WO2001088153A1 - Nouveau polypeptide, nadh-ubiquinone oxydoreductase humaine 14, et polynucleotide codant ce polypeptide - Google Patents

Nouveau polypeptide, nadh-ubiquinone oxydoreductase humaine 14, et polynucleotide codant ce polypeptide Download PDF

Info

Publication number
WO2001088153A1
WO2001088153A1 PCT/CN2001/000745 CN0100745W WO0188153A1 WO 2001088153 A1 WO2001088153 A1 WO 2001088153A1 CN 0100745 W CN0100745 W CN 0100745W WO 0188153 A1 WO0188153 A1 WO 0188153A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
polynucleotide
ubiquinone oxidoreductase
sequence
human
Prior art date
Application number
PCT/CN2001/000745
Other languages
English (en)
Chinese (zh)
Inventor
Yumin Mao
Yi Xie
Original Assignee
Biowindow Gene Development Inc. Shanghai
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Biowindow Gene Development Inc. Shanghai filed Critical Biowindow Gene Development Inc. Shanghai
Priority to AU10030/02A priority Critical patent/AU1003002A/en
Publication of WO2001088153A1 publication Critical patent/WO2001088153A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/0012—Oxidoreductases (1.) acting on nitrogen containing compounds as donors (1.4, 1.5, 1.6, 1.7)
    • C12N9/0026—Oxidoreductases (1.) acting on nitrogen containing compounds as donors (1.4, 1.5, 1.6, 1.7) acting on CH-NH groups of donors (1.5)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • the present invention belongs to the field of biotechnology. Specifically, the present invention describes a new polypeptide—human NADH ubiquinone oxidoreductase 14—and a polynucleotide sequence encoding the polypeptide. The invention also relates to a method and application for preparing such polynucleotides and polypeptides. Background technique
  • NADH ubiquinone oxidoreductase is an internal mitochondrial membrane-bound multi-subunit enzyme complex.
  • Complex I consists of at least 41 subunits, seven of which are encoded by the mitochondrial genome.
  • the function of NADH ubiquinone oxidoreductase is to catalyze the sensitive oxidation of NADH rotenone and reduce ubiquinone.
  • the complex is composed of two hydrophilic portions and one hydrophobic portion, and the hydrophilic portion includes a flavin protein portion and a ferritin portion.
  • the flavin protein consists of 51-, 24-, and 10-KD subunits, all of which are encoded by nuclear genes.
  • This part plays a catalytic role in oxidizing MDH because it is related to the binding of flavin protein and NAD.
  • the four-nucleus Fe-S center in the 51- KD subunit and the two-nucleus Fe-S center in the 24-KD subunit participate in electron transfer (de Coo RF, Budd i ger P, Smeet s HJ, van Oos t BA, Genomi cs 1997 Oc t 15; 45 (2): 434-7) 0
  • the human gene encoding the 10-KD flavin protein subunit of complex I is named NDUFV3 gene, which is located on chromosome 21q22.3. This gene defect will cause Down syndrome and is related to the deterioration of dementia. Down syndrome, also known as 21-trisomy syndrome or Mongolian dementia, is one of the most common autosomal diseases caused by autosomal aberrations. Three 21 chromosomes contain the same genes and disrupt the balance of genetic material. Causes fetal developmental abnormalities. It is characterized by a small head shape, flat front and back, low nose bridges, short finger (toe) bones, large gaps between the first and second fingers (toes) of hands and feet, mental retardation, and chromosomal abnormalities.
  • the polypeptide of the present invention has 95% identity and 96% similarity with human NADH ubiquinone oxidoreductase at the protein level, and has similar biological functions, so it is considered to be a new type of MDH ubiquinone redox.
  • the enzyme named human NADH ubiquinone oxidoreductase 14. This protein catalyzes the sensitive oxidation of NADH rotenone and the reduction of ubiquinone. It is one of the mitochondrial respiratory chain complexes. Abnormal expression will cause diseases such as Down's syndrome and is related to the deterioration of dementia.
  • the human NADH ubiquinone oxidoreductase 14 protein plays an important role in regulating important functions of the body, such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes. Therefore, there is always a need to identify more participants in this field.
  • These processes of human NADH ubiquinone oxidoreductase 14 egg In particular, the amino acid sequence of this protein is identified. Isolation of the new gene encoding NADH ubiquinone oxidoreductase 14 protein also provides a basis for the study to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so isolating its coding DNA is very important. Disclosure of invention
  • Another object of the invention is to provide a polynucleotide encoding the polypeptide.
  • Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding human NADH ubiquinone oxidoreductase 14.
  • Another object of the present invention is to provide a method for producing human MDH ubiquinone oxidoreductase 14.
  • Another object of the present invention is to provide a human NADH ubiquinone oxidoreductase directed against the polypeptide of the present invention.
  • Another object of the present invention is to provide mimic compounds, antagonists, agonists, and inhibitors of NADH ubiquinone oxidoreductase 14 against the polypeptide of the present invention.
  • Another object of the present invention is to provide a method for diagnosing and treating diseases associated with abnormalities in human NADH ubiquinone oxidoreductase 14.
  • the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
  • the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
  • sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 23-412 in SEQ ID NO: 1; and (b) a sequence having positions 1-1 in SEQ ID NO: 1 083-bit sequence.
  • the invention further relates to a vector, in particular an expression vector, containing the polynucleotide of the invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; a package
  • the method of preparing the polypeptide of the present invention includes culturing the host cell and recovering the expressed product.
  • the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
  • the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of human MDH ubiquinone oxidoreductase 14 protein, which comprises utilizing the polypeptide of the invention.
  • the invention also relates to compounds obtained by this method.
  • the present invention also relates to a method for in vitro detection of a disease or disease susceptibility associated with abnormal expression of human NADH ubiquinone oxidoreductase 14 protein, which comprises detecting a mutation in the polypeptide or a sequence encoding a polynucleotide thereof in a biological sample, or Detection of the amount or biological activity of a polypeptide of the invention in a biological sample.
  • the invention also relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
  • the present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention in the preparation of a medicament for treating cancer, developmental disease or immune disease or other diseases caused by abnormal expression of human MDH ubiquinone oxidoreductase 14.
  • Nucleic acid sequence refers to oligonucleotides, nucleotides or polynucleotides and fragments or parts thereof, and can also refer to genomic or synthetic DNA or RNA, which can be single-stranded or double-stranded, representing the sense strand or Antisense strand.
  • amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
  • a “variant" of a protein or polynucleotide refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it.
  • the changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence.
  • Variants can have "conservative" changes, in which the amino acid substituted has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine.
  • Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
  • “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
