the form of DM or RNA.
  • DNA forms include cDNA, genomic DNA, or synthetic DNA.
  • DNA can be single-stranded or double-stranded.
  • DNA can be coding or non-coding.
  • the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
  • a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
  • the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
  • polynucleotide encoding a polypeptide refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.
  • the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
  • Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
  • an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
  • the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity between the two sequences).
  • the invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the invention under stringent conditions.
  • “strict conditions” means: (1) in the lower Hybridization and elution at ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 6 (TC; or (2) hybridization with a denaturant, such as 50 ° / (v / v) formamide, 0.1 % Calf serum / 0.1% Ficoll, 42 ° C, etc .; or (3) hybridization occurs only when the identity between the two sequences is at least 95% or more, and more preferably 97% or more.
  • the polypeptide encoded by the hybridized polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
  • nucleic acid fragments that hybridize to the sequences described above.
  • a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 nuclei. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques such as PCR to identify and / or isolate polynucleotides encoding human NADH dehydrogenase subunits 1-17.
  • polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
  • the specific polynucleotide sequences encoding human NADH dehydrogenase subunits 1-17 of the present invention can be obtained by various methods.
  • polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
  • the DM fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DM sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.
  • genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences.
  • the standard method for isolating the cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library.
  • Various methods have been used to extract mRNA, and kits are also commercially available (Qiagene).
  • the construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989).
  • Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
  • genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-D or DNA-RNA hybridization; (2) the presence or absence of marker gene functions; (3) determination of the transcripts of human NADH dehydrogenase subunits 1-17 Level; (4) detecting protein products of gene expression by immunological techniques or measuring biological activity. The above methods can be used alone or in combination.
  • the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and has a length of at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
  • probes are typically 2000 nucleotides in length Within 1,000 nucleotides is preferred.
  • the probe used here is usually a DNA sequence chemically synthesized based on the gene sequence information of the present invention.
  • the genes or fragments of the present invention can of course be used as probes.
  • DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
  • the protein products of human NADH dehydrogenase subunit 1-17 gene expression can be detected by immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA).
  • immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA).
  • a method using DNA technology to amplify DNA / RNA is preferably used to obtain the gene of the present invention.
  • the RACE method RACE-rapid cDNA end rapid amplification method
  • the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Select and synthesize using conventional methods.
  • the amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
  • polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, sequencing needs to be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
  • the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell that is genetically engineered using the vector of the present invention or directly using human NADH dehydrogenase subunit 1-17 coding sequences, and to produce the present invention by recombinant technology Said method of polypeptide.
  • polynucleotide sequences encoding human NADH dehydrogenase subunits 1-17 can be inserted into a vector to form a recombinant vector containing the polynucleotide of the present invention.
  • vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
  • Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al.
  • any plasmid and vector can be used to construct a recombinant expression vector.
  • An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
  • the DM sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis.
  • promoters are: the l ac or trp promoter of E. coli; the PL promoter of lambda phage; eukaryotic promoters include the CMV immediate early promoter, the HSV thymidine kinase promoter, and the early and late SV40 promoters Promoters, retroviral LTRs, and other known promoters that control the expression of genes in prokaryotic or eukaryotic cells or their viruses.
  • the expression vector also includes a ribosome binding site for translation initiation and a transcription terminator.
  • Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription.
  • Illustrative examples include SV40 enhancers of 100 to 270 base pairs at a later stage from the origin of replication, polyoma enhancers and adenovirus enhancers at the late side of replication origin.
  • the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • GFP fluorescent protein
