WO2001094404A1 - Nouveau polypeptide, facteur humain de retrotransposition l1 22, et polynucleotide codant ce polypeptide - Google Patents
Nouveau polypeptide, facteur humain de retrotransposition l1 22, et polynucleotide codant ce polypeptide Download PDFInfo
- Publication number
- WO2001094404A1 WO2001094404A1 PCT/CN2001/000761 CN0100761W WO0194404A1 WO 2001094404 A1 WO2001094404 A1 WO 2001094404A1 CN 0100761 W CN0100761 W CN 0100761W WO 0194404 A1 WO0194404 A1 WO 0194404A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- polypeptide
- polynucleotide
- human
- transcription factor
- reverse transcription
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
Definitions
- the present invention belongs to the field of biotechnology. Specifically, the present invention describes a new polypeptide, a human L1 reverse transcription factor 22, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and polypeptide.
- transposable elements ie transposons
- the transposition process is usually accompanied by the replication process, so the transposition process increases the number of copies of the transposons, which, like other types of genetic recombination, makes the genome of eukaryotes very mobile, which accelerates the genome. Evolutionary process.
- the components of transposition in eukaryotes are divided into two types, one is the transfer from DNA to DNA, called transposition, and the DM unit that is transposed is also called the transposable element; the other is mediated by RM
- the transposition effect is called the return effect, and the genetic information unit that is transposed is called the return element.
- the types of return units are very complicated.
- RNA polymerases II and III the return units of the non-viral family originate from the transcription products of RNA polymerases II and III. Part of it is a fully post-transcriptional RNA product.
- the L1 reverse transcription factor is found in all mammalian genomes. It is a member of the family of reverse transcription factors and lacks long repeats at the end of the sequence. Members of the transcription factor family are involved in a variety of important biological processes such as transcription, reverse transcription, and gene drift. Members of this protein family have multiple open reading frames to transcribe and translate many different protein products. The highly conserved L1 factor also has two open reading frames, which are transcribed and translated into two different protein products.
- L1 back-transcription factor from human Y chromosome.
- the protein factor also has two different open reading frames to transcribe and translate different protein products.
- the open reading frame 1 encodes a protein product of about 40KD a , which is highly expressed in embryonic cancer cells.
- L1 protein is also closely related to the occurrence of Duchenne muscular dystrophy and other diseases in vivo.
- the amino acid sequence of this protein contains a highly conserved active domain of reverse transcriptase. This domain plays an important role in the process of protein transposition, and its mutation or abnormal expression will usually cause abnormalities in the genome transposition process. And then affect the genetic recombination and evolution of the organism.
- the protein is usually closely related to the development of some diseases of developmental and metabolic disorders, tumors and cancers of related tissues, Duchenne muscular dystrophy, etc. [Susan E. Holmes, Beth A. Dombroski et al, 1994, Nature Genet ics, 7 (2): 143-148].
- the new human LI reverse transcription factor 22 of the present invention has 56% identity and 77% similarity at the protein level with the known human L1 reverse transcription factor, and the amino acid sequences of both contain highly conserved reversals Since the enzyme acts on the active domain, both are considered to be members of the protein family of the reverse transcription factor and have similar biological functions.
- the human L1 reverse transcription factor 22 of the present invention is also highly expressed in embryonic cancer cells and related tissue cells.
- the protein is involved in regulating a variety of important gene transcription and recombination processes in the body, and its mutation or abnormal expression is usually associated with a variety of organisms. Development is closely related to the occurrence of metabolic disorders, related tissue tumors and cancer, and Duchenne muscular dystrophy. The protein can also be used for the diagnosis and treatment of various related diseases mentioned above.
- the human L1 reverse transcription factor 11 protein plays an important role in regulating important functions of the body such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes, so there has been a need to identify more involved in these processes
- the human L1 reverse transcription factor 22 protein identifies the amino acid sequence of this protein. Isolation of the newcomer L1 reverse transcription factor 22 protein encoding gene also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for developing diagnostic and / or therapeutic drugs for the disease, so it is important to isolate its coding for DM.
- Another object of the invention is to provide a polynucleotide encoding the polypeptide.
- Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding a human L1 reverse transcription factor 22.
- Another object of the present invention is to provide an antibody against the polypeptide of the present invention-human L1 reverse transcription factor 22.
- Another object of the present invention is to provide mimic compounds, antagonists, agonists, and inhibitors directed to the polypeptide of the present invention-human L1 reverse transcription factor 22.
- Another object of the present invention is to provide a method for diagnosing and treating a disease associated with abnormality of human L1 reverse transcription factor 22. Summary of invention
- the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
- the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
- the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
- sequence of the polynucleotide is one selected from: (a) a sequence having positions 93-707 in SEQ ID NO: 1; and (b) having a sequence of 1-1441 in SEQ ID NO: 1 Sequence of bits.
- the present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
- the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
- the present invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of human L1 reverse transcription factor 22 protein, which comprises utilizing the polypeptide of the present invention.
- the invention also relates to compounds obtained by this method.
- the invention also relates to a method for detecting a disease or susceptibility to disease associated with abnormal expression of human L1 reverse transcription factor 22 protein in vitro, comprising detecting a mutation in the polypeptide or a polynucleotide sequence encoding the same in a biological sample, or detecting a biological The amount or biological activity of a polypeptide of the invention in a sample.