  • “Insertion” or “addition” refers to an alteration in the amino acid sequence or nucleotide sequence that results in an increase in one or more amino acids or nucleotides compared to a naturally occurring molecule. "Replacement” refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
  • Biological activity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
  • the term “immunologically active” refers to the ability of natural, recombinant, or synthetic proteins and fragments thereof to induce a specific immune response and to bind specific antibodies in a suitable animal or cell.
  • An "agonist” refers to a molecule that, when combined with human NADH ubiquinone oxidoreductase 14, can cause the protein to change, thereby regulating the activity of the protein.
  • Agonists can include proteins, nucleic acids, carbohydrates, or any other molecule that can bind human NADH ubiquinone oxidoreductase 14.
  • Antagonist refers to a molecule that can block or regulate the biological or immunological activity of human NADH ubiquinone oxidoreductase 14 when combined with human NADH ubiquinone oxidoreductase 14.
  • Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates or any other molecule that can bind human NADH ubiquinone oxidoreductase 14.
  • Regular refers to a change in the function of human NADH ubiquinone oxidoreductase 14, including an increase or decrease in protein activity, a change in binding characteristics, and any other biological properties, functions, or immunity of human MDH ubiquinone oxidoreductase 14. Change of nature.
  • Substantially pure 1 'means substantially free of other proteins, lipids, sugars, or other substances with which it is naturally associated.
  • Those skilled in the art can purify human NADH ubiquinone oxidoreductase 14 using standard protein purification techniques.
  • Substantially pure human NADH ubiquinone oxidoreductase 14 produces a single main band on a non-reducing polyacrylamide gel.
  • the purity of human NADH ubiquinone oxidoreductase 14 polypeptide can be analyzed by amino acid sequence.
  • Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
  • sequence C-T-G-A
  • complementary sequence G-A-C-T.
  • the complementarity between two single-stranded molecules may be partial or complete.
  • the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
  • “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
  • Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Southern imprinting or Nor thern blotting, etc.) under conditions of reduced stringency.
  • Substantially homologous sequences or hybridization probes can compete and inhibit the binding of fully homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that conditions with reduced stringency allow non-specific binding, because conditions with reduced stringency require that the two sequences bind to each other as either specific or selective interactions.
  • Percent identity refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALIGN program (Lasergene sof tware package, DNASTAR, Inc., Mad Son Wis.). The MEGALIGN program can compare two or more sequences (Hi gg ins, DG and PM Sharp (1988) Gene 73: 237-244) 0 C lus ter method checks the distance between all pairs of sequence groups each arranged in clusters. The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula:
  • the number of residues matching between sequence A and sequence X 100
  • the number of residues in sequence A-the number of spacer residues in sequence A-the number of spacer residues in sequence B can also be determined by the Cluster method or by using known methods in the art Methods such as Jotun He in to determine the percent identity between nucleic acid sequences (He in J., (1990) Methods in emzumo logy 183: 625-645) 0 "similarity" refers to the corresponding position in the alignment between amino acid sequences Degree of identical or conservative substitutions of amino acid residues.
  • Amino acids used for conservative substitutions may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
  • Antisense refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence.
  • Antisense strand refers to a nucleic acid strand that is complementary to a “sense strand.”
  • Derivative refers to a chemical modification of HFP or a nucleic acid encoding it. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
  • Antibody refers to a complete antibody molecule and its fragments, such as Fa,? ( ⁇ ') 2 and? ⁇ It can specifically bind to the epitope of human NADH ubiquinone oxidoreductase 14.
  • a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
  • isolated refers to the removal of a substance from its original environment (for example, its natural environment if it is naturally occurring).
  • a naturally-occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
  • Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not part of its natural environment, they are still isolated.
  • isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
  • polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides coexist in a natural state Separated in other materials, it is isolated and purified.
  • isolated human NADH ubiquinone oxidoreductase 14 means that human NADH ubiquinone oxidoreductase 14 is substantially free of other proteins, lipids, sugars, or other substances with which it is naturally associated.
  • Those skilled in the art can purify human NADH ubiquinone oxidoreductase 14 using standard protein purification techniques. Basically pure peptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of human MDH ubiquinone oxidoreductase 14 peptide can be analyzed by amino acid sequence.
  • the present invention provides a new polypeptide, human NADH ubiquinone oxidoreductase 14, which is basically composed of the amino acid sequence shown in SEQ ID NO: 2.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
  • the polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques. Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude initial methionine residues.
  • the invention also includes fragments, derivatives and analogs of human NADH ubiquinone oxidoreductase 14.
  • fragment refers to a polypeptide that substantially maintains the same biological function or activity of the human NADH ubiquinone oxidoreductase 14 of the present invention.
  • a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution
  • the amino acid may or may not be encoded by a genetic codon; or ( ⁇ ) such a type in which one or more amino acid residues are substituted with other groups to include a substituent; or (III) such A type in which a mature polypeptide is fused to another compound (such as a compound that extends the half-life of a polypeptide, such as polyethylene glycol); or (IV) a type of polypeptide sequence in which an additional amino acid sequence is fused into a mature polypeptide (such as the leader sequence or secreted sequence or the sequence used to purify this polypeptide or protease sequence)
  • such fragments, derivatives and analogs are considered to be within the knowledge of those skilled in the art.
  • the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
  • the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a polynucleotide sequence with a total length of 1083 bases, and its open reading frames 23-412 encode 129 amino acids. According to the amino acid sequence homology comparison, it was found that this polypeptide has 95% homology with human NADH ubiquinone oxidoreductase.
  • the polynucleotide of the present invention may be in the form of DNA or RM.
  • DNA forms include cDNA, genomic DNA, or synthetic DNA.
  • DNA can be single-stranded or double-stranded.
  • the DM can be a coding chain or a non-coding chain.
  • the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
  • a “degenerate variant” refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
  • the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
  • polynucleotide encoding a polypeptide refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.
  • the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
  • Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
  • an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
  • the present invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity, between the two sequences).
  • the present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions.
  • “strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60 ° C; or (2) Add denaturants during hybridization, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% F i co ll, 42 ⁇ , etc .; or (3) only between two sequences Hybridization occurs only when the identity is at least 95%, and more preferably 97%.
  • the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
  • nucleic acid fragments that hybridize to the sequences described above.
  • a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, most preferably at least 100 More than nucleotides.
  • Nucleic acid fragments can also be used in nucleic acid amplification techniques such as PCR to identify and / or isolate polynucleotides encoding human MDH ubiquinone oxidoreductase 14.
  • polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
  • the specific polynucleotide sequence encoding the human NADH ubiquinone oxidoreductase 14 of the present invention can be obtained by various methods.
  • polynucleotides are isolated using hybridization techniques well known in the art. These technologies include but are not Limitations are: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleotide fragments with common structural characteristics.
  • the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the DM sequence to obtain the double-stranded DNA of the polypeptide.
  • genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences.
  • the standard method for isolating cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library. There are many mature techniques for mRNA extraction. Kits are also commercially available (Qiagene).
  • the construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989).
  • Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
  • genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DNA-RNA hybridization; (2) markers due to the appearance or loss of function; (3) determination of the level of human NADH ubiquinone oxidoreductase 14 transcripts (4) Detecting protein products expressed by genes through immunological techniques or measuring biological activity. The above methods can be used alone or in combination.
  • the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
  • the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
  • the probe used here is generally a DNA sequence chemically synthesized based on the gene sequence information of the present invention.
  • the genes or fragments of the present invention can of course be used as probes.
  • DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
  • the protein product of human NADH ubiquinone oxidoreductase 14 gene expression can be detected by immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA).
  • immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA).
  • a method using DNA technology to amplify DNA / RNA is preferably used to obtain the gene of the present invention.
  • the RACE method RACE-rapid amplification of cDNA ends
  • the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Select and synthesize using conventional methods.
  • the amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
  • polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, sequencing must be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
  • the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using human NADH ubiquinone oxidoreductase 14 coding sequence, and the recombinant technology to produce the polypeptide of the present invention Methods.
  • a polynucleotide sequence encoding human NADH ubiquinone oxidoreductase 14 can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
  • vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
  • Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, eta l.
  • any plasmid and vector can be used to construct a recombinant expression vector.
  • An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
  • Methods known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding human NADH ubiquinone oxidoreductase 14 and appropriate transcription / translation regulatory elements. These methods include in vitro recombination DM technology, DNA synthesis technology, in vivo recombination technology, etc. (Sambroook, et al. Mol ecular Cl oning, a Labora tory Manua, cold Harbor Labora tory. New York, 1989).
  • the DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis. Representative examples of these promoters are: the l ac or trp promoter of E.
  • the expression vector also includes a ribosome binding site for translation initiation and a transcription terminator. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers from 100. to 270 base pairs on the late side of the replication initiation point, polyoma enhancers and adenovirus enhancers on the late side of the replication initiation point.
  • the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance for eukaryotic cell culture. And green fluorescent protein (GFP), or tetracycline or ampicillin resistance for E. coli. It is clear to those skilled in the art how to select the appropriate vector / transcription control element (such as promoter, enhancer, etc.) and selectable marker gene.
  • selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance for eukaryotic cell culture. And green fluorescent protein (GFP), or tetracycline or ampicillin resistance for E. coli.
  • a polynucleotide encoding human NADH ubiquinone oxidoreductase 14 or a recombinant vector containing the polynucleotide can be transformed or introduced into a host cell to form a genetically engineered host cell containing the polynucleotide or the recombinant vector.
  • the term "host cell” refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E.
  • coli Streptomyces
  • bacterial cells such as Salmonella typhimurium
  • fungal cells such as yeast
  • plant cells insect cells
  • fly S2 or Sf 9 animal cells
  • animal cells such as CH0, COS or Bowes melanoma 'cells, etc.
  • Transformation of a host cell with a DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art.
  • the host is a prokaryote such as E. coli
  • competent cells capable of DNA uptake can be in the exponential growth phase were harvested, treated with CaC l 2 method used in steps well known in the art. The alternative is to use MgC l 2 .
  • transformation can also be performed by electroporation.
  • the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
  • the polynucleotide sequence of the present invention can be used to express or produce recombinant human NADH ubiquinone oxidoreductase 14 (Scence, 1984; 224: 1431). Generally there are the following steps:
  • the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
  • a suitable method such as temperature conversion or chemical induction
  • the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell.
  • recombinant proteins can be isolated and purified by various separation methods using their physical, chemical, and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
  • conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromat
  • Fig. 1 is a comparison diagram of amino acid sequence homology between the NADH ubiquinone oxidoreductase 14 and human NADH ubiquinone oxidoreductase of the present invention.
  • the upper sequence is human NADH ubiquinone oxidoreductase 14
  • the lower sequence is human NADH ubiquinone oxidoreductase.
  • Identical amino acids are represented by single-character amino acids between the two sequences, and similar amino acids are represented by "+”.
  • Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of human NADH ubiquinone oxidoreductase 14 isolated. 14kDa is the molecular weight of the protein. The arrow indicates the isolated protein band. The best way to implement the invention