  • tetracycline or ampicillin resistance for E. coli.
  • polynucleotides encoding human NADH dehydrogenase subunits 1-17 or recombinant vectors containing the polynucleotides can be transformed or transduced into host cells to form genetic engineering containing the polynucleotides or recombinant vectors.
  • Host cell refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell.
  • Escherichia coli, Streptomyces bacterial cells such as Salmonella typhimurium
  • fungal cells such as yeast
  • plant cells insect cells
  • fly S2 or Sf 9 animal cells
  • animal cells such as CH0, COS or Bowes melanoma cells.
  • Transformation of a host cell with a DM sequence according to the present invention or a recombinant vector containing the DNA sequence can be performed by conventional techniques well known to those skilled in the art.
  • the host is a prokaryote such as E. coli
  • competent cells capable of DNA uptake can be in the exponential growth phase were harvested, treated with CaC l 2 method used in steps well known in the art. The alternative is to use MgC l 2 .
  • transformation can also be performed by electroporation.
  • the host is a eukaryotic organism, the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
  • polynucleotide sequence of the present invention can be used to express or produce recombinant human NADH dehydrogenase subunits 1-17 (Scence, 1984; 224: 1431). Generally there are the following steps:
  • polynucleotide or variant encoding human human NADH dehydrogenase subunits 1-17 of the present invention is used Body), or transform or transduce a suitable host cell with a recombinant expression vector containing the polynucleotide;
  • the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
  • a suitable method such as temperature conversion or chemical induction
  • the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If necessary, the recombinant protein can be isolated and purified by various separation methods using its physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
  • conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid
  • polypeptides of the present invention as well as antagonists, agonists and inhibitors of the polypeptides, can be directly used in the treatment of diseases, for example, they can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection, and immune diseases.
  • the respiratory chain is an important method for electron transfer and energy conversion in the body, and the role of various enzymes in the respiratory chain reaction process. These different enzymes coordinate in the respiratory chain process to facilitate the completion of the respiratory metabolic process. Mutation or abnormal expression of any of these substances will cause abnormal effects of the respiratory chain.
  • the respiratory chain NADH dehydrogenase is a polymerase complex that exists in the inner mitochondrial inner membrane.
  • the NADH dehydrogenase subunit I protein is a component of the NADH dehydrogenase subunit I protein, and it has a conserved sequence fragment specific to members of the NADH dehydrogenase subunit I protein family to form its active mot if.
  • the expression of the specific DH dehydrogenase subunit I mo t if is abnormal, which causes the function of the polypeptide containing the mot if of the present invention to be abnormal, which results in abnormalities in electron transfer in the respiratory chain, energy generation, and material conversion. It further affects the metabolic process of matter and energy, and produces related diseases such as disorders of substance and energy metabolism, disorders of embryonic development, disorders of growth and development, and tumors.
  • human NADH dehydrogenase subunits 1-17 of the present invention will produce various diseases, especially disorders of material and energy metabolism, embryonic developmental disorders, disorders of growth and development, tumors, these diseases including but not limited to:
  • Disorders related to energy and substance metabolism disorders isovalerate, combined carboxylase deficiency, glutarate type I, propionate, methylmalonic aciduria, phenylketonuria, albinism, color Glycineemia, Branched Amino Acid Metabolism Deficiency, Glycineemia, Hypersarcosinemia, Proline and Hydroxyproline Metabolism Deficiency, Glutamate Metabolism Deficiency, Urea Cycle Metabolism Deficiency, Histamine Acid Metabolism Deficiency Disease, Lysine Metabolism Deficiency Disease, Mucopolysaccharidosis Types 1 to VII, Rheumatoid Mucopolysaccharidosis, Mucolipid Storage Syndrome, Ray-niney Syndrome, Xanthineuria, Orotic Aciduria, Adenine deaminase deficiency, hyperlipoproteinemia, Familial hyper- ⁇ -lipoproteinemia, congenital lactose intolerance, heredit
  • Embryonic disorders congenital abortion, cleft palate, limb loss, limb differentiation disorder, hyaline membrane disease, atelectasis, polycystic kidney disease, double ureter, cryptorchidism, congenital inguinal hernia, double uterus, vaginal atresia, suburethral urethra Fissure, amphoteric deformity, atrial septal defect, ventricular septal defect, pulmonary stenosis, arterial duct occlusion, neural tube defect, congenital hydrocephalus, iris defect, congenital cataract, congenital glaucoma or cataract, congenital deafness, etc.
  • Growth and development disorders mental retardation, cerebral palsy, brain development disorders, mental retardation, familial cerebral nucleus dysplasia syndrome, strabismus, skin, fat and muscular dysplasia such as congenital skin laxity, premature aging Disease, congenital keratosis, various metabolic defects such as various amino acid metabolic defects, stunting, dwarfism, sexual retardation, etc .;