- the invention also relates to a pharmaceutical composition
- a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
- the present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention in the preparation of a medicament for treating cancer, developmental disease or immune disease, or other diseases caused by abnormal expression of human L1 reverse transcription factor 22.
- FIG. 1 is a comparison diagram of amino acid sequence homology between the human LI reverse transcription factor 22 and human LI reverse transcription factor of the present invention.
- the upper sequence is human L1 reverse transcription factor 22, and the lower sequence is human L1 reverse transcription factor.
- Identical amino acids are represented by single-character amino acids between the two sequences, and similar amino acids are represented by "+”.
- Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of the isolated human L1 reverse transcription factor 22. 22kDa is the molecular weight of the protein. The arrow indicates the isolated protein band.
- Nucleic acid sequence refers to oligonucleotides, nucleotides or polynucleotides and fragments or parts thereof, and may also refer to the genome or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
- amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
- amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
- a “variant" of a protein or polynucleotide refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it.
- the changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence.
- Variants can have "conservative" changes, in which the amino acid substituted has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine.
- Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
- “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
- Insertion means that a change in the amino acid sequence or nucleotide sequence results in an increase in one or more amino acids or nucleotides compared to a molecule that exists in nature.
- Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
- Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
- immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response and to bind specific antibodies in a suitable animal or cell.
- An "agonist” refers to a molecule that, when combined with human L1 reverse transcription factor 22, causes the protein to change, thereby regulating the activity of the protein.
- An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that binds human L1 back-transcription factor 22.
- Antagonist refers to a molecule that can block or modulate the biological or immunological activity of human L1 back transcription factor 22 when combined with human L1 back transcription factor 22.
- Antagonists and inhibitors It may include a protein, a nucleic acid, a carbohydrate or any other molecule that can bind to human L1 back transcription factor 22.
- Regular refers to a change in the function of human L1 reverse transcription factor 22, including an increase or decrease in protein activity, a change in binding characteristics, and any other biological, functional, or immune properties of human L1 reverse transcription factor 22.
- substantially pure ' means essentially free of other proteins, lipids, carbohydrates or other substances with which it is naturally associated.
- Those skilled in the art can purify human L1 back transcription factor 22 using standard protein purification techniques. Basically Pure human L1 reverse transcription factor 22 can generate a single main band on a non-reducing polyacrylamide gel. The purity of human L1 reverse transcription factor 22 polypeptide can be analyzed by amino acid sequence.
- Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
- sequence C-T-G-A
- complementary sequence G-A-C-T.
- the complementarity between two single-stranded molecules may be partial or complete.
- the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
- “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
- Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Southern imprinting or Northern blotting, etc.) under conditions of reduced stringency. Substantially homologous sequences or hybridization probes can compete and inhibit the binding of fully homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.
- Percent identity refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALIGN program (Lasergene sof tware package, DNASTAR, Inc., Madi son Wis.). The MEGALIGN program can compare two or more sequences according to different methods such as the Clus ter method (Hi gg ins, DG and PM Sharp (1988) Gene 73: 237-244). 0 The C lus ter method checks the distance between all pairs The groups of sequences are arranged into clusters. The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula:
- the assay may be Jotun Hein percent identity between nucleic acid sequences Clus ter or a method well known in the art (Hein J., (1990) Methods in enzymol ogy 183: 625-645) 0
- Similarity refers to the identity of amino acid residues at corresponding positions when aligning amino acid sequences. Or the extent of conservative substitution.
- Amino acids used for conservative substitution for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
- Antisense refers to a nucleotide sequence that is complementary to a particular DNA or A sequence.
- Antisense strand refers to a nucleic acid strand that is complementary to a “sense strand.”
- Derivative refers to HFP or a chemical modification of its nucleic acid. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
- Antibody refers to a complete antibody molecule and its fragments, such as Fa,? ( ⁇ ') 2 and?, Which specifically bind to the antigenic determinant of human L1 reverse transcription factor 22.
- a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
- isolated refers to the removal of a substance from its original environment (for example, its natural environment if it is naturally occurring).
- a naturally-occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
- Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not part of its natural environment, they are still isolated.
- isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
- polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances in the natural state .
- isolated human L1 reverse transcription factor 22 means that human L1 reverse transcription factor 11 is substantially free of other proteins, lipids, sugars, or other substances that are naturally associated with it. Those skilled in the art will be able to purify human L1 reverse transcription factor 22 using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of human L1 reverse transcription factor 22 polypeptide can be analyzed by amino acid sequence.
- the present invention provides a new polypeptide, human L1 reverse transcription factor 22, which is basically composed of the amino acid sequence shown in SEQ ID NO: 2.
- the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, a synthetic polypeptide, and preferably a recombinant polypeptide.
- the polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be obtained from prokaryotic or eukaryotic hosts (e.g., bacteria, yeast, higher plants, insects, and mammals) using recombinant techniques. Cells). Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
- the present invention also includes fragments, derivatives, and analogs of human L1 reverse transcription factor 22.
- fragment refers to a polypeptide that substantially maintains the same biological function or activity of the human L1 reverse transcription factor 22 of the present invention.
- a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution
- the amino acid may or may not be encoded by a genetic codon; or ( ⁇ ) a type in which a group on one or more amino acid residues is replaced by another group to include a substituent; or (II I)
- Such a polypeptide sequence in which the mature polypeptide is fused with another compound such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol
- a polypeptide sequence in which an additional amino acid sequence is fused into the mature polypeptide (Such as the leader or secretory sequence or the sequence used to purify the polypeptide or protease sequence).
- such fragments, derivatives and analogs are considered to be within the knowledge of those skilled in the art.
- the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
- the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
- the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a full-length polynucleotide sequence of 1441 bases, and its open reading frame 93-707 encodes 204 amino acids. According to the amino acid sequence homology comparison, it was found that this polypeptide has 56% homology with human L1 reverse transcription factor. It can be inferred that human L1 reverse transcription factor 22 has similar structure and function to human L1 reverse transcription factor.
- the polynucleotide of the present invention may be in the form of DNA or RNA.
- DNA forms include cDNA, genomic DNA, or synthetic DNA.
- DNA can be single-stranded or double-stranded.
- the DM can be a coding chain or a non-coding chain.
- the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
- a "degenerate variant” refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
- the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
- polynucleotide encoding a polypeptide refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.
- the present invention also relates to a variant of the polynucleotide described above, which encodes the same amino group as the present invention.
- Variants of this polynucleotide may be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
- an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
- the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity, between the two sequences).
- the present invention particularly relates to polynucleotides that can hybridize to the polyglycolic acid according to the present invention under stringent conditions.
- “strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60 ° C; or (2) Add denaturants during hybridization, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% Ficol 1, 42 ° C, etc .; or (3) only between the two sequences Hybridization occurs only when the identity is at least 95%, and more preferably 97%.
- the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
- nucleic acid fragments that hybridize to the sequences described above.
- a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 cores. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques, such as PCR, to identify and / or isolate polynucleotides encoding human L1 back transcription factor 22.
- polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
- the specific polynucleotide sequence encoding the human L1 reverse transcription factor 22 of the present invention can be obtained by various methods.
- polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
- the DM fragment sequence of the present invention can also be obtained by the following methods: 1) separating a double-stranded DNA sequence from genomic DNA; 2) chemically synthesizing the DM sequence to obtain the double-stranded DM of the polypeptide.
- genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the separation of the CDM sequences.
- the standard method for isolating the cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library. There are many mature techniques for extracting mRNA, and kits are also commercially available (Qiagene). And the construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manua, Cold Spruing Harbor Laboratory. New York, 1989).
- cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned. These genes can be screened from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DM or DM-RNA hybridization; (2) the presence or absence of a marker gene function; (3) the determination of the level of human L1 reverse transcription factor 22 transcripts; (4) ) Detection of protein products expressed by genes through immunological techniques or determination of biological activity. The above methods can be used singly or in combination.
- the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
- the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
- the probe used here is generally a DNA sequence chemically synthesized based on the gene sequence information of the present invention.
- the genes or fragments of the present invention can of course be used as probes.
- DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
- immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) can be used to detect the protein products expressed by the human L1 reverse transcription factor 22 gene.
- ELISA enzyme-linked immunosorbent assay
- a method for amplifying DNA / RNA using PCR technology is preferably used to obtain the gene of the present invention.
- the RACE method RACE-Rapid Amplification of cDNA Ends
- the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein Select and synthesize using conventional methods.
- the amplified DM / RNA fragment can be isolated and purified by conventional methods such as by gel electrophoresis.
- polynucleotide sequence of the gene of the present invention or various DM fragments and the like obtained as described above can be measured by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, sequencing needs to be repeated. Sometimes it is necessary to determine the cDM sequence of multiple clones in order to splice into a full-length cDM sequence.
- the present invention also relates to a vector comprising a polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using a human L1 back transcription factor 22 coding sequence, and a method for producing a polypeptide of the present invention by recombinant technology. .
- a polynucleotide sequence encoding the human L1 back transcription factor 22 can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
- vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
- Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al.
- any plasmid and vector can be used to construct recombinant expression vectors.
- An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
- Methods known to those skilled in the art can be used to construct an expression vector containing a DM sequence encoding human L1 reverse transcription factor 22 and appropriate transcription / translation regulatory elements. These methods include in vitro recombinant DNA technology, band synthesis technology, and in vivo recombination technology (Sambroook, et al. Molecular Cloning, a Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989).
- the DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide mMA synthesis. Representative examples of these promoters are: the lac or trp promoter of E.
- the expression vector also includes a ribosome binding site for translation initiation, a transcription terminator, and the like. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors expressed by DM, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers and adenovirus enhancers on the late side of the origin of replication.
- the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
- selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
- GFP fluorescent protein
- tetracycline or ampicillin resistance for E. coli.
- the polynucleotide encoding human L1 back transcription factor 22 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a genetically engineered host cell containing the polynucleotide or the recombinant vector.
- host cell refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E.
- coli Streptomyces
- bacterial cells such as Salmonella typhimurium
- fungal cells such as yeast
- plant cells such as insect cells such as Fly S2 or Sf9
- animal cells such as CH0, COS or Bowes melanoma cells.
- Transformation of a host cell with a DM sequence according to the present invention or a recombinant vector containing the DNA sequence can be performed by conventional techniques well known to those skilled in the art.
- the host is a prokaryote, such as E. coli
- competent cells capable of absorbing DNA can be harvested after the exponential growth phase and treated with the CaCl 2 method. The steps used are well known in the art. Alternatively, MgCl 2 is used. If required, transformation can also be performed by electroporation Method.
- the host is a eukaryote, the following DM transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
- the polynucleotide sequence of the present invention can be used to express or produce recombinant human L1 retrotranscription factor 22 (Science, 1984; 224: 1431). Generally, the following steps are taken:
- the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
- a suitable method such as temperature conversion or chemical induction
- the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If necessary, the recombinant protein can be isolated and purified by various separation methods using its physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
- conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid
- polypeptides of the present invention as well as antagonists, agonists and inhibitors of the polypeptides, can be directly used in the treatment of diseases, for example, they can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection, and immune diseases.
- transposons There are a large number of transferable components in the human genome, namely transposons.
- the transposition process of transposons will increase the number of copies of transposons and accelerate the evolution of the genome.
- the transposition effect mediated by MA is called the return effect, and the genetic information unit that is transposed is called the return element.
- L1 reverse transcription factor is a member of the family of reverse transcription factors, which is highly expressed in embryonic cancer cells.
- L1 protein is also closely related to the occurrence of Duchenne muscular dystrophy and other diseases.
- the amino acid sequence of this protein contains a highly conserved active domain of reverse transcriptase. This domain plays an important role in the process of protein transposition, and its mutation or abnormal expression will usually cause abnormalities in the genome transposition process. And then affect the genetic recombination and evolution of the organism.
- the protein is usually closely related to the development of some diseases of developmental and metabolic disorders, tumors and cancers of related tissues, and Duchenne muscular dystrophy.
- the polypeptide of the present invention and the L1 reverse transcription factor are human L1 reverse transcription factors and contain characteristic sequences of the L1 reverse transcription factor family. Both have similar biological functions. It has a transposition effect mediated by MA in vivo and regulates the expression of related genes. Its abnormal expression is usually closely related to the occurrence of some related metabolic disorders, protein metabolic disorders, and related tissue tumors and cancers, and produce related diseases.
- human L1 reverse transcription factor 22 of the present invention will produce various diseases, especially Duchenne muscular dystrophy, various tumors, embryonic developmental disorders, growth and development disorders, inflammation, and immunity. Diseases, including but not limited to:
- Tumors of various tissues stomach cancer, liver cancer, lung cancer, esophageal cancer, breast cancer, leukemia, lymphoma, thyroid tumor, uterine fibroids, neuroblastoma, astrocytoma, ependymoma, glioblastoma, nerve Fibroma, colon cancer, melanoma, bladder cancer, uterine cancer, endometrial cancer, thymic tumor, nasopharyngeal cancer, laryngeal cancer, tracheal tumor, fibroid, fibrosarcoma, lipoma, liposarcoma
- Fetal developmental disorders congenital abortion, cleft palate, limb loss, limb differentiation disorder, atrial septal defect, neural tube defect, congenital hydrocephalus, congenital glaucoma or cataract, congenital deafness
- Growth and development disorders mental retardation, brain development disorders; skin, fat and muscle dysplasia, bone and joint dysplasia, various metabolic defects, stunting, dwarfism, Cushing syndrome, Sexual retardation
- Inflammation chronic active hepatitis, sarcoidosis, polymyositis, chronic rhinitis, chronic gastritis, cerebrospinal multiple sclerosis, glomerulonephritis, myocarditis, cardiomyopathy, atherosclerosis, gastric ulcer, cervicitis, Various infectious inflammations
- Immune diseases Systemic lupus erythematosus, rheumatoid arthritis, bronchial asthma, urticaria, specific dermatitis, post-infection myocarditis, scleroderma, myasthenia gravis, Guillain-Barre syndrome, common variable immunodeficiency disease , Primary B-lymphocyte immunodeficiency disease, Acquired immunodeficiency syndrome
- Abnormal expression of the human L1 reverse transcription factor 22 of the present invention will also produce certain hereditary, hematological diseases and the like.
- the polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat various diseases, especially Duchenne muscular dystrophy, various tumors, embryonic developmental disorders, growth Developmental disorders, inflammation, immune diseases, certain hereditary, blood diseases, etc.
- the present invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) human L1 retrotranscription factor 22.
- Agonists enhance biological functions such as human L1 retrotransduction factor 22 to stimulate cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
- a mammalian cell or a membrane preparation expressing human L1 reverse transcription factor 22 can be cultured together with a labeled human L1 reverse transcription factor 22. The ability of the drug to increase or block this interaction is then determined.
- Antagonists of human L1 reverse transcription factor 22 include antibodies, compounds, receptor deletions, and the like that have been screened. Antagonists of human L1 reverse transcription factor 22 can bind to human L1 reverse transcription factor 22 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot perform biological functions.
- human L1 reverse transcription factor 22 can be added to bioanalytical assays to determine whether a compound is an antagonist by measuring the effect of the compound on the interaction between human L1 reverse transcription factor 22 and its receptor. .
- Receptor deletions and analogs that function as antagonists can be screened in the same manner as described above for screening compounds.
- Polypeptide molecules capable of binding to human L1 reverse transcription factor 22 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. When screening, the human L1 reverse transcription factor 22 molecule should generally be labeled.
- the present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or single'clonal antibodies.
- the invention also provides antibodies directed against the human L1 retrotranscription factor 22 epitope. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments generated from Fab expression libraries.
- Polyclonal antibodies can be produced by injecting human L1 reverse transcription factor 22 directly into immunized animals (such as rabbits, mice, rats, etc.).
- immunized animals such as rabbits, mice, rats, etc.
- a variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's adjuvant. Wait.
- Techniques for preparing monoclonal antibodies against human L1 retrotranscription factor 22 include, but are not limited to, hybridoma technology (Kohler and Mistein. Nature, 1975, 256: 495-497), triple tumor technology, human beta cell hybridoma technology, EBV-hybridoma technology, etc.
- Embedding antibodies that bind human constant regions and non-human variable regions can be produced using known techniques (Morrison et al, PNAS, 1985, 81: 6851).
- the existing technology for producing single chain antibodies (U.S. Pat No. 4946778) can also be used to produce single chain antibodies against human L1 retrotranscription factor 22
- Antibodies against human L1 reverse transcription factor 22 can be used in immunohistochemistry to detect human L1 reverse transcription factor 22 in biopsy specimens.
- Monoclonal antibodies that bind to human L1 reverse transcription factor 22 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
- Antibodies can also be used to design immunotoxins that target a particular part of the body.
- Human L1 22 High-affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
- a common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
- This hybrid antibody can be used to kill human L1 reverse transcription factor 22-positive cells .
- the antibodies of the present invention can be used to treat or prevent diseases related to human L1 retrotranscription factor 22. Administration of an appropriate dose of the antibody can stimulate or block the production or activity of human L1 reverse transcription factor 22.
- the invention also relates to a diagnostic test method for quantitatively and locally detecting the level of human L1 reverse transcription factor 22.
- tests are well known in the art and include FISH assays and radioimmunoassays.
- the level of human L1 reverse transcription factor 22 detected in the test can be used to explain the importance of human L1 reverse transcription factor 22 in various diseases and to diagnose diseases in which human L1 reverse transcription factor 22 plays a role.
- polypeptide of the present invention can also be used for peptide mapping analysis.
- the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
- Polynucleotides encoding human L1 reverse transcription factor 22 can also be used for a variety of therapeutic purposes. Gene therapy techniques can be used to treat abnormal cell proliferation, development, or metabolism caused by the non-expression or abnormal / inactive expression of human L1 reverse transcription factor 22.
- Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated human L1 reverse transcription factor 22 to inhibit endogenous human L1 reverse transcription factor 22 activity.
- a mutated human L1 retrotransduction factor 22 may be a shortened human L1 retrotransduction factor 22 lacking a signaling functional domain. Although it can bind to downstream substrates, it lacks signaling activity.
- the recombinant gene therapy vector can be used for treating diseases caused by abnormal expression or activity of human L1 reverse transcription factor 22.
- Expression vectors derived from viruses such as retroviruses, adenoviruses, adenovirus-associated viruses, herpes simplex virus, parvoviruses, and the like can be used to transfer a polynucleotide encoding human L1 back transcription factor 22 into cells.
- Methods for constructing a recombinant viral vector carrying a polynucleotide encoding human L1 reverse transcription factor 22 can be found in the existing literature (Sambrook, et al.).
- a recombinant polynucleotide encoding human L1 retroviral factor 22 can be packaged into liposomes and transferred into cells.
- Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
- a vector such as a virus, phage, or plasmid
- Oligonucleotides including antisense RNA and DM
- ribozymes that inhibit human L1 reverse transcription factor 22 mRNA are also within the scope of the present invention.
- a ribozyme is an enzyme-like RNA molecule that can specifically decompose a specific RM. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RM to perform endonucleation.
- Antisense RM and DM and ribozymes can be obtained using any existing or DM synthesis techniques, such as solid-phase phosphate The technology of oligonucleotide synthesis by amine chemical synthesis is widely used.
- Antisense MA molecules can be obtained by in vitro or in vivo transcription of DM sequences encoding the RNA. This DM sequence has been integrated downstream of the RNA polymerase promoter of the vector. In order to increase the stability of a nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the ribonucleoside linkages should use phosphate thioester or peptide bonds instead of phosphodiester bonds.
- Polynucleotides encoding human L1 reverse transcription factor 22 can be used for the diagnosis of diseases related to human L1 reverse transcription factor 22.
- a polynucleotide encoding human U-retroviral factor 22 can be used to detect the expression of human L1-retroviral factor 22 or the abnormal expression of human L1-retroviral factor 11 in a disease state.
- the DM sequence encoding human L1 reverse transcription factor 22 can be used to hybridize biopsy specimens to determine the expression status of human L1 reverse transcription factor 22.
- Hybridization techniques include Southern blotting, Northern blotting, and in situ hybridization. These techniques and methods are publicly available and mature, and related kits are commercially available.
- a part or all of the polynucleotide of the present invention can be used as a probe to be fixed on a microarray or a DNA chip (also referred to as a "gene chip") for analyzing differential expression analysis and gene diagnosis of genes in a tissue.
- Human L1 reverse transcription factor 22 specific primers can also be used to detect the transcription products of human L1 reverse transcription factor 22 by performing RNA-polymerase chain reaction (RT-PCR) in vitro amplification.
- Detecting mutations in the human L1 retrotranscription factor 22 gene can also be used to diagnose human L1 retrotranscription factor 22-related diseases.
- the form of human L1 reverse transcription factor 22 mutations includes point mutations, translocations, deletions, recombinations, and any other abnormalities compared to normal wild-type human L1 reverse transcription factor 11 DNA sequences. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression. Therefore, the Nor thern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
- sequences of the invention are also valuable for chromosome identification. This sequence will specifically target a specific position on a human chromosome and can hybridize to it. Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for marking chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DNA sequences on a chromosome.
- a PCR primer (preferably 15-35bp) is prepared from the cDNA, and the sequence can be located on the chromosome. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
- PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
- oligonucleotide primers of the present invention by a similar method, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
- Other similar strategies that can be used for chromosomal localization include in situ Hybridization, pre-screening of chromosomes using labeled flow sorting, and pre-selection of hybridization, thereby constructing a chromosome-specific cDNA library.
- Fluorescent in situ hybridization of cDM clones with metaphase chromosomes allows precise chromosomal localization in one step.
- FISH Fluorescent in situ hybridization
- the cD or genomic sequence differences between the affected and unaffected individuals need to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for changes in scabs in the chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the CDM that is accurately mapped to a disease-related chromosomal region can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).
- the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
- suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
- the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
- the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
- a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
- these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell.
- the polypeptides of the invention can be used in combination with other therapeutic compounds.
- the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
- Human L1 retrotranscription factor 22 is administered in an amount effective to treat and / or prevent a specific indication.
- the amount and dose range of human L1 retrotransduction factor 22 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician. Examples
- Total human fetal brain RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform.
- Poly (A) mRNA was isolated from total RNA using Quik mRNA Isolat ion Kit (product of Qiegene). 2ug poly (A) mRNA is reverse transcribed to form cDNA. Smart cDNA cloning kit (purchased from Clontech) was used to insert the cDNA fragments into the multi-cloning site of pBSK (+) vector (Clontech) to transform DH5 ⁇ to form a cDNA library.
- sequences of the 5 'and 3' ends of all clones were determined using Dye terminate cycle reaction ionization kit (Perkin-Elmer) and ABI 377 automatic sequencer (Perkin-Elmer).
- the determined cDNA sequences existing DM public sequence databases were compared, they found a clone cDNA sequence for the new 0691e0 4 DM.
- a series of primers were synthesized to determine the inserted cDNA fragments of the clone in both directions.
- the 0691e04 clone contains a full-length cDNA of 1441bp (as shown by Seq ID NO: l), and a 614bp open reading frame (0RF) from 93bp to 707bp, encoding a new protein (such as Seq ID NO : Shown in 2).
- This clone pBS-0691e04 was named human L1 reverse transcription factor 22.
- Example 2 Homologous search of cDNA clones
- CDNA was synthesized using fetal brain total A as a template and ol igo-dT as a primer for reverse transcription reaction. After purification using Qiagene's kit, PCR was performed using the following primers:
- Primerl 5,-AAACCTCCTTAAAACATAAATCTC —3, (SEQ ID NO: 3) Primer 2: 5'- GCAGTTTTTAAATTACCGTTTCAA -3 '(SEQ ID NO: 4)
- Primerl is a forward sequence starting at lbp of the 5th end of SEQ ID NO: 1;
- Primer2 is the 3, terminal reverse sequence of SEQ ID NO: 1.
- Amplification conditions 50 ⁇ l reaction volume containing 50 mmol / LiCl, 10 mmol / L Tr is-HCl pH 8.5, 1.5 surface 1 / L MgCl 2 , 2 (mol / L dNTP, lOpmol primer, 1U Taq DM polymerase (Clontech).
- the reaction was performed on a PE9600 DM thermal cycler (Perkin-Elmer) under the following conditions for 25 cycles: 94 ° C 30sec; 55 ° C 30 sec; 72 ° C 2min 0 at RT -Set ⁇ -actin as positive control and template blank as negative control at the same time for PCR.
- Total RM was extracted in one step [Anal. Biochem. 1987, 162, 156-159].
- This method involves acid guanidinium thiocyanate phenol-chloroform extraction. 4M guanidinium isothiocyanate-25mM sodium citrate, 0.2M Sodium acetate (pH 4.0) was used to homogenize the tissue, 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1) were added, and the mixture was centrifuged. The aqueous phase layer was aspirated and isopropyl alcohol ( 0.8 volume) and the mixture was centrifuged to obtain a MA precipitate. The resulting RNA precipitate was washed with 70% ethanol, dried and dissolved in water.
- RNA-transferred nitrocellulose membrane were hybridized overnight at 42 ° C in a solution containing 50% formamide-25mM KH 2 P0 4 ( P H7.4)-5 x SSC-5 ⁇ Den Hardt's solution and 20 ⁇ g / ml salmon sperm DM. After hybridization, the filter was washed in 1 x SSC-0.1% SDS at 55 ° C. for 30 min. Then, Phosphor Imager was used for analysis and quantification.
- Example 5 Recombinant human In vitro expression, isolation and purification of L1 reverse transcription factor 22
- Priraer3 5'-CATGCTAGCATGAATAGAATAGTACCTCACATC-3 '(Seq ID No: 5)
- Primer4 5'-CATGGATCCTTATTGAGACTCATTTTGTGGCCT-3' (Seq ID No: 6)
- the two ends of these two primers contain Nhel and BamHI restriction sites, respectively.
- the coding sequences of the 5 ', 3 ' and 3 'ends of the target gene are followed, respectively.
- the Nhel and BamHI restriction sites correspond to the expression vector plasmid pET- Selective endonuclease site on 28b (+) (Novagen, Cat. No. 69865. 3).
- PCR was performed using the PBS-0691e04 plasmid containing the full-length target gene as a template.
- PCR reaction conditions were: 1 in a total volume of 50 ⁇ plasmid pBS-0691e04 containing 10pg, primer? ⁇ 1 ⁇ ]: A 3 and? ] ⁇ 11161-4 are 1.
- Advantage polymerase Mix (Clontech) 1 ⁇ 1 .
- Cycle parameters 94 ° C 20s, 60. C 30s, 68. C 2 min, a total of 25 cycles.
- Nhel and BamHI were used to double-digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase.
- the ligated product was transformed into E. coli DH5 cc using the calcium chloride method. After culturing overnight on LB plates containing kanamycin (final concentration 3 (g / ml)), positive colonies were screened by colony PCR method and sequenced. The correct positive clone (PET-0691e04) was used to transform the recombinant plasmid into E. coli BL21 (DE3) plySs (product of Novagen) by calcium chloride method.
- a peptide synthesizer (product of PE company) was used to synthesize the following human L1 reverse transcription factor 22-specific peptides: NH2- et-Asn ⁇ Arg-I le-Val-Pro-Hi sI le-Ser-I le-Val-Met -Leu-Asn-Val-C00H (SEQ ID NO: 7).
- the polypeptide is coupled with hemocyanin and bovine serum albumin to form a complex, respectively. For methods, see: Avrameas, et al. Imm painted chemi s try, 1969; 6: 43.
- Selecting suitable oligonucleotide fragments from the polynucleotides of the present invention has various uses as hybridization probes, such as using the probes to hybridize to genomic or cDNA libraries of normal tissues or pathological tissues from different sources.
- the probe may further be used to detect the polynucleotide sequence of the present invention or a homologous polynucleotide sequence thereof in normal tissue or Whether the expression in pathological tissue cells is abnormal.
- the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by using a filter hybridization method.
- Filter hybridization methods include dot blotting, Southern imprinting, Northern blotting, and copying methods. They all use the same steps to immobilize the polynucleotide sample to be tested on the filter.
- the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer to saturate the non-specific binding site of the sample on the filter with the carrier and the synthesized polymer.
- the pre-hybridization solution is then replaced with a hybridization buffer containing labeled probes and incubated to hybridize the probes to the target nucleic acid.
- the unhybridized probes are removed by a series of membrane washing steps.
- This embodiment uses higher-intensity washing conditions (such as lower salt concentration and higher temperature), so that the hybridization background is reduced and only strong specific signals are retained.
- the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
- the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
- the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
- oligonucleotide fragments from the polynucleotide SEQ ID NO: 1 of the present invention for use as hybridization probes should follow the following principles and several aspects to be considered:
- the preferred range of probe size is 18-50 nucleotides
- the GC content is 30% -70%, and the non-specific hybridization increases when it exceeds;
- Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements The regions are compared for homology. If the homology with the non-target molecule region is greater than 853 ⁇ 4 or there are more than 15 consecutive bases, the primary probe should not be used in general;
- Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
- Probe 2 which belongs to the second type of probe, is equivalent to the replacement mutant sequence of the gene fragment of SEQ ID NO: 1 or its complementary fragment (41Nt):
- PBS phosphate buffered saline
- step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
- NC membrane nitrocellulose membrane
- the sample membrane was placed in a plastic bag, and 3-10 mg of prehybridization solution (10xDenhardt's; 6xSSC, 0.1 mg / ml CT DM (calf thymus DM)) was added. After sealing the bag, shake at 68 ° C for 2 hours.
- prehybridization solution 10xDenhardt's; 6xSSC, 0.1 mg / ml CT DM (calf thymus DM)
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Veterinary Medicine (AREA)
- Pharmacology & Pharmacy (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Animal Behavior & Ethology (AREA)
- General Chemical & Material Sciences (AREA)
- Public Health (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Biophysics (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Gastroenterology & Hepatology (AREA)
- Biochemistry (AREA)
- Toxicology (AREA)
- Genetics & Genomics (AREA)
- Molecular Biology (AREA)
- Zoology (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Immunology (AREA)
- Peptides Or Proteins (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
AU13584/02A AU1358402A (en) | 2000-05-16 | 2001-05-14 | A new polypeptide- human L1 retroposon 22 and the polynucleotide encoding it |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN00115705.1 | 2000-05-16 | ||
CN00115705A CN1323816A (zh) | 2000-05-16 | 2000-05-16 | 一种新的多肽——人l1返转录因子22和编码这种多肽的多核苷酸 |
Publications (1)
Publication Number | Publication Date |
---|---|
WO2001094404A1 true WO2001094404A1 (fr) | 2001-12-13 |
Family
ID=4585149
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/CN2001/000761 WO2001094404A1 (fr) | 2000-05-16 | 2001-05-14 | Nouveau polypeptide, facteur humain de retrotransposition l1 22, et polynucleotide codant ce polypeptide |
Country Status (3)
Country | Link |
---|---|
CN (1) | CN1323816A (fr) |
AU (1) | AU1358402A (fr) |
WO (1) | WO2001094404A1 (fr) |
-
2000
- 2000-05-16 CN CN00115705A patent/CN1323816A/zh active Pending
-
2001
- 2001-05-14 AU AU13584/02A patent/AU1358402A/en not_active Abandoned
- 2001-05-14 WO PCT/CN2001/000761 patent/WO2001094404A1/fr active Application Filing
Non-Patent Citations (5)
Title |
---|
GLAUSER A. AND BRAUN R.: "TUBIS, a fossilized retroposon in the tubulin gene cluster of trypanosoma brucei", BIOCHIM. BIOPHYS. ACTA, vol. 1218, no. 1, 1994, pages 99 - 101 * |
HOSLER B.A. ET AL.: "An octamer motif contributes to the expression of the retinoic acid-regulated zinc finger gene Rex-1 (Zfp-42)in F9 teratocarcinoma cells", MOL. CELL. BIOL., vol. 13, 1993, pages 2919 - 2928 * |
SCOTT A.F. ET AL.: "Origin of the human L1 elements: proposed progenitor genes deduced from a consensus DNA sequence", GENOMICS, vol. 1, no. 2, 1987, pages 113 - 125 * |
SHELL B.E. ET AL.: "Two subfamilies of murine retrotransposon ETn sequences", GENE, vol. 86, no. 2, 1990, pages 269 - 274 * |
SULSTON J.E. AND WATERSTON R.: "Toward a complete human genome sequence", GENOME RES., vol. 8, no. 11, 1998, pages 1097 - 1108 * |
Also Published As
Publication number | Publication date |
---|---|
CN1323816A (zh) | 2001-11-28 |
AU1358402A (en) | 2001-12-17 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
WO2002026973A1 (fr) | Nouveau polypeptide, une ribonucleoproteine nucleaire heterogene humaine 32.01, et un polynucleotide codant ce polypeptide | |
WO2002026972A1 (fr) | Nouveau polypeptide, proteine humaine 20.13 de liaison de l'acide polyadenylique, et polynucleotide codant ce polypeptide | |
WO2001090169A1 (fr) | Nouveau polypeptide, antigene nucleaire de proliferation cellulaire (pcna) 13, et polynucleotide codant ce polypeptide | |
WO2001083780A1 (fr) | Nouveau polypeptide, methylthioadenosine phosphorylase humaine 37, et polynucleotide codant pour ce polypeptide | |
WO2001068688A1 (fr) | Nouveau polypeptide, proteine kinase humaine tak1-27, et polynucleotide codant pour ce polypeptide | |
WO2001046240A1 (fr) | Nouveau polypeptide, mariner transposase 19 humaine, et polynucleotide codant pour ce polypeptide | |
WO2001094404A1 (fr) | Nouveau polypeptide, facteur humain de retrotransposition l1 22, et polynucleotide codant ce polypeptide | |
WO2002002611A1 (fr) | Nouveaux polypeptides, domaine de repetition 12 de recepteurs peptidiques de la motilite du sperme et proteine ribosomale l22, et polynucleotides codant ces polypeptides | |
WO2001072790A1 (fr) | Nouveau polypeptide, proteine humaine p40 12 de facteur l1, et polynucleotide codant pour ce polypeptide | |
WO2001073068A1 (fr) | Nouveau polypeptide, l1-12, et polynucleotide codant pour ce polypeptide | |
WO2002026810A1 (fr) | Nouveau polypeptide, substance proteique p125-77.22, et polynucleotide codant ce polypeptide | |
WO2001079279A1 (fr) | Nouveau polypeptide, facteur humain associe au recepteur du facteur de necrose tumorale 16, et polynucleotide codant pour ce polypeptide | |
WO2001064733A1 (fr) | Nouveau polypeptide, facteur humain 22 lie a la transcription inverse, et polynucleotide codant pour ce polypeptide | |
WO2001090369A1 (fr) | Nouveau polypeptide, n-acetylgalactosamine transferase 28, et polynucleotide codant ce polypeptide | |
WO2001094567A1 (fr) | Nouveau polypeptide, transposase de la famille tc1/mariner humaine 11, et polynucleotide codant ce polypeptide | |
WO2002033077A1 (fr) | Nouveau polypeptide, une proteine de regulation 10.01 etant associee au developpement humain et polynucleotide la codant | |
WO2001083540A1 (fr) | Nouveau polypeptide, kiaa0883-44, et polynucleotide codant pour ce polypeptide | |
WO2001049727A1 (fr) | Nouveau polypeptide, transducteur de signal 9 a effet chemotactique de bacteries, et polynucleotide codant pour ce polypeptide | |
WO2002004631A1 (fr) | Nouveau polypeptide, proteine 11 humaine associee a la transcription inverse orf2 du facteur l1, et polynucleotide codant ce polypeptide | |
WO2002004503A1 (fr) | Nouveau polypeptide, proteine humaine 15 associee a la transcription inverse orf2 du facteur l1, et polynucleotide codant ce polypeptide | |
WO2002012324A1 (fr) | Nouveau polypeptide, proteine 13 humaine associee a la transcription inverse orf2 du facteur l1, et polynucleotide codant ce polypeptide | |
WO2001075120A1 (fr) | Nouveau polypeptide, alkylguanine-adn/cysteine proteine methyltransferase humaine 13, et polynucleotide codant pour ce polypeptide | |
WO2001075000A2 (fr) | Nouveau polypeptide, facteur humain 15 lié á la rétrotransposition, et polynucléotide codant pour ce polypeptide | |
WO2002033076A1 (fr) | Nouveau polypeptide, facteur de transcription eucaryotique 17.38, et polynucleotide codant ce polypeptide | |
WO2002012323A1 (fr) | Nouveau polypeptide, proteine secretrice 11 de la famille des hlyd, et polynucleotide codant ce polypeptide |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A1 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
122 | Ep: pct application non-entry in european phase | ||
NENP | Non-entry into the national phase |
Ref country code: JP |