  • Total human fetal brain RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform.
  • Poly (A) mRNA was isolated from total RNA using Quik mRNA Isolat ion Kit (product of Qiegene). 2ug poly (A) mRNA is reverse transcribed to form cDNA.
  • the Smart cDNA cloning kit purchased from Clontech was used to insert the cDNA fragment into the multicloning site of pBSK (+) vector (Clontech) to transform DH5 ⁇ . The bacteria formed a cDNA library.
  • the sequences at the 5 'and 3' ends of all clones were determined using Dye terminate cycle reaction ion sequencing ldt (product of Perkin-Elmer) and ABI 377 automatic sequencer (Perkin-Elmer).
  • the determined cDNA sequence was compared with the existing public DM sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 2592d04 was new DNA.
  • a series of primers were synthesized to determine the inserted cDNA fragments of the clone in both directions.
  • the sequence of the human MDH ubiquinone oxidoreductase 14 of the present invention and the protein sequence encoded by the same are used by the Blas t process Sequence (Basiclocal Alignment search tool) [Altschul, SF et al. J. Mol. Biol. 1990; 215: 403-10], homology search was performed in databases such as Genbank and Swissport.
  • the gene with the highest homology to the human NADH ubiquinone oxidoreductase 14 of the present invention is a known human MDH ubiquinone oxidoreductase, and its encoded protein has the accession number P 39081 in Genbank.
  • the protein homology results are shown in Figure 1. The two are highly homologous, with 95% identity; 96% similarity.
  • Example 3 Cloning of a gene encoding human NADH ubiquinone oxidoreductase 14 by RT-PCR
  • CDNA was synthesized using fetal brain total RNA as a template and oligo-dT as a primer.
  • PCR amplification was performed with the following primers:
  • Primerl 5'- GGGTGCGCCCGCTGTCACCGCCAT -V (SEQ ID NO: 3)
  • Primer2 5'- CATATGCCGAGGCGGCCGACATGT -3 '(SEQ ID NO: 4)
  • Priraerl is a forward sequence starting at the lbp of the 5th end of SEQ ID NO: 1;
  • Primer 2 is the 3 'terminal reverse sequence of SEQ ID NO: 1.
  • Conditions for the amplification reaction 50 mmol / L KC1, 10 mmol / L Tris-CI, (pH 8.5), 1.5 mmol / L MgCl 2 , 200 ⁇ mol / L dNTP, lOpmol primers in a 50 ⁇ 1 reaction volume, 1U of Taq DNA polymerase (Clontech).
  • the reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) for 25 cycles under the following conditions: 94 ° C 30sec; 55 ° C 30sec; 72. C 2min.
  • ⁇ -actin was set as a positive control and template blank was set as a negative control.
  • the amplified product was purified using a QIAGEN kit and ligated to a pCR vector (Invitrogen product) using a TA cloning kit.
  • the DNA sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as that of 1-1083bp shown in SEQ ID NO: 1.
  • Example 4 Northern blot analysis of human MDH ubiquinone oxidoreductase 14 gene expression:
  • RNA extraction in one step [Anal. Biochem 1987, 162, 156-159] 0
  • This method involves acid guanidinium thiocyanate-chloroform extraction. That is, the tissue was homogenized with 4M guanidinium isothiocyanate-25mM sodium citrate, 0.2M sodium acetate ( ⁇ 4.00), and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1), centrifuge after mixing. The aqueous layer was aspirated, isopropanol (0.8 vol) was added and the mixture was centrifuged to obtain RM precipitate. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water.
  • RNA containing 20mM 3- (N- morpholino) propanesulfonic acid (pH7.0) - electrophoresed on 1 IraM EDTA- 2.2M formaldehyde, 2% agarose gel - 5mM sodium acetate. It was then transferred to a nitrocellulose membrane. A- 32 P dATP was used to prepare 32 P-labeled DNA probes by random primers. The DNA probe used was the PCR amplified human NADH ubiquinone oxidoreductase 14 coding region sequence (23bp to 412bp) shown in FIG. 1.
  • 32P-labeled probes (approximately 2 x 10 6 cpm / ml) were hybridized with a nitrocellulose membrane to which RNA was transferred at 42 ° C overnight in a solution containing 50% formamide-25mM H 2 P0 4 (pH7.4) -5 x SSC- 5 x Denhardt's solution and 200 ⁇ g / ml salmon sperm DNA. After hybridization, the filter was placed at 1 x SSC-0.1 ° /. Wash in SDS at 55 ° C for 30 min. Then, Phosphor Imager was used for analysis and quantification.
  • Example 5 In vitro expression, isolation and purification of recombinant human NADH ubiquinone oxidoreductase 14
  • Primer3 5 '-CATGCTAGCATGGCTGCCCCGTGTTTGCTGCGG-3' (Seq ID No: 5)
  • Primer4 5'-CATGGATCCTCAGTGTCGAGGTGACTCCCGGCC-3 '(Seq ID No: 6)
  • the 5' ends of these two primers contain Nhel and BamHI restriction sites, respectively.
  • the coding sequences of the 5 'and 3' ends of the gene of interest are followed, respectively.
  • the Nhel and BamHI restriction sites correspond to the selectivity within the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865.3). Digestion site.
  • the pBS-2592d04 plasmid containing the full-length target gene was used as a template for the PCR reaction.
  • the PCR reaction conditions were as follows: a total volume of 50 ⁇ l containing 10 pg of pBS-2592d04 plasmid, 3i Primer-3 Primer-4; ⁇ ! ⁇ 10 pmol, Advantage polymerase Mix (Clontech) 1 ⁇ 1. Cycle parameters: 94. C 20s, 60 ° C 30s, 68. C 2 min, a total of 25 cycles. Nhel and BamHI were used to double-digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase.
  • the ligation product was transformed into E. coli DH5a by the calcium chloride method, and cultured on LB plates containing kanamycin (final concentration 30 ⁇ ⁇ / ⁇ 1) overnight. Positive clones were selected by colony PCR method and sequenced. A positive clone (pET-2592d04) with the correct sequence was selected, and the recombinant plasmid was transformed into E. coli BL21 (DE3) plySs (product of Novagen) using the calcium chloride method.
  • the host bacteria BL21 (pET-2592d04) was cultured at 37 ° C to the logarithmic growth phase, and IPTG was added to a final concentration of 1 mmol / L, Continue incubation for 5 hours. The bacteria were collected by centrifugation, and the supernatant was collected by centrifugation. The supernatant was collected by centrifugation. The affinity chromatography column His. Bind Quick Cartridge (product of Novagen) was used for chromatography to obtain 6 histidine (6His-Tag). The purified protein NADH ubiquinone oxidoreductase 14 was purified.
  • the polypeptide is coupled with hemocyanin and bovine serum albumin to form a complex, respectively.
  • hemocyanin and bovine serum albumin For methods see: Avrameas, et al. Immmiochemi s try, 1969; 6:43. Rabbits were immunized with 4 mg of the hemocyanin polypeptide complex plus complete Freund's adjuvant, and 15 days later, the hemocyanin polypeptide complex plus incomplete Freund's adjuvant was used to boost immunity once.
  • a titer plate coated with a 15 g / tnl bovine serum albumin polypeptide complex was used as an ELISA to determine antibody titers in rabbit serum.
  • Total IgG was isolated from antibody-positive rabbit serum using protein A-Sepharose.
  • the peptide was bound to a cyanogen bromide-activated Sepharos B column and anti-peptide antibodies were separated from the total IgG by affinity chromatography.
  • the immunoprecipitation method proved that the purified antibody could specifically bind to human MDH ubiquinone oxidoreductase 14.
  • Example 7 Use of a polynucleotide fragment of the present invention as a hybridization probe
  • Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
  • the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
  • the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
  • the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method.
  • Filter hybridization methods include dot blotting, Southern imprinting, Northern blotting, and copying methods. They all use the same steps to immobilize the polynucleotide sample to be tested on the filter.
  • the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer to saturate the non-specific binding site of the sample on the filter with the carrier and the synthesized polymer.