  • Tumors of various tissues gastric cancer, liver cancer, lung cancer, esophageal cancer, breast cancer, leukemia, lymphoma, thyroid tumor, uterine fibroids, neuroblastoma, astrocytoma, ependymoma, glioblastoma , Colon cancer, malignant histiocytosis, melanoma, teratoma, sarcoma, adrenal cancer, bladder cancer, bone cancer, osteosarcoma, myeloma, bone marrow cancer, brain cancer, uterine cancer, endometrial cancer, gallbladder cancer, Thymic tumors, nasal and sinus tumors, nasopharyngeal carcinoma, larynx cancer, tracheal tumors, pleural mesothelioma, fibroids, fibrosarcoma, lipomas, liposarcomas, leiomyomas.
  • the invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) human NADH dehydrogenase subunits 1 to 17.
  • Agonists enhance human NADH dehydrogenase subunits 1-1 17 to stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
  • mammalian cells or membrane preparations expressing human MDH dehydrogenase subunits 1-1 17 can be cultured with labeled human NADH dehydrogenase subunits 1-1 17 in the presence of drugs. The ability of the drug to increase or block this interaction is then determined.
  • Antagonists of human NADH dehydrogenase subunits 1-1 17 include antibodies, compounds, receptor deletions, and the like that have been screened. Antagonists of human NADH dehydrogenase subunits 1-17 can bind to human NADH dehydrogenase subunits 1-17 and eliminate their functions, or inhibit the production of the polypeptide, or with the active site of the polypeptide Binding prevents the polypeptide from functioning biologically.
  • human NADH dehydrogenase subunits 1-17 When screening compounds as antagonists, human NADH dehydrogenase subunits 1-17 can be added to the bioanalytical assay, and the interaction between human NADH dehydrogenase subunits 1-17 and their receptors can be determined by determining the compounds Influence to determine if a compound is an antagonist. Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds. Polypeptide molecules capable of binding to human NADH dehydrogenase subunit I-II can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. In the screening, human NADH dehydrogenase subunits 1 to 17 molecules should generally be labeled.
  • the present invention provides a method for producing an antibody using a polypeptide, a fragment, a derivative, an analog thereof, or a cell thereof as an antigen.
  • These antibodies can be polyclonal or monoclonal antibodies.
  • the invention also provides antibodies directed against human NADH dehydrogenase subunits 1-1 7 epitopes. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by Fab expression libraries.
  • Polyclonal antibodies can be produced by injecting human NADH dehydrogenase subunits 1 to 17 directly into immunized animals (such as rabbits, mice, rats, etc.).
  • immunized animals such as rabbits, mice, rats, etc.
  • a variety of adjuvants can be used to enhance the immune response, including but not limited to Limited to Freund's adjuvant and the like.
  • Techniques for preparing monoclonal antibodies to human NADH dehydrogenase subunits 1-17 include, but are not limited to, hybridoma technology (Kohl er and Milstei n. Nature, 1975, 256: 495-497), triple tumor technology, human Beta-cell hybridoma technology, EBV-hybridoma technology, etc.
  • An inlay antibody combining a human constant region and a non-human variable region can be produced using existing technologies (Morris on e t al, PNAS, 1985, 81: 6851).
  • the existing technology for producing single chain antibodies (U.S. Pat No. 4946778) can also be used to produce single chain antibodies against human MDH dehydrogenase subunits 1-17.
  • Antibodies against human NADH dehydrogenase subunits 1-17 can be used in immunohistochemistry to detect human NADH dehydrogenase subunits 1-17 in biopsy specimens.
  • Monoclonal antibodies that bind to human MDH dehydrogenase subunits 1-17 can also be labeled with radioisotopes and injected into the body to track their location and distribution.
  • This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
  • Antibodies can also be used to design immunotoxins that target a particular part of the body.
  • human NADH dehydrogenase subunit I-II high affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
  • a common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
  • This hybrid antibody can be used to kill human NADH dehydrogenase subunit1- 17 positive cells.
  • the antibodies of the present invention can be used to treat or prevent diseases related to human NADH dehydrogenase subunits 1-17. Administration of appropriate doses of antibodies can stimulate or block the production or activity of human NADH dehydrogenase subunits 1-17.
  • the invention also relates to a diagnostic test method for quantitative and localized detection of human NADH dehydrogenase subunit 1-17 levels.
  • tests are well known in the art and include FI SH assays and radioimmunoassays.
  • the levels of human NADH dehydrogenase subunits 1-17 detected in the test can be used to explain the importance of human NADH dehydrogenase subunits 1-17 in various diseases and to diagnose human NADH dehydrogenase subunits 1-17 Working diseases.
  • polypeptides of the present invention can also be used for peptide mapping, for example, the polypeptides can be physically, chemically or enzymatically Specific cleavage and one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, preferably mass spectrometry.
  • Polynucleotides encoding human NADH dehydrogenase subunits 1-17 can also be used for a variety of therapeutic purposes. Gene therapy technology can be used to treat abnormal cell proliferation, development, or metabolism caused by the non-expression or abnormal / inactive expression of human NADH dehydrogenase subunits 1-17.