  • the pre-hybridization solution is then replaced with a hybridization buffer containing labeled probes and incubated to hybridize the probes to the target nucleic acid.
  • the unhybridized probes are removed by a series of membrane washing steps.
  • This embodiment uses higher-intensity washing conditions (such as lower salt concentration and higher temperature), so that the hybridization background is reduced and only strong specific signals are retained.
  • the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention Polynucleotide SBQ ID NO: 1 Identical or complementary oligonucleotide fragment.
  • the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
  • oligonucleotide fragments from the polynucleotide SEQ ID NO: 1 of the present invention for use as hybridization probes should follow the following principles and several aspects to be considered:
  • the preferred range of probe size is 18-50 nucleotides; 2, GC content is 30% -70%, non-specific hybridization increases when it exceeds;
  • Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements The regions are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, the primary probe should not be used;
  • Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
  • Probe 1 which belongs to the second type of probe, is equivalent to the replacement mutant sequence of the gene fragment of SEQ ID NO: 1 or its complementary fragment (41Nt):
  • PBS phosphate buffered saline
  • step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
  • NC membranes nitrocellulose membranes
  • Two NC membranes are required for each probe for subsequent experiments.
  • the film is washed with high-strength conditions and strength conditions, respectively.
  • the 32 P-Probe (the second peak is free ⁇ - 32 P-dATP) is prepared after the collection solutions of the first peak are combined.
  • probe 1 can be used to qualitatively and quantitatively analyze the presence and differential expression of the polynucleotide of the present invention in different tissues.
  • polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat malignant tumors, adrenal deficiency, skin diseases, various inflammations, HIV infections and immune diseases.
  • NADH ubiquinone oxidoreductase is an internal mitochondrial membrane-bound multi-subunit enzyme complex. Its function is to catalyze the sensitive oxidation of NADH rotenone and the reduction of ubiquinone.
  • the hydrophilic portion of the complex consists of a flavin protein portion and a ferritin portion.
  • the human gene encoding the flavin protein subunit of complex I is named NDUFV3 gene, which is located on chromosome 21q22.3. A defect in this gene will cause Down's syndrome and is related to the deterioration of dementia. Down syndrome, also known as trisomy 21, is one of the most common autosomal diseases.
  • the polypeptide of the present invention and human NADH ubiquinone oxidoreductase are human NADH ubiquinone oxidoreductases, which contain characteristic sequences of the human NADH ubiquinone oxidoreductase family. Both have similar biological functions. It catalyzes the sensitive oxidation of NADH rotenone and reduction of ubiquinone in the body, and its abnormal expression is usually closely related to the occurrence of some related disorders of substance metabolism, disorders of protein metabolism and related tissue tumors and cancers, and produces Related diseases are especially Trisomy 21, Dementia.
  • the abnormal expression of the human NADH ubiquinone oxidoreductase 14 in the present invention will produce various diseases, especially 21-trisomy syndrome, dementia, material metabolism disorders, tumors, development disorders, inflammation, and immunity.
  • Diseases including but not limited to:
  • Material metabolism disorders isovalerate, propionate, methylmalonic aciduria, combined carboxylase deficiency, glutarate type I, phenylketonuria, metabolic deficiency of the urea cycle, Mucolipid storage disease, Ray-niney syndrome, galactosemia, fructose metabolism deficiency, glycogen storage disease
  • Tumors of various tissues gastric cancer, liver cancer, lung cancer, esophageal cancer, breast cancer, leukemia, lymphoma, thyroid tumors, uterine fibroids, astrocytoma, ependymoma, glioblastoma, neurofibromas, colon Cancer, endometrial cancer, colon cancer, thymic tumor, tracheal tumor, fibroid, fibrosarcoma
  • Developmental disorders congenital abortion, cleft palate, lack of limbs, limb differentiation disorders, atrial septal defect, neural tube defects, congenital hydrocephalus, mental retardation, brain development disorders, skin, fat and muscular dysplasia, Bone and joint dysplasia, various metabolic defects, sexual retardation inflammation: chronic active hepatitis, sarcoidosis, polymyositis, chronic rhinitis, chronic gastritis, cerebral spinal cord Multiple sclerosis, Glomerulonephritis, Myocarditis, Cardiomyopathy, Atherosclerosis, Gastric ulcer, Cervicitis, Various infectious inflammations
  • Immune diseases Systemic lupus erythematosus, rheumatoid arthritis, bronchial asthma, urticaria, specific dermatitis, post-infection myocarditis, scleroderma, myasthenia gravis, Guillain-Barre syndrome, common variable immunodeficiency disease , Primary B-lymphocyte immunodeficiency disease, Acquired immunodeficiency syndrome
  • Abnormal expression of the human NADH ubiquinone oxidoreductase 14 of the present invention will also produce certain heredity, blood diseases and the like.
  • the polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat various diseases, especially 21-trisomy syndrome, dementia, substance metabolism disorder, tumor, development Disorders, inflammation, immune diseases, certain hereditary, blood diseases, etc.
  • the invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) human MDH ubiquinone oxidoreductase 14.
  • Agonists enhance human MDH ubiquinone oxidoreductase 14 to stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
  • mammalian cells or a membrane preparation expressing human NADH ubiquinone oxidoreductase 14 can be cultured with labeled human NADH ubiquinone oxidoreductase 14 in the presence of a drug. The ability of the drug to increase or block this interaction is then determined.
  • Antagonists of human NADH ubiquinone oxidoreductase 14 include antibodies, compounds, receptor deletions, and the like that have been screened. Antagonists of human NADH ubiquinone oxidoreductase 14 can bind to human NADH ubiquinone oxidoreductase 14 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot function biological functions.
  • human MDH ubiquinone oxidoreductase 14 can be added to the bioanalytical assay, and the compound can be determined by measuring the effect of the compound on the interaction between human NADH ubiquinone oxidoreductase 14 and its receptor. Whether it is an antagonist.
  • Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds.
  • Polypeptide molecules capable of binding to human NADH ubiquinone oxidoreductase 14 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. In screening, human NADH ubiquinone oxidoreductase 14 molecules should generally be labeled.
  • the present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies.
  • the invention also provides antibodies against human NADH ubiquinone oxidoreductase 14 epitopes. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by Fab expression libraries.
  • Polyclonal antibodies can be produced by immunizing animals with human NADH ubiquinone oxidoreductase 14 (eg Rabbit, mouse, rat, etc.), a variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's adjuvant.
  • Techniques for preparing monoclonal antibodies to human MDH ubiquinone oxidoreductase 14 include, but are not limited to, hybridoma technology (Kohl er and Miste in. Nature, 1975, 256: 495-497), triple tumor technology, human beta- Cell hybridoma technology, EBV-hybridoma technology, etc.
  • Antibodies against human NADH ubiquinone oxidoreductase 14 can be used in immunohistochemical techniques to detect human NADH ubiquinone oxidoreductase 14 in biopsy specimens. '
  • Monoclonal antibodies that bind to human NADH ubiquinone oxidoreductase 14 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
  • Antibodies can also be used to design immunotoxins that target a particular part of the body.
  • human NADH ubiquinone oxidoreductase 14 high affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
  • a common method is to attack the amino group of the antibody with a thiol crosslinker such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
  • This hybrid antibody can be used to kill human NADH ubiquinone redoxase 14 positive Cell.
  • the antibodies of the present invention can be used to treat or prevent diseases related to human NADH ubiquinone oxidoreductase 14.
  • Administration of appropriate doses of antibodies can stimulate or block the production or activity of human NADH ubiquinone oxidoreductase 14.
  • the invention also relates to a diagnostic test method for quantitative and localized detection of human NADH ubiquinone oxidoreductase 14 levels.
  • tests are well known in the art and include FI SH assays and radioimmunoassays.
  • the level of human NADH ubiquinone oxidoreductase 14 detected in the test can be used to explain the importance of human NADH ubiquinone oxidoreductase 14 in various diseases and to diagnose the role of human NADH ubiquinone oxidoreductase 14 disease.
  • polypeptide of the present invention can also be used for peptide mapping analysis.
  • the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
  • the polynucleotide encoding human NADH ubiquinone oxidoreductase 14 can also be used for a variety of therapeutic purposes.
  • Gene therapy technology can be used to treat abnormal cell proliferation, development, or metabolism caused by the non-expression or abnormal / inactive expression of human NADH ubiquinone oxidoreductase 14.
  • Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated human NADH ubiquinone oxidoreductase 14 to inhibit endogenous human NADH ubiquinone oxygen Reductase 14 activity.
  • a mutated human NADH ubiquinone oxidoreductase 14 may be a shortened human NADH ubiquinone oxidoreductase 14 lacking a signaling function domain, and although it can bind to a downstream substrate, it lacks signaling activity. Therefore, the recombinant gene therapy vector can be used to treat diseases caused by abnormal expression or activity of human NADH ubiquinone oxidoreductase 14.
  • Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus and the like can be used to transfer a polynucleotide encoding human NADH ubiquinone oxidoreductase 14 into cells.
  • Methods for constructing a recombinant viral vector carrying a polynucleotide encoding human NADH ubiquinone oxidoreductase 14 can be found in the literature (Sambrook, etal.).
  • a recombinant polynucleotide encoding human NADH ubiquinone oxidoreductase 14 can be packaged into liposomes and transferred into cells.
  • Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
  • a vector such as a virus, phage, or plasmid
  • Oligonucleotides including antisense RNA and DM
  • ribozymes that inhibit human NADH ubiquinone oxidoreductase 14 mRNA are also within the scope of the present invention.
  • a ribozyme is an enzyme-like RNA molecule that specifically decomposes specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation.
  • Antisense RNA, DNA, and ribozymes can be obtained using any existing RNA or DNA synthesis technology, such as solid-phase phosphoramidite chemical synthesis to synthesize oligonucleotides.
  • Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA. This DNA sequence is integrated downstream of the RM polymerase promoter of the vector. In order to increase the stability of the nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the linkage between ribonucleosides using phosphate thioester or peptide bonds instead of phosphodiester bonds.
  • the polynucleotide encoding human NADH ubiquinone oxidoreductase 14 can be used for the diagnosis of diseases related to human NADH ubiquinone oxidoreductase 14.
  • the polynucleotide encoding human NADH ubiquinone oxidoreductase 14 can be used to detect the expression of human NADH ubiquinone oxidoreductase 14 or abnormal expression of human NADH ubiquinone oxidoreductase 14 in a disease state.
  • a DNA sequence encoding human 'NADH ubiquinone oxidoreductase 14 can be used to hybridize biopsy specimens to determine the expression of human NADH ubiquinone oxidoreductase 14.
  • Hybridization techniques include Sout hern blotting, Nor thern blotting, and in situ hybridization. These techniques and methods are publicly available and mature, and related kits are commercially available.
  • a part or all of the polynucleotides of the present invention can be used as probes to be fixed on a microarray (Microar ray) or a DNA chip (also known as a "gene chip") for analyzing differential expression analysis of genes in tissues and genes. diagnosis.
  • Human NADH ubiquinone oxidoreductase 14 specific primers can be used for RNA-polymerase chain reaction (RT-PCR) in vitro amplification to detect human NADH ubiquinone oxidoreductase 14 transcription products. Detection of mutations in the human MDH ubiquinone oxidoreductase 14 gene can also be used to diagnose human NADH ubiquinone oxidoreductase 14-related diseases. Human NADH ubiquinone oxidoreductase 14 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type human NADH ubiquinone oxidoreductase 14 DNA sequence.
  • Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression. Therefore, the Nor thern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
  • the sequences of the invention are also valuable for chromosome identification.
  • the sequence specifically targets a specific position on a human chromosome and can hybridize to it. At present, the specific loci on the chromosomes need to be identified.
  • an important first step is to locate these DNA sequences on a chromosome.
  • PCR primers (preferably 15-35bp) are prepared based on cDNA, and the sequences can be located on chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
  • PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
  • oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
  • Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.
  • Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step.
  • FISH Fluorescent in situ hybridization
  • the physical location of the sequence on the chromosome can be correlated with the genetic map data. These data can be found in, for example, V. Mckusick, Mendelian Inheritance in Man (available online with Johns Hopkins University Wetch Medical Library). Linkage analysis can then be used to determine the relationship between genes and diseases that have been mapped to chromosomal regions.
  • the differences in cDNA or genomic sequences between the affected and unaffected individuals need to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in the chromosome, such as deletions or translocations that are visible at the chromosomal level or detectable using cDNA sequence-based PCR. Based on the resolution capabilities of current physical mapping and gene mapping technologies, The cDNA of the disease-related chromosomal region can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution and one gene per 20 kb).
  • the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
  • suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
  • the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
  • the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell.
  • the polypeptides of the invention can be used in combination with other therapeutic compounds.
  • the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
  • Human NADH ubiquinone oxidoreductase 14 is administered in an amount effective to treat and / or prevent a specific indication.
  • the amount and range of human MDH ubiquinone oxidoreductase 14 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