  • Recombinant gene therapy vectors (such as viral vectors) can be designed to express variant human NADH dehydrogenase subunits 1-17 to inhibit endogenous human NADH dehydrogenase subunits 1-17 activity.
  • a mutated human NADH dehydrogenase subunit 1-17 may be a shortened human NADH dehydrogenase subunit 1-17 that lacks a signaling domain.
  • recombinant gene therapy vectors can be used to treat diseases caused by abnormal expression or activity of human NADH dehydrogenase subunits 1-17.
  • Virus-derived expression vectors such as retroviruses, adenoviruses, adenovirus-associated viruses, herpes simplex virus, and parvoviruses can be used to transfer polynucleotides encoding human NADH dehydrogenase subunits 1-17 into cells. Methods for constructing recombinant viral vectors carrying polynucleotides encoding human NADH dehydrogenase subunits 1-17 can be found in existing literature (Sambrook, et al.). In addition, recombinant polynucleotides encoding human NADH dehydrogenase subunits 1-17 can be packaged into liposomes and transferred into cells.
  • Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
  • a vector such as a virus, phage, or plasmid
  • Oligonucleotides including antisense RNA and DNA
  • ribozymes that inhibit human NADH dehydrogenase subunit 1-17 mRNA are also within the scope of the present invention.
  • a ribozyme is an enzyme-like RNA molecule that can specifically decompose specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RM to perform endonucleation.
  • Antisense RNA, DNA, and ribozymes can be obtained using any existing RNA or DNA synthesis technology, such as solid-phase phosphoramidite chemical synthesis to synthesize oligonucleotides.
  • Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA. This DNA sequence has been integrated downstream of the vector's RNA polymerase promoter. In order to increase the stability of the nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the linkage between ribonucleosides using phosphate thioester or peptide bonds instead of phosphodiester bonds.
  • Polynucleotides encoding human NADH dehydrogenase subunits 1-17 can be used for the diagnosis of diseases related to human NADH dehydrogenase subunits 1-17.
  • Polynucleotides encoding human NADH dehydrogenase subunit 1-17 can be used to detect the expression of human NADH dehydrogenase subunit 1-17 or abnormal expression of human NADH dehydrogenase subunit 1-17 in a disease state .
  • the DM sequence encoding human NADH dehydrogenase subunit 1-17 can be used to hybridize biopsy specimens to determine the expression of human NADH dehydrogenase subunit 1-17.
  • Hybridization Techniques include Sou thern blotting, Nor thern blotting, and in situ hybridization. These techniques and methods are publicly available and mature, and related kits are commercially available. A part or all of the polynucleotides of the present invention can be used as probes to be fixed on a micro array or a DNA chip (also called a "gene chip") for analyzing differential expression analysis and gene diagnosis of genes in tissues.
  • Human NADH dehydrogenase subunit 1-17 specific primers can be used to perform RM-polymerase chain reaction (RT-PCR) in vitro amplification to detect the transcription products of human NADH dehydrogenase subunit 1-17.
  • Human NADH dehydrogenase subunit 1-17 gene mutations can also be used to diagnose human NADH dehydrogenase subunit 1-17 related diseases.
  • Human NADH dehydrogenase subunit 1-17 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to normal wild-type human MDH dehydrogenase subunit 1-17 DNA sequences. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect the expression of proteins. Therefore, Nor thern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
  • sequences of the invention are also valuable for chromosome identification. This sequence will specifically target a specific position on a human chromosome and can hybridize to it. Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for marking chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DNA sequences on a chromosome.
  • PCR primers (preferably 15-35bp) are prepared from the cDNA, and the sequences can be located on the chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
  • PCR localization of somatic hybrid cells is a quick way to localize DM to specific chromosomes.
  • oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
  • Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.
  • Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step.
  • FISH Fluorescent in situ hybridization
  • the difference in cDNA or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).
  • the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
  • suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
  • the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
  • the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell.
  • the polypeptides of the invention can be used in combination with other therapeutic compounds.
  • the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
  • Human NADH dehydrogenase subunits 1-1 7 are administered in amounts effective to treat and / or prevent specific indications.
  • the amount and range of human NADH dehydrogenase subunits 1-17 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnosing physician. Examples
  • Total human fetal brain RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform.
  • Po ly (A) mRNA was isolated from total RNA using Quik mRNA I sola ti on Kit (product of Qiegene). 2ug po ly (A) mRNA is reverse transcribed CDNA is formed. Smart cDNA cloning kit (purchased from Clontech; ⁇ cDNA fragment was inserted into the multicloning site of pBSK (+) vector (Clontech)) to transform DH5 ⁇ , and bacteria were used to form a cDNA library.
  • Dye terminate cycle reaction sequencing Kit Perkin-Elmer
  • ABI 377 automatic sequencer Perkin-Elmer
  • the determined cDNA sequences were compared with the existing public DNA sequence database (Genebank). The comparison revealed that the cDNA sequence of one of the clones 0479c07 was new DNA.
  • a series of primers were synthesized to determine the inserted cDNA fragment in both directions.
  • Primerl 5,-GATGGGTCTCTTTTCTCTAATGGG -3, (SEQ ID NO: 3)
  • Primer2 5'- CGACAGTCTCACTCTGTTGCCCAG -3 '(SEQ ID NO: 4)
  • Primerl is a forward sequence starting at lbp of the 5th end of SEQ ID NO: 1;
  • Primer2 is the 3, terminal reverse sequence of SEQ ID NO: 1.
  • Amplification reaction conditions 50mm1 reaction volume containing 50mmoI / L KC1, 10mmol / L Tris-HCl, pH8.5, 1.5mmol / L MgCl 2 , 200 ⁇ ol / L dNTP, lOpmol primer, 1U Taq DNA Polymerase (Clontech).
  • the reaction was performed on a PE9600 DNA thermal cycler (Perkin-Eimer) for 25 cycles under the following conditions: 94 ° C 30sec; 55 ° C 30sec; 72 ° C 2min.
  • ⁇ -actin was set as a positive control and template blank was set as a negative control.
  • RNA precipitate was washed with 703 ⁇ 4 ethanol, dried and dissolved in water.
  • PH7.0 Propanesulfonic acid
  • Preparation 32 P- DNA probe labeled with ex- 32 P dATP by random priming method was the PCR amplified human NADH dehydrogenase subunit I-17 coding region sequence (682bp to 945bp) shown in FIG. 1.
  • a 32P-labeled probe (approximately 2 x 10 6 cpm / ml) and an RNA-transferred nitrocellulose membrane were placed in a solution at 42 ° C. C hybridization overnight, the solution contains 50% formamide-25mM KH 2 P0 4 (pH7.4)-5 x SSC-5 x Denhardt's solution and 200 ⁇ 8 / ⁇ 1 salmon sperm DNA.
  • Example 4 In vitro expression, isolation, and purification of recombinant human NADH dehydrogenase subunit I-17 Based on the sequence of the coding region shown in SEQ ID NO: 1 and Figure 1, a For specific amplification primers, the sequence is as follows:
  • Primer3 5'- CATGCTAGCATGTCTCCTGAGAGCAAATCCAGG -3, (Seq ID No: 5)
  • Primer4 5 '-CATGGATCCTTATAAAATACCATCAGTCATAAG -3, (Seq ID No: 6)
  • the 5' ends of these two primers contain Ndel and BamHI restriction sites, respectively.
  • the coding sequences for the 5 'and 3' ends of the gene of interest are followed, respectively.
  • the Ndel and BamHI restriction sites correspond to the selectivity within the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865.3). Digestion site.
  • PCR was performed using the PBS-0479C07 plasmid containing the full-length target gene as a template.
  • the PCR reaction conditions were as follows: a total volume of 50 ⁇ 1 containing 10 pg of pBS-0479c07 plasmid, primers Primer-3 and Primer-4 were lOpmol and Advantage polymerase Mix (Clontech) 1 ⁇ 1, respectively. Cycle parameters: 94 ° C 20s, 60 ° C 30s, 68. C 2 min, a total of 25 cycles. Ndel and BamHI were used to double-digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase.
  • the ligation product was transformed into the colibacillus DH5cx by the calcium chloride method. After being cultured overnight on LB plates containing kanamycin (final concentration 30 ⁇ ⁇ / ⁇ 1), positive clones were selected by colony PCR method and sequenced. A positive clone (PET-0479c07) with the correct sequence was selected, and the recombinant plasmid was transformed into E. coli BL21 (DE3) plySs (product of Novagen) using the calcium chloride method.
  • kanamycin final concentration of 30 ⁇ ⁇ / ⁇ 1 in LB liquid medium
  • host strain BL21 P ET-0479c07
  • IPTG was added to a final concentration of 1 Implicit ol / L, continue to cultivate for 5 hours.
  • the cells were collected by centrifugation, and the supernatant was collected by centrifugation. The supernatant was collected by centrifugation. Chromatography was performed using an His. Bind Quick Cartridge (product of Novagen) which can bind 6 histidines (6His-Tag).
  • the purified human protein NADH dehydrogenase subunits 1-17 were obtained.
  • Polypeptides specific to the following human NADH dehydrogenase subunits 1-17 were synthesized using a peptide synthesizer (product of PE):
  • the polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex, respectively.
  • hemocyanin and bovine serum albumin For methods, see: Avrameas, et al. Iramunochemi s try, 1969; 6: 43. Rabbits were immunized with 4 mg of the above-mentioned blue cyanin polypeptide complex and complete Freund's adjuvant, and 15 days later, the hemocyanin polypeptide complex and incomplete Freund's adjuvant were used to boost immunity once.
  • a titer plate coated with a 15 g / ml bovine serum albumin peptide complex was used as an ELISA to determine antibody titers in rabbit serum.
  • Total IgG was isolated from antibody-positive rabbit serum using protein A-Sepharose.
  • the peptide was bound to a cyanogen bromide-activated Sephar 0S e4B column, and the anti-peptide antibody was separated from the total IgG by affinity chromatography.
  • the immunoprecipitation method proved that the purified antibody could specifically bind to human NADH dehydrogenase subunits 1-17.
  • Example 6 Application of the polynucleotide fragment of the present invention as a hybridization probe
  • Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
  • the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
  • the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
  • the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method.
  • Filter hybridization methods include dot blotting, Southern imprinting, Northern blotting, and copying methods. They all use the same steps to immobilize the polynucleotide sample to be tested on the filter.
  • the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer to saturate the non-specific binding site of the sample on the filter with the carrier and the synthesized polymer.
  • the pre-hybridization solution is then replaced with a hybridization buffer containing labeled probes and incubated to hybridize the probes to the target nucleic acid.
  • the unhybridized probes are removed by a series of membrane washing steps.
  • This embodiment uses higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals.
  • the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
  • the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
  • the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
  • oligonucleotide fragments for use as hybridization probes from the polynucleotide SEQ ID NO: 1 of the present invention should follow the following principles and several aspects to be considered:
  • the preferred range of probe size is 18-50 nucleotides
  • GC content is 30% -70%, if it exceeds, non-specific hybridization increases; 3. There should be no complementary regions inside the probe;
  • Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements For homology comparison of the regions, if the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, the primary probe should not be used generally;
  • Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
  • Probe 2 which belongs to the second type of probe, is equivalent to the replacement mutant sequence (41Nt) of the gene fragment or its complementary fragment of SEQ ID NO: 1:
  • PBS phosphate buffered saline
  • step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
  • NC membranes nitrocellulose membranes
  • Two NC membranes are required for each probe for subsequent experiments.
  • the film is washed with high-strength conditions and strength conditions, respectively.
  • the sample membrane was placed in a plastic bag, and 3-10 mg of prehybridization solution (10xDenhardt's; 6xSSC, 0.1rag / ml CT DNA (calf thymus DNA)) was added. After sealing the mouth of the bag, shake at 68 ° C for 2 hours.
  • prehybridization solution 10xDenhardt's; 6xSSC, 0.1rag / ml CT DNA (calf thymus DNA)
  • Gene chip or gene micromatrix (DM Microaray) is a new technology that many national laboratories and large pharmaceutical companies are developing and developing. It refers to the orderly and high-density arrangement of a large number of target gene fragments.
  • the data is compared and analyzed on a carrier such as glass, silicon, and the like by fluorescence detection and computer software, so as to achieve the purpose of analyzing biological information quickly, efficiently, and with high throughput.
  • the polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research of new gene functions; search for and screen new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases .
  • the specific method steps have been reported in the literature.
  • a total of 4,000 polynucleotide sequences of various full-length cDNAs are used as target DNA, including the polynucleotide of the present invention. They were amplified by PCR respectively. After purification, the concentration of the amplified product was adjusted to about 500 ng / ul, and spotted on a glass medium using a Cartesian 7500 spotter (purchased from Cartesian Company, USA). The distance between the points is 280 ⁇ . The spotted slides were hydrated and dried, cross-linked in a UV cross-linker, and dried after elution to fix the DNA on the glass slide to prepare a chip. The specific method steps have been reported in the literature. The sample post-processing steps in this embodiment are: 1. Hydration in a humid environment for 4 hours;
  • Total mRNA was extracted from human mixed tissues and specific tissues (or stimulated cell lines) in one step, and mRNA was purified using Oligotex mRNA Midi Kit (purchased from QiaGen).
  • J Cy3dUTP (5-Amino-propargy 1-2 ⁇ -deoxyuridine 5 '-tr iphate coupled to Cy3 fluorescent dye, purchased from Amersham Phamacia Biotech) labeled with mRNA of human mixed tissues, using Cy5dUTP Amino- propargyl- 2'- deoxyuridine 5'-tr iphate coupled to Cy5 fluorescent dye, purchased from Amersham Phamacia Biotech company, labeled the body's specific tissue (or stimulated cell line) mRNA, and purified the probe to prepare a probe.
  • Cy3dUTP (5-Amino-propargy 1-2 ⁇ -deoxyuridine 5 '-tr iphate coupled to Cy3 fluorescent dye, purchased from Amersham Phamaci
  • Probes from the above two tissues and chips were hybridized in a UniHyb TM Hybridization Solution (purchased from TeleChem) hybridization solution for 16 hours, washed with a wash solution (1 x SSC, 0.2% SDS) at room temperature, and then scanned with ScanArray 3000.
  • the scanner purchased from General Scanning Company, USA
  • the scanned images were analyzed and processed with Imagene software (Biodiscovery, USA) to calculate the Cy3 / Cy5 ratio of each point.
  • the above specific tissues are normal brain, liver cancer, muscle, fetal brain, fetal kidney, fetal lung, fetal liver, thyroid, thymus, adult liver, lung, and glioma. Based on these 18 Cy3 / Cy5 ratios, a bar graph is drawn ( Figure 1). It can be seen from the figure that the expression profiles of human NADH dehydrogenase subunit I-U and human NADH dehydrogenase subunit 1-11 according to the present invention are very similar.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Peptides Or Proteins (AREA)

Abstract

L'invention concerne un nouveau polypeptide, une sous-unité humaine I-17 de NADH-déshydrogénase, et un polynucléotide codant pour ce polypeptide ainsi qu'un procédé d'obtention de ce polypeptide par des techniques recombinantes d'ADN. L'invention concerne en outre les applications de ce polypeptide dans le traitement de maladies, notamment des tumeurs malignes, de l'hémopathie, de l'infection par VIH, de maladies immunitaires et de diverses inflammations. L'invention concerne aussi l'antagoniste agissant contre le polypeptide et son action thérapeutique ainsi que les applications de ce polynucléotide codant pour la sous-unité humaine I-17 de NADH-déshydrogénase.
PCT/CN2001/000498 2000-03-27 2001-03-26 Nouveau polypeptide, sous-unite humaine i-17 de nadh-deshydrogenase, et polynucleotide codant pour ce polypeptide WO2001075052A2 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU63726/01A AU6372601A (en) 2000-03-27 2001-03-26 A novel polypeptide, nadh dehydrogenase human sub-unit i-17 and the polynucleotide encoding the polypeptide

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN 00115140 CN1315369A (zh) 2000-03-27 2000-03-27 一种新的多肽——人nadh脱氢酶亚单位i－17和编码这种多肽的多核苷酸

Publications (2)

Publication Number Publication Date
WO2001075052A2 true WO2001075052A2 (fr) 2001-10-11
WO2001075052A3 WO2001075052A3 (fr) 2002-04-18

Family

ID=4584609

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2001/000498 WO2001075052A2 (fr) 2000-03-27 2001-03-26 Nouveau polypeptide, sous-unite humaine i-17 de nadh-deshydrogenase, et polynucleotide codant pour ce polypeptide

Country Status (3)

Country Link
CN (1) CN1315369A (fr)
AU (1) AU6372601A (fr)
WO (1) WO2001075052A2 (fr)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5925543A (en) * 1997-09-12 1999-07-20 Incyte Pharmaceuticals, Inc. Isolated polynucleotide sequence encoding NADH dehydrogenase B17 subunit
US5976804A (en) * 1997-12-12 1999-11-02 Incyte Pharmaceuticals, Inc. NADH dehydrogenase PDSW subunit

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5925543A (en) * 1997-09-12 1999-07-20 Incyte Pharmaceuticals, Inc. Isolated polynucleotide sequence encoding NADH dehydrogenase B17 subunit
US6100036A (en) * 1997-09-12 2000-08-08 Incyte Pharmaceuticals, Inc. NADH dehydrogenase B17 subunit
US5976804A (en) * 1997-12-12 1999-11-02 Incyte Pharmaceuticals, Inc. NADH dehydrogenase PDSW subunit

Also Published As

Publication number Publication date
AU6372601A (en) 2001-10-15
CN1315369A (zh) 2001-10-03
WO2001075052A3 (fr) 2002-04-18

Similar Documents

Publication Publication Date Title
WO2001055404A1 (fr) Nouveau polypeptide, alcool deshydrogenase humaine 39, et polynucleotide codant pour ce polypeptide
WO2001083538A1 (fr) Nouveau polypeptide, proteine humaine 36 du gene k-ras, et polynucleotide codant pour ce polypeptide
WO2001068684A1 (fr) Nouveau polypeptide, protocadherine humaine 14, et polynucleotide codant pour ce polypeptide
WO2001075052A2 (fr) Nouveau polypeptide, sous-unite humaine i-17 de nadh-deshydrogenase, et polynucleotide codant pour ce polypeptide
WO2001088084A2 (fr) Nouveau polypeptide, superoxyde dismutase 11, et polynucleotide codant pour ce polypeptide
WO2001075048A2 (fr) Nouveau polypeptide, proteine ribosomale humaine s11 23, et polynucleotide codant pour ce polypeptide
WO2001098488A1 (fr) Nouveau polypeptide, sous-unite 24 de flavoproteine humaine, et polynucleotide codant ce polypeptide
WO2001068873A1 (fr) Nouveau polypeptide, molecule humaine d'adhesion intercellulaire 12, et polynucleotide codant pour ce polypeptide
WO2001079423A2 (fr) Nouveau polypeptide, proteine humaine bcr 10, et polynucleotide codant pour ce polypeptide
WO2001090171A1 (fr) Nouveau polypeptide, proteine humaine ribosomale sii 12, et polynucleotide codant ce polypeptide
WO2001079435A2 (fr) Nouveau polypeptide, sous-unite humaine 14 de flavoproteine, et polynucleotide codant pour ce polypeptide
WO2001068874A1 (fr) Nouveau polypeptide, polypeptide humain d'activation endotheliale ii-62, et polynucleotide codant pour ce polypeptide
WO2001081396A1 (fr) Nouveau polypeptide, proteine ribosomale s7 humaine 14, et polynucleotide codant pour ce polypeptide
WO2001048001A1 (fr) Nouveau polypeptide, quinone-proteine reductase 7, et polynucleotide codant pour ce polypeptide
WO2001048198A1 (fr) Nouveau polypeptide, proteine ribosomale s4 8, et polynucleotide codant pour ce polypeptide
WO2001075055A2 (fr) Nouveau polypeptide, quinine reductase humaine 9, et polynucleotide codant pour ce polypeptide
WO2001072789A1 (fr) Nouveau polypeptide, proteine humaine a doigt de zinc 10, et polynucleotide codant pour ce polypeptide
WO2001072805A1 (fr) Nouveau polypeptide, sous-unite humaine 14.19 de flavoproteine, et polynucleotide codant pour ce polypeptide
WO2001075024A2 (fr) Nouveau polypeptide, facteur humain 13 associe a nf-e2, et polynucleotide codant pour ce polypeptide
WO2001048012A1 (fr) Nouveau polypeptide, sous-unite i-11 de nadh-deshydrogenase, et polynucleotide codant pour ce polypeptide
WO2001087968A1 (fr) Proteine s4-36 ribosomale, polypeptide humain, et polynucleotide la codant
WO2001072787A1 (fr) Nouveau polypeptide, facteur humain 10 induisant l'assemblage des peroxysomes, et polynucleotide codant pour ce polypeptide
WO2001092516A1 (fr) Nouveau polypeptide, proteine ribosomale s19e 13, et polynucleotide codant ce polypeptide
WO2001074998A2 (fr) Nouveau polypeptide, proteine humaine de regulation 10 de la serine proteinase, et polynucleotide codant pour ce polypeptide
WO2001075062A2 (fr) Nouveau polypeptide, hydrogenase humaine 10, et polynucleotide codant pour ce polypeptide

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
AK Designated states

Kind code of ref document: A3

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A3

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase in:

Ref country code: JP