L'invention concerne un nouveau polypeptide, une NADH-ubiquinone oxydoréductase humaine 14, et un polynucléotide codant ce polypeptide ainsi qu'un procédé d'obtention de ce polypeptide par des techniques recombinantes d'ADN. L'invention concerne en outre les applications de ce polypeptide dans le traitement de maladies, notamment du syndrome de Down, de la démence, des troubles du métabolisme des substances, des tumeurs, des troubles du développement, des inflammations, des maladies immunitaires, etc. L'invention concerne aussi l'antagoniste agissant contre le polypeptide et son action thérapeutique ainsi que les applications de ce polynucléotide codant la NADH-ubiquinone oxydoréductase humaine 14.
PCT/CN2001/000745 2000-05-19 2001-05-14 Nouveau polypeptide, nadh-ubiquinone oxydoreductase humaine 14, et polynucleotide codant ce polypeptide WO2001088153A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU10030/02A AU1003002A (en) 2000-05-19 2001-05-14 Novel polypeptide...A NADH ubiquinone oxidoreductase 14 and polynucleotide encoding it

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN 00115780 CN1324935A (zh) 2000-05-19 2000-05-19 一种新的多肽——人nadh泛醌氧化还原酶14和编码这种多肽的多核苷酸
CN00115780.9 2000-05-19

Publications (1)

Publication Number Publication Date
WO2001088153A1 true WO2001088153A1 (fr) 2001-11-22

Family

ID=4585223

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2001/000745 WO2001088153A1 (fr) 2000-05-19 2001-05-14 Nouveau polypeptide, nadh-ubiquinone oxydoreductase humaine 14, et polynucleotide codant ce polypeptide

Country Status (3)

Country Link
CN (1) CN1324935A (fr)
AU (1) AU1003002A (fr)
WO (1) WO2001088153A1 (fr)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1997004101A2 (fr) * 1995-07-17 1997-02-06 Fraunhofer-Gesellschaft zur Förderung der angewandten Forschung e.V. Enzyme convenant a l'oxydation des cyclitols et de leurs derives
CN1261104A (zh) * 1999-01-20 2000-07-26 复旦大学 一种人氧化还原酶亚基及其编码序列,以及制法和用途

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1997004101A2 (fr) * 1995-07-17 1997-02-06 Fraunhofer-Gesellschaft zur Förderung der angewandten Forschung e.V. Enzyme convenant a l'oxydation des cyclitols et de leurs derives
CN1261104A (zh) * 1999-01-20 2000-07-26 复旦大学 一种人氧化还原酶亚基及其编码序列,以及制法和用途

Also Published As

Publication number Publication date
CN1324935A (zh) 2001-12-05
AU1003002A (en) 2001-11-26

Similar Documents

Publication Publication Date Title
WO2002026972A1 (fr) Nouveau polypeptide, proteine humaine 20.13 de liaison de l'acide polyadenylique, et polynucleotide codant ce polypeptide
WO2001090169A1 (fr) Nouveau polypeptide, antigene nucleaire de proliferation cellulaire (pcna) 13, et polynucleotide codant ce polypeptide
WO2001098502A1 (fr) Nouveau polypeptide, arginase humaine 9, et polynucleotide codant ce polypeptide
WO2001088153A1 (fr) Nouveau polypeptide, nadh-ubiquinone oxydoreductase humaine 14, et polynucleotide codant ce polypeptide
WO2001055404A1 (fr) Nouveau polypeptide, alcool deshydrogenase humaine 39, et polynucleotide codant pour ce polypeptide
WO2001072790A1 (fr) Nouveau polypeptide, proteine humaine p40 12 de facteur l1, et polynucleotide codant pour ce polypeptide
WO2001064733A1 (fr) Nouveau polypeptide, facteur humain 22 lie a la transcription inverse, et polynucleotide codant pour ce polypeptide
WO2002048356A1 (fr) Nouveau polypeptide, proteine humaine formee de cytochromes 45, et polynucleotide codant ce polypeptide
WO2001048173A1 (fr) Nouveau polypeptide, aminoacyl-arnt synthetase humaine 10, et polynucleotide codant pour ce polypeptide
WO2001055417A1 (fr) Nouveau polypeptide, proteine a f-box 65, et polynucleotide codant pour ce polypeptide
WO2001083776A1 (fr) Nouveau polypeptide, hormone de croissance humaine 11, et polynucleotide codant pour ce polypeptide
WO2001048219A1 (fr) Nouveau polypeptide, proteine de transport phosphorylee 10, et polynucleotide codant pour ce polypeptide
WO2001072787A1 (fr) Nouveau polypeptide, facteur humain 10 induisant l'assemblage des peroxysomes, et polynucleotide codant pour ce polypeptide
WO2001075055A2 (fr) Nouveau polypeptide, quinine reductase humaine 9, et polynucleotide codant pour ce polypeptide
WO2001081593A1 (fr) Nouveau polypeptide, proteine humaine 20 contenant un domaine a structure de boite de paires appariees, et polynucleotide codant pour ce polypeptide
WO2001048002A1 (fr) Nouveau polypeptide, cytochrome b12, et polynucleotide codant pour ce polypeptide
WO2001049853A1 (fr) Phosphoribosyle glycinamide synthase 9 et polynucleotide codant ce polypeptide
WO2001048001A1 (fr) Nouveau polypeptide, quinone-proteine reductase 7, et polynucleotide codant pour ce polypeptide
WO2001074995A2 (fr) Nouveau polypeptide, protéine humaine de mutation 15 de l'ataxie telangiectasie, et de polynucléotide codant pour ce polypeptide
WO2001074996A2 (fr) Nouveau polypeptide, c. elegans 52 humain, et polynucléotide codant pour ce polypeptide
WO2001075024A2 (fr) Nouveau polypeptide, facteur humain 13 associe a nf-e2, et polynucleotide codant pour ce polypeptide
WO2001072795A1 (fr) Nouveau polypeptide, quinine reductase humaine 16, et polynucleotide codant pour ce polypeptide
WO2001081381A1 (fr) Nouveau polypeptide, proteine humaine 9 contenant un fragment de sequence particulier d'une recombinase specifique au site, et polynucleotide codant pour ce polypeptide
WO2001048157A1 (fr) Nouveau polypeptide, adn methylase 13, et polynucleotide codant pour ce polypeptide
WO2001073045A1 (fr) Nouveau polypeptide, quinine reductase humaine 10, et polynucleotide codant pour ce polypeptide

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP