WO2000028079A2 - Variation genetique associee a l'anemie aplasique, et applications diagnostiques et therapeutiques basees sur cette variation - Google Patents

Variation genetique associee a l'anemie aplasique, et applications diagnostiques et therapeutiques basees sur cette variation Download PDF

Info

Publication number
WO2000028079A2
WO2000028079A2 PCT/IB1999/001794 IB9901794W WO0028079A2 WO 2000028079 A2 WO2000028079 A2 WO 2000028079A2 IB 9901794 W IB9901794 W IB 9901794W WO 0028079 A2 WO0028079 A2 WO 0028079A2
Authority
WO
WIPO (PCT)
Prior art keywords
rps
gene
mutation
amino acid
exon
Prior art date
Application number
PCT/IB1999/001794
Other languages
English (en)
Other versions
WO2000028079A3 (fr
Inventor
Niklas Dahl
Peter Gustavsson
Natalia Draptchinskaia
Original Assignee
Gemini Genomics Ab
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Gemini Genomics Ab filed Critical Gemini Genomics Ab
Priority to AU64834/99A priority Critical patent/AU6483499A/en
Publication of WO2000028079A2 publication Critical patent/WO2000028079A2/fr
Publication of WO2000028079A3 publication Critical patent/WO2000028079A3/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/172—Haplotypes

Definitions

  • the present invention relates to identification of a protein that is rendered non-functional in an aplastic anemia.
  • the invention concerns mutations that disrupt a ribosomal protein (RP), preferably RP SI 9, in
  • DBA Diamond-Blackfan Anemia
  • Diamond-Blackfan Anemia (DBA; McKusick #205900) is characterized by a chronic constitutional degenerative anemia with absent or decreased red cell precursors in the bone marrow but otherwise normal cellularity (Diamond, et al, Am. J. Dis. Child, 56:464-467, 1938; Alter, et al, Am. J. Pediat. Hernat. Oncol., 2: 121-139, 1980; Halperin and Freedman, Am. J. Pediatr. Hematol. Oncol., 11 -380-394, 1980; Young and Alter, Aplastic Anemia: Acquired and Inherited, W.B. Saunders, Philadelphia, 1994).
  • DBA has been classified as a variant of aplastic anemia. Most patients present with anemia in the neonatal period or in infancy. Approximately 30% of affected children present with a variety of associated physical anomalies. Thumb and upper limb abnormalities are present in 10-20% of patients, ranging in severity from flat thenar eminence to triphalangeal thumb and absent radii (Aase, et al, J. Pediatr. 74(3):471-474, 1969). Craniofacial abnormalities are common, with cleft or high arched palate, hypertelorism and flat nasal bridge (Cathie, Arch. Dis. Child, 25:313-324, 1950).
  • the IL-9 gene plays no role statistically in DBA; markers spanning the chromosome 5q31.1-133.2 exclude this region as playing an active role in DBA (Dianzani et al, Exp. Hematology, 25 : 1270- 1277, 1997).
  • the combined findings have led to the consensus of an intrinsic defect in erythroid differentiation as the likely pathogenic mechanism (Dianzani et al, Exp. Hematology, 25:1270-1277, 1997; Willig et al, Blood, In Press, 1998). This is supported by the observations that CD34+ cells from patients with DBA fail to undergo erythroid maturation in vitro (Bagnara et al, Blood, 1;78(9):2203-2210, 1991).
  • the present invention represents a significant step forward in understanding and treating aplastic or hypoproliferative anemias.
  • DBA the tools for studying the molecular biology of aplastic anemia are made available.
  • identification of this protein, and the genetic polymorphisms or variations that lead to its functional inactivation provides strategies for overcoming these defects. These strategies can be used broadly to affect any aplastic anemia or hypoproliferative disorder, as well as for treating DBA itself.
  • the invention provides a gene encoding ribosomal protein S19 (SEQ ID NOS:l and 2) which is defective in the expression of the functional protein.
  • the invention provides a mutant RPS 19 protein.
  • the invention provides methods for detecting a genetic mutation associated with an aplastic or hypoplastic anemia in a mammal comprising detecting a polymorphism or variation in a gene for RPS 19 which results in a defect in expression of the functional RPS19.
  • the invention provides a method for diagnosing an aplastic or hypoplastic anemia comprising detecting such a mutation.
  • the invention provides a method for predicting the likelihood of developing DBA.
  • the invention provides a kit for detecting a mutation in the gene encoding for RPS 19 which results in a defect in expression of functional RPS 19, using an ohgonucleotide that specifically hybridizes to the site of the mutation or to an adjacent site on the gene.
  • Another embodiment of the invention provides a method for detecting an intracellular macromolecule that is associated with DBA.
  • Still another embodiment of the invention provides vectors that express functional human RPS 19 in human target cells and a method of treating an aplastic or hypoplastic anemia associated with such a defect by administering the vector into cells (such as bone marrow cells) of the subject.
  • Pharmaceutical compositions comprising the vector are also provided.
  • the invention provides a method of screening for candidate compounds that modulate activity of RPS 19, by detecting binding of RPS 19 with a compound and isolating the compound.
  • kits comprising an RPS 19 polypeptide and a binding detector that indicates RPS 19 binding with a compound for screening for a candidate compound that modulates the activity of RPS19.
  • the invention further provides vectors that contain mutant RPS 19 and methods for treating hyperproliferative disorders derived from hematopoietic cells in a subject by inhibiting the functional activity of RPS 19, or by administering a vector that expresses non- functional variants of RPS 19 in cells of the subject.
  • FIGS. 1A, IB, and IC show three multiplex DBA families with haplotypes spanning the candidate gene locus on chromosome 19ql3.2.
  • the DNA marker loci are shown to the left (A) with a relative marker order from the centromere (top) to the telomere (bottom).
  • the corresponding marker alleles and haplotypes are boxed and indicated below each symbol. In each kindred no common haplotype was inherited by affected relatives, thereby indicating genetic heterogeneity.
  • An asterisk (*) indicates deduced haplotypes. Closed symbols denote affected individuals; open symbols denote healthy individuals. Circles denote females; squares denote males.
  • Figures 2 A, 2B, 2C, 2D, and 2E show segregation of 19q marker alleles in families with dominantly inherited DBA. Apparently healthy family members (open symbols) have inherited the disease associated chromosome 19q haplotype in each of the five different families, which suggests incomplete penetrance or locus heterogeneity.
  • the activity of erythrocyte adenosine deaminase (ADA) was measured in families V, VI and VII. An increased ADA level was found in one healthy sibling (family V, ind. 11:2). Normal ADA levels were found in healthy siblings of families VI (ind. 11:1) and VIII (ind. 11:3).
  • Figures 3 A, 3B, and 3C show identification of microdeletions in the
  • Figure 4A and 4B represent a continuous physical map of part of the 19ql3.2 region (top) including known markers and genes based on a previously presented physical map (Ashworth et al, Nat. Genet. 11 :422-427, 1995).
  • An asterisk (*) indicates transcribed genes in the critical interval. The extent of the three microdeletions are shown for three patients. Horizontal bars represent chromosome regions present in each of the three patients. The deleted regions in each patient are indicated by an intervening line, respectively.
  • the critical DBA gene region, deletion of which results in inactivation of the protein, is indicated by a two-headed arrow and restricted by cosmids 16767 and 19343.
  • Figure 5 is a Southern blot analysis with hybridization of probes X and Y (exon 3 and exon 4 from the RPS 19 gene) to EcoRI digests of DNA from the t(X;19) and two controls.
  • the arrows on the right are molecular weight markers.
  • Figure 6 is a schematic map of the structure of the human RPS 19 gene region.
  • the exons are indicated by boxes and filled boxes denote coding sequences.
  • the ATG translation start site
  • the ATG is located in the immediate beginning of exon 2.
  • Figure 7 shows tissue distribution of RPS 19 mRNA as detected by Northern analysis. RPS29 mRNA was detected for comparison.
  • Figure 8A, 8B, and 8C show segregation ⁇ RPS19 mutations in families. Restriction fragment length polymorphisms (RFLPs) were analyzed in genomic PCR DNA fragments.
  • RFLPs Restriction fragment length polymorphisms
  • B Family F04 segregating for a missense mutation (C 184T). The mutation results in loss of an RstUI site which is detected as a second upper band after the separation of digested PCR products from genomic DNA using primers RP3 and RP4.
  • the missense mutation (C184T) which has occurred de novo in a sporadic case of family S05.
  • the (upper) band in the proband of the affected sibling indicate the mutant allele.
  • the mutation was neither found in the parents nor in the two healthy siblings who share the probands genotype
  • Figure 9 A and 9B are a sequence comparison of human RPS 19 (SEQ ID NO:3) with homologous proteins from rat (R. novegicus) (SEQ ID NO:4), mouse (M. musculus) (SEQ ID NO:5), fruit fly (D. melanogaster) (SEQ ID NO:6), yeast (S. cerevisiae S19A and S. cerevisiae S19B) (SEQ ID NOS:7 and 8), and a bacterium (M. yannaschii) (SEQ ID NO:9).
  • the present invention is based, in part, on the discovery that ribosomal protein S19 (RPS 19) is mutated in Diamond-Blackfan Anemia (DBA), a type of erythroblastopenia with absence or decreased number of cells in the erythroid lineage.
  • DBA Diamond-Blackfan Anemia
  • a number of different types of mutations within this gene including chromosomal translocation, microdeletion, insertion, nonsense mutations, missense mutations, and splice acceptor site mutations are associated with DBA.
  • the present invention advantageously provides oligonucleotides specific for mutations of the gene encoding RPS 19, including both probes for directly detecting mutated sequences and PCR primers for amplifying sites where such mutations are found to occur.
  • RPS 19, including mutant forms of RPS 19, can be expressed in eukaryotic and prokaryotic cells and can be used to develop and/or implement high throughput screens to identify novel agonists and antagonists of RPS 19 activity, such as ribosomal function.
  • RPS 19 refers to an RPS 19 that functions in a cell, e.g., plays a role as a structural protein of the small ribosomal subunit.
  • Evidence of RPS19 function can be detected by various methods, e.g., by detecting a defect in a hematopoietic cell that results in an anemia.
  • Other RPS 19 functions include, but are not limited to, binding with RPS19-specific antibodies; association with ribosomes or with ribosomal components; and interaction with binding partners, e.g., found in the cytoplasm.
  • a “defect in expression of functional RPS 19” refers to an alteration in the sequence of a genomic RPS 19 gene (also termed herein a “mutation”) that causes failure of expression of RPS 19 or that causes expression of an RPS 19 protein or polypeptide that is non-functional Preferably such non-functionality is reflected in defects of hematoporetic cells that manifest as aplastic or hypoplastic anemia.
  • a non- functional RPS 19 protein or polypeptide is termed herein a "mutant RPS 19 protein”.
  • aplastic anemia and “hypoplastic anemia” each refer to a failure of the bone marrow to produce normal amounts of red blood cells.
  • aplastic. anemia refers to an anemia that results from diminished numbers of erythrocyte progenitor cells and the term “hypoplastic anemia” refers to an anemia that results from insufficient differentiation of progenitor cells into erythrocytes.
  • hyperproliferative disorders refers to an excessive production of bone marrow derived cells, which require frequent removal. It also refers to forms of cancer that result in overproduction of blood cells such as acute myeloid leukemia (AML) and chronic myeloproliferative disorders.
  • hyperproliferative disorders refers to any hyperplastic state that leads to overproduction of blood cells, including leukemias (e.g., AML, FAB subgroup M0- M7), chronic myeloproliferative disorders (e.g., polycytemia vera) and lymphomas.
  • Such conditions can be treated by gene therapy with a mutant form of RPS 19 by disrupting endogenous expression of RPS 19, by using antisense technology to suppress expression or translation of RPS 19, or by the modification of RPS 19 function by interacting molecules (inhibitors).
  • an RPS 19 inhibitor is a molecule that reduces RPS 19 function.
  • the term “about” or “approximately” means within 20%, preferably within 10%, and more preferably within 5% of a given value or range.
  • an isolated nucleic acid means that the referenced material is removed from the environment in which it is normally found.
  • an isolated biological material can be free of cellular components, i.e., components of the cells in which the material is found or produced.
  • an isolated nucleic acid includes a PCR product, an isolated mRNA, a cDNA, or a restriction fragment.
  • an isolated nucleic acid is preferably excised from the chromosome in which it may be found, and more preferably is no longer joined to non-regulatory, non-coding regions, or to other genes, located upstream or downstream of the gene contained by the isolated nucleic acid molecule when found in the chromosome.
  • the isolated nucleic acid lacks one or more introns.
  • Isolated nucleic acid molecules include sequences inserted into plasmids, cosmids, artificial chromosomes, and the like.
  • a recombinant nucleic acid is an isolated nucleic acid.
  • An isolated protein may be associated with other proteins or nucleic acids, or both, with which it associates in the cell, or with cellular membranes if it is a membrane-associated protein.
  • An isolated organelle, cell, or tissue is removed from the anatomical site in which it is found in an organism.
  • An isolated material may be, but need not be, purified.
  • purified refers to material that has been isolated under conditions that reduce or eliminate the presence of unrelated materials, i.e., contaminants, including native materials from which the material is obtained.
  • a purified protein is preferably substantially free of other proteins or nucleic acids with which it is associated in a cell; a purified nucleic acid molecule is preferably substantially free of proteins or other unrelated nucleic acid molecules with which it can be found within a cell.
  • substantially free is used operationally, in the context of analytical testing of the material.
  • purified material substantially free of contaminants is at least 50% pure; more preferably, at least 90% pure, and more preferably still at least 99% pure. Purity can be evaluated by chromatography, gel electrophoresis, immunoassay, composition analysis, biological assay, and other methods known in the art.
  • nucleic acids can be purified by precipitation, chromatography (including preparative solid phase chromatography, ohgonucleotide hybridization, and triple helix chromatography), ultracentrifugation, and other means.
  • Polypeptides and proteins can be purified by various methods including, without limitation, preparative disc-gel electrophoresis, isoelectric focusing, HPLC, reversed-phase HPLC, gel filtration, ion exchange and partition chromatography, precipitation and salting-out chromatography, extraction, and countercurrent distribution.
  • the polypeptide in a recombinant system in which the protein contains an additional sequence tag that facilitates purification, such as, but not limited to, a polyhistidine sequence, or a sequence that specifically binds to an antibody, such as FLAG and GST.
  • the polypeptide can then be purified from a crude lysate of the host cell by chromatography on an appropriate solid-phase matrix.
  • antibodies produced against the protein or against peptides derived therefrom can be used as purification reagents.
  • Cells can be purified by various techniques, including centrifugation, matrix separation (e.g., nylon wool separation), panning and other immunoselection techniques, depletion (e.g., complement depletion of contaminating cells), and cell sorting (e.g., fluorescence activated cell sorting [FACS]). Other purification methods are possible.
  • a purified material may contain less than about 50%, preferably less than about 75%, and most preferably less than about 90%), of the cellular components with which it was originally associated. The "substantially pure" indicates the highest degree of purity which can be achieved using conventional purification techniques known in the art.
  • RPS19 indicates a nucleic acid molecule (e.g., RPS 19, cDNA, gene, etc.); normal text indicates the polypeptide or protein.
  • the present invention contemplates analysis and isolation of a gene encoding a functional or mutant RPS 19, including a full length, or naturally occurring form of RPS 19, and any antigenic fragments thereof from any human source. It further contemplates expression of functional or mutant RPS 19 protein for evaluation, diagnosis, or therapy.
  • PCR polymerase chain reaction
  • “Chemical sequencing” of DNA denotes methods such as that of Maxam and Gilbert (Maxam-Gilbert sequencing, Maxam and Gilbert, Proc. Natl. Acad. Sci. USA, 74:560, 1977), in which DNA is randomly cleaved using individual base-specific reactions.
  • Enzymatic sequencing of DNA denotes methods such as that of Sanger (Sanger et al, 1977, Proc. Natl Acad. Sci. USA, 74:5463, 1977), in which a single-stranded DNA is copied and randomly terminated using DNA polymerase, including variations thereof well-known in the art.
  • SSCP single-strand conformational polymorphism analysis
  • HAT cleavage is defined herein as a method for detecting sequence differences between two DNAs, comprising hybridization of the two species with subsequent mismatch detection by chemical cleavage (Cotton, et al, Proc. Natl Acad. Sci., USA, 85:4397, 1988).
  • DDGE Denaturing gradient gel electrophoresis
  • sequence-specific oligonucleotides refers to related sets of oligonucleotides that can be used to detect allelic variations or mutations in the RRS7P gene.
  • a “probe” refers to a nucleic acid or ohgonucleotide that forms a hybrid structure with a sequence in a target region due to complementarity of at least one sequence in the probe with a sequence in the target protein.
  • nucleic acid molecule refers to the phosphate ester polymeric form of ribonucleosides (adenosine, guanosine, uridine or cytidine; "RNA molecules”) or deoxyribonucleosides (deoxyadenosine, deoxyguanosine, deoxythymidine, or deoxy cytidine; "DNA molecules”), or any phosphoester analogs thereof, such as phosphorothioates and thioesters, in either single stranded form, or a double-stranded helix. Double stranded DNA-DNA, DNA-RNA and RNA-RNA helices are possible.
  • nucleic acid molecule refers only to the primary and secondary structure of the molecule, and does not limit it to any particular tertiary forms.
  • this term includes double-stranded DNA found, inter alia, in linear (e.g., restriction fragments) or circular DNA molecules, plasmids, and chromosomes.
  • sequences may be described herein according to the normal convention of giving only the sequence in the 5' to 3' direction along the nontranscribed strand of DNA (i.e., the strand having a sequence homologous to the mRNA).
  • a "recombinant DNA molecule” is a DNA molecule that has undergone a molecular biological manipulation.
  • a "polynucleotide” or “nucleotide sequence” is a series of nucleotide bases (also called “nucleotides”) in DNA and RNA, and means any chain of two or more nucleotides.
  • a nucleotide sequence typically carries genetic information, including the information used by cellular machinery to make proteins and enzymes. These terms include double or single stranded genomic and cDNA, RNA, any synthetic and genetically manipulated polynucleotide, and both sense and anti-sense polynucleotide (although only sense stands are being represented herein).
  • PNA protein nucleic acids
  • the polynucleotides herein may be flanked by natural regulatory (expression control) sequences, or may be associated with heterologous sequences, including promoters, internal ribosome entry sites (IRES) and other ribosome binding site sequences, enhancers, response elements, suppressors, signal sequences, polyadenylation sequences, introns, 5'- and 3'- non-coding regions, and the like.
  • the nucleic acids may also be modified by many means known in the art.
  • Non-limiting examples of such modifications include methylation, "caps”, substitution of one or more of the naturally occurring nucleotides with an analog, and internucleotide modifications such as, for example, those with uncharged linkages (e.g., methyl phosphonates, phosphotriesters, phosphoroamidates, carbamates, etc.) and with charged linkages (e.g., phosphorothioates, phosphorodithioates, etc.).
  • uncharged linkages e.g., methyl phosphonates, phosphotriesters, phosphoroamidates, carbamates, etc.
  • charged linkages e.g., phosphorothioates, phosphorodithioates, etc.
  • Polynucleotides may contain one or more additional covalently linked moieties, such as, for example, proteins (e.g., nucleases, toxins, antibodies, signal peptides, poly-L-lysine, etc.), intercalators (e.g., acridine, psoralen, etc.), chelators (e.g., metals, radioactive metals, iron, oxidative metals, etc.), and alkylators.
  • the polynucleotides may be derivatized by formation of a methyl or ethyl phosphotriester or an alkyl phosphoramidate linkage.
  • the polynucleotides herein may also be modified with a label capable of providing a detectable signal, either directly or indirectly. Exemplary labels include radioisotopes, fluorescent molecules, biotin, and the like.
  • host cell means any cell of any organism that is selected, modified, transformed, grown, or used or manipulated in any way, for the production of a substance by the cell, for example the expression by the cell of a gene, a DNA or RNA sequence, a protein or an enzyme. Host cells can further be used for screening or other assays, as described infra.
  • Proteins and enzymes are made in the host cell using instructions in DNA and RNA, according to the genetic code.
  • a DNA sequence having instructions for a particular protein or enzyme is "transcribed” into a corresponding sequence of RNA.
  • the RNA sequence in turn is “translated” into the sequence of amino acids which form the protein or enzyme.
  • An “amino acid sequence” is any chain of two or more amino acids. Each amino acid is represented in DNA or RNA by one or more triplets of nucleotides. Each triplet forms a codon, corresponding to an amino acid.
  • the amino acid lysine (Lys) can be coded by the nucleotide triplet or codon AAA or by the codon AAG.
  • the genetic code has some redundancy, also called degeneracy, meaning that most amino acids have more than one corresponding codon.
  • the nucleotides in DNA and RNA sequences are read in groups of three for protein production, it is important to begin reading the sequence at the correct amino acid, so that the correct triplets are read. The way that a nucleotide sequence is grouped into codons is called the "reading frame.”
  • a "coding sequence” or a sequence “encoding” an expression product, such as a RNA, polypeptide, protein, or enzyme is a nucleotide sequence that, when expressed, results in the production of that RNA, polypeptide, protein, or enzyme, i.e., the nucleotide sequence encodes an amino acid sequence for that polypeptide, protein or enzyme.
  • a coding sequence for a protein may include a start codon (usually ATG) and a stop codon.
  • gene also called a "structural gene” means a DNA sequence that codes for or corresponds to a particular sequence of amino acids which comprise all or part of one or more proteins or enzymes, and may or may not include regulatory DNA sequences, such as promoter sequences, which determine for example the conditions under which the gene is expressed. Some genes, which are not structural genes, may be transcribed from DNA to RNA, but are not translated into an amino acid sequence. Other genes may function as regulators of structural genes or as regulators of DNA transcription.
  • a “promoter sequence” is a DNA regulatory region capable of binding RNA polymerase in a cell and initiating transcription of a downstream (3' direction) coding sequence.
  • the promoter sequence is bounded at its 3' terminus by the transcription initiation site and extends upstream (5' direction) to include the minimum number of bases or elements necessary to initiate transcription at levels detectable above background.
  • a transcription initiation site (conveniently defined for example, by mapping with nuclease SI), as well as protein binding domains (consensus sequences) responsible for the binding of RNA polymerase.
  • a coding sequence is "under the control” or “operatively associated with” of transcriptional and translational control sequences in a cell when RNA polymerase transcribes the coding sequence into mRNA, which is then trans-RNA spliced (if it contains introns) and translated into the protein encoded by the coding sequence.
  • the terms "express” and “expression” mean allowing or causing the information in a gene or DNA sequence to become manifest, for example producing a protein by activating the cellular functions involved in transcription and translation of a corresponding gene or DNA sequence.
  • a DNA sequence is expressed in or by a cell to form an "expression product" such as a protein.
  • the expression product itself e.g. the resulting protein, may also be said to be “expressed” by the cell.
  • An expression product can be characterized as intracellular, extracellular or secreted.
  • intracellular means something that is inside a cell.
  • extracellular means something that is outside a cell.
  • a substance is “secreted” by a cell if it appears in significant measure outside the cell, from somewhere on or inside the cell.
  • transfection means the introduction of a foreign nucleic acid into a cell.
  • transformation means the introduction of a "foreign” (i.e. extrinsic or extracellular) gene, DNA or RNA sequence to a host cell, so that the host cell will express the introduced gene or sequence to produce a desired substance, typically a protein or enzyme coded by the introduced gene or sequence.
  • the introduced gene or sequence may also be called a "cloned” or “foreign” gene or sequence, may include regulatory or control sequences, such as start, stop, promoter, signal, secretion, or other sequences used by a cell's genetic machinery.
  • the gene or sequence may include nonfunctional sequences or sequences with no known function.
  • a host cell that receives and expresses introduced DNA or RNA has been "transformed” and is a “transformant” or a "clone.”
  • the DNA or RNA introduced to a host cell can come from any source, including cells of the same genus or species as the host cell, or cells of a different genus or species.
  • vector means the vehicle by which a DNA or RNA sequence (e.g. a foreign gene) can be introduced into a host cell, so as to transform the host and promote expression (e.g. transcription and translation) of the introduced sequence.
  • Vectors include plasmids, phages, viruses, etc.
  • Vectors typically comprise the DNA of a transmissible agent, into which foreign DNA is inserted.
  • a common way to insert one segment of DNA into another segment of DNA involves the use of enzymes called restriction enzymes that cleave DNA at specific sites (specific groups of nucleotides) called restriction sites.
  • restriction enzymes that cleave DNA at specific sites (specific groups of nucleotides) called restriction sites.
  • a "cassette” refers to a DNA coding sequence or segment of DNA that codes for an expression product that can be inserted into a vector at defined restriction sites. The cassette restriction sites are designed to ensure insertion of the cassette in the proper reading frame.
  • foreign DNA is inserted at one or more restriction sites of the vector DNA, and then is carried by the vector into a host cell along with the transmissible vector DNA.
  • a segment or sequence of DNA having inserted or added DNA, such as an expression vector can also be called a "DNA construct.”
  • a common type of vector is a "plasmid", which generally is a self-contained molecule of double-stranded DNA, usually of bacterial origin, that can readily accept additional (foreign) DNA and which can readily introduced into a suitable host cell.
  • a plasmid vector often contains coding DNA and promoter DNA and has one or more restriction sites suitable for inserting foreign DNA.
  • Coding DNA is a DNA sequence that encodes a particular amino acid sequence for a particular protein or enzyme.
  • Promoter DNA is a DNA sequence which initiates, regulates, or otherwise mediates or controls the expression of the coding DNA.
  • Promoter DNA and coding DNA may be from the same gene or from different genes, and may be from the same or different organisms.
  • a large number of vectors, including plasmid and fungal vectors, have been described for replication and/or expression in a variety of eukaryotic and prokaryotic hosts.
  • Non-limiting examples include pKK plasmids (Clonetech), pUC plasmids, pET plasmids (Novagen, Inc., Madison, WI), pRSET or pREP plasmids (Invitrogen, San Diego, CA), or pMAL plasmids (New England Biolabs, Beverly, MA), and many appropriate host cells, using methods disclosed or cited herein or otherwise known to those skilled in the relevant art.
  • Recombinant cloning vectors will often include one or more replication systems for cloning or expression, one or more markers for selection in the host, e.g. antibiotic resistance, and one or more expression cassettes.
  • expression system means a host cell and compatible vector under suitable conditions, e.g. for the expression of a protein coded for by foreign DNA carried by the vector and introduced to the host cell.
  • Common expression systems include E. coli host cells and plasmid vectors, and insect host cells and Baculovirus vectors.
  • heterologous refers to a combination of elements not naturally occurring.
  • heterologous DNA refers to DNA not naturally located in the cell, or in a chromosomal site of the cell.
  • the heterologous DNA includes a gene foreign to the cell.
  • a heterologous expression regulatory element is a such an element operatively associated with a different gene than the one it is operatively associated with in nature.
  • an RPS 19 gene is heterologous to the vector DNA in which it is inserted for cloning or expression, and it is heterologous to a host cell containing such a vector, in which it is expressed, e.g., a CHO cell.
  • mutant and mutant mean any detectable change in genetic material, e.g. DNA, or any process, mechanism, or result of such a change. This includes gene mutations, in which the structure (e.g. DNA sequence) of a gene is altered, any gene or DNA arising from any mutation process, and any expression product (e.g. protein or enzyme) expressed by a modified gene or DNA sequence.
  • variant may also be used to indicate a modified or altered gene, DNA sequence, enzyme, cell, etc., i.e., any kind of mutant.
  • Sequence-conservative variants of a polynucleotide sequence are those in which a change of one or more nucleotides in a given codon position results in no alteration in the amino acid encoded at that position.
  • “Function-conservative variants” are those in which a given amino acid residue in a protein or enzyme has been changed without altering the overall conformation and function of the polypeptide, including, but not limited to, replacement of an amino acid with one having similar properties (such as, for example, polarity, hydrogen bonding potential, acidic, basic, hydrophobic, aromatic, and the like).
  • Amino acids with similar properties are well known in the art. For example, arginine, histidine and lysine are hydrophilic-basic amino acids and may be interchangeable. Similarly, isoleucine, a hydrophobic amino acid, may be replaced with leucine, methionine or valine.
  • Amino acids other than those indicated as conserved may differ in a protein or enzyme so that the percent protein or amino acid sequence similarity between any two proteins of similar function may vary and may be, for example, from 70% to 99%) as determined according to an alignment scheme such as by the Cluster Method, wherein similarity is based on the MEGALIGN algorithm.
  • a “function-conservative variant” also includes a polypeptide or enzyme which has at least 60 % amino acid identity as determined by BLAST or FASTA algorithms, preferably at least 75%, most preferably at least 85%, and even more preferably at least 90%, and which has the same or substantially similar properties or functions as the native or parent protein or enzyme to which it is compared.
  • homologous in all its grammatical forms and spelling variations refers to the relationship between proteins that possess a "common evolutionary origin,” including proteins from superfamilies (e.g., the inimunoglobulin superfamily) and homologous proteins from different species (e.g., myosin light chain, etc.) (Reeck et al, Cell 50:667, 1987). Such proteins (and their encoding genes) have sequence homology, as reflected by their sequence similarity, whether in terms of percent similarity or the presence of specific residues or motifs.
  • sequence similarity in all its grammatical forms refers to the degree of identity or correspondence between nucleic acid or amino acid sequences of proteins that may or may not share a common evolutionary origin (see Reeck et al, supra).
  • sequence similarity when modified with an adverb such as "highly,” may refer to sequence similarity and may or may not relate to a common evolutionary origin.
  • two DNA sequences are "substantially homologous" or “substantially similar” when at least about 80%, and most preferably at least about 90 or 95%) of the nucleotides match over the defined length of the DNA sequences, as determined by sequence comparison algorithms, such as BLAST, FASTA, DNA Strider, etc.
  • sequence comparison algorithms such as BLAST, FASTA, DNA Strider, etc.
  • An example of such a sequence is an allelic or species variant of the specific RPS19 genes of the invention.
  • Sequences that are substantially homologous can be identified by comparing the sequences using standard software available in sequence data banks, or in a Southern hybridization experiment under, for example, stringent conditions as defined for that particular system.
  • two amino acid sequences are "substantially homologous” or “substantially similar” when greater than 80% of the amino acids are identical, or greater than about 90% are similar (functionally identical).
  • the similar or homologous sequences are identified by alignment using, for example, the GCG (Genetics Computer Group, Program Manual for the GCG Package, Version 7, Madison, Wisconsin) pileup program, or any of the programs described above (BLAST, FASTA, A nucleic acid molecule is hybridizable" to another nucleic acid molecule, such as a cDNA, genomic DNA, or RNA, when a single stranded form of the nucleic acid molecule can anneal to the other nucleic acid molecule under the appropriate conditions of temperature and solution ionic strength (see Sambrook et al, supra).
  • the conditions of temperature and ionic strength determine the "stringency" of the hybridization.
  • low stringency hybridization conditions corresponding to a T m (melting temperature) of 55 °C
  • T m melting temperature
  • Moderate stringency hybridization conditions correspond to a higher T m , e.g., 40% formamide, with 5x or 6x SCC.
  • High stringency hybridization conditions correspond to the highest T m , e.g., 50% formamide, 5x or 6x SCC.
  • SCC is a 0.15M NaCl, 0.015M Na-citrate.
  • Hybridization requires that the two nucleic acids contain complementary sequences, although depending on the stringency of the hybridization, mismatches between bases are possible.
  • the appropriate stringency for hybridizing nucleic acids depends on the length of the nucleic acids and the degree of complementation, variables well known in the art. The greater the degree of similarity or homology between two nucleotide sequences, the greater the value of T m for hybrids of nucleic acids having those sequences. The relative stability
  • RNA:RNA RNA:RNA
  • DNA:RNA DNA:DNA
  • T m DNA:DNA
  • equations for calculating T m have been derived (see Sambrook et al, supra, 9.50-9.51).
  • the position of mismatches becomes more important, and the length of the ohgonucleotide determines its specificity (see Sambrook et al, supra, 11.7- 11.8).
  • a minimum length for a hybridizable nucleic acid is at least about 10 nucleotides; preferably at least about 15 nucleotides; and more preferably the length is at least about 20 nucleotides.
  • standard hybridization conditions refers to a T m of 55 °C, and utilizes conditions as set forth above.
  • the T m is 60 °C; in a more preferred embodiment, the T m is 65 °C.
  • “high stringency” refers to hybridization and/or washing conditions at 68°C in 0.2XSSC, at 42°C in 50% formamide, 4XSSC, or under conditions that afford levels of hybridization equivalent to those observed under either of these two conditions.
  • oligonucleotide refers to a nucleic acid, generally of at least 10, preferably at least 15, and more preferably at least 20 nucleotides, preferably no more than 100 nucleotides, that is hybridizable to a genomic DNA molecule, a cDNA molecule, or an mRNA molecule encoding a gene, mRNA, cDNA, or other nucleic acid of interest.
  • Oligonucleotides can be labeled, e.g., with 32 P-nucleotides or nucleotides to which a label, such as biotin, has been covalently conjugated.
  • a labeled ohgonucleotide can be used as a probe to detect the presence of a nucleic acid.
  • oligonucleotides (one or both of which may be labeled) can be used as PCR primers, either for cloning full length or a fragment of RPS 19, or to detect the presence of nucleic acids encoding RPS 19.
  • an ohgonucleotide of the invention can form a triple helix with a RPS 19 DNA molecule.
  • a library of oligonucleotides arranged on a solid support, such as a silicon wafer or chip can be used to detect various polymorphisms of interest.
  • oligonucleotides are prepared synthetically, preferably on a nucleic acid synthesizer. Accordingly, oligonucleotides can be prepared with non-naturally occurring phosphoester analog bonds, such as thioester bonds, etc.
  • the present invention provides antisense nucleic acids (including ribozymes), which may be used to inhibit expression of RPS19 of the invention, particularly to suppress hyperproliferative disorders.
  • An "antisense nucleic acid” is a single stranded nucleic acid molecule which, on hybridizing under cytoplasmic conditions with complementary bases in an RNA or DNA molecule, inhibits the latter's role. If the RNA is a messenger RNA transcript, the antisense nucleic acid is a countertranscript or mRNA-interfering complementary nucleic acid.
  • antisense broadly includes RNA-RNA interactions, RNA-DNA interactions, ribozymes and RNase-H mediated arrest.
  • Antisense nucleic acid molecules can be encoded by a recombinant gene for expression in a cell (e.g., U.S. Patent No. 5,814,500; U.S. Patent No. 5,811,234), or alternatively they can be prepared synthetically (e.g., U.S. Patent No. 5,780,607).
  • synthetic oligonucleotides envisioned for this invention include oligonucleotides that contain phosphorothioates, phosphotriesters, methyl phosphonates, short chain alkyl, or cycloalkl intersugar linkages or short chain heteroatomic or heterocyclic intersugar linkages.
  • 5,637,684 describes phosphoramidate and phosphorothioamidate oligomeric compounds.
  • oligonucleotides having morpholino backbone structures U.S. Pat. No. 5,034,506.
  • the phosphodiester backbone of the ohgonucleotide may be replaced with a polyamide backbone, the bases being bound directly or indirectly to the aza nitrogen atoms ' of the polyamide backbone (Nielsen et al, Science 254:1497, 1991).
  • oligonucleotides may contain substituted sugar moieties comprising one of the following at the 2' position: OH, SH, SCH 3 , F, OCN, O(CH 2 ) n NH 2 or O(CH 2 ) n CH 3 where n is from 1 to about 10; C, to C 10 lower alkyl, substituted lower alkyl, alkaryl or aralkyl; Cl; Br; CN; CF 3 ; OCF 3 ; O-; S-, or N-alkyl; O-, S-, or N-alkenyl; SOCH 3 ; SO 2 CH 3 ; ONO 2 ;NO 2 ; N 3 ; NH 2 ; heterocycloalkyl; heterocycloalkaryl; aminoalkylamino; polyalkylamino; substitued silyl; a fluorescein moiety; an RNA cleaving group; a reporter group; an intercalator; a group for improving the pharmacokinetic properties of an o
  • Oligonucleotides may also have sugar mimetics such as cyclobutyls or other carbocyclics in place of the pentofuranosyl group.
  • Nucleotide units having nucleosides other than adenosine, cytidine, guanosine, thymidine and uridine, such as inosine, may be used in an ohgonucleotide molecule, etc.).
  • RPS 19 Nucleic Acids
  • a gene encoding RPS 19, whether genomic DNA or cDNA, can be isolated from any source, particularly from a human cDNA or genomic library. Methods for obtaining RPS 19 gene are well known in the art, as described above (see, e.g., Sambrook et al, 1989, supra).
  • the DNA may be obtained by standard procedures known in the art from cloned DNA (e.g., a DNA "library”), and preferably is obtained from a cDNA library prepared from tissues with high level expression of the protein (e.g., a hematopoietic stem cell library, since these are the cells that evidence highest levels of expression of RPS 19), by chemical synthesis, by cDNA cloning, or by the cloning of genomic DNA, or fragments thereof, purified from the desired cell (See, for example, Sambrook et al, 1989, supra; Glover, D.M. (ed.), 1985, DNA Cloning: A Practical Approach, MRL Press, Ltd., Oxford, U.K. Vol. I, II).
  • Clones derived from genomic DNA may contain regulatory and intron DNA regions in addition to coding regions; clones derived from cDNA will not contain intron sequences. Whatever the source, the gene should be molecularly cloned into a suitable vector for propagation of the gene.
  • Identification of the specific DNA fragment containing the desired RPS 19 gene may be accomplished in a number of ways. For example, a portion of a RPS19 gene exemplified infra can be purified and labeled to prepare a labeled probe, and the generated DNA may be screened by nucleic acid hybridization to the labeled probe (Benton and Davis, Science 196:180, 1977; Grunstein and Hogness, Proc. Natl. Acad. Sci. U.S.A. 72:3961, 1975). Those DNA fragments with substantial homology to the probe, such as an allelic variant from another individual, will hybridize. In a specific embodiment, highest stringency hybridization conditions are used to identify a homologous RPS 19 gene.
  • the invention provides a genomic sequence of the RRS7P gene (SEQ ID NOS : 1 and 2).
  • the gene encodes a protein product having the isoelectric, electrophoretic, amino acid composition, partial or complete amino acid sequence, antibody binding activity, or ligand binding profile of RPS 19 protein as disclosed herein.
  • the presence of the gene may be detected by assays based on the physical, chemical, immunological, or functional properties of its expressed product.
  • the present invention also relates to cloning vectors containing genes encoding analogs and derivatives of RPS 19 of the invention, that have the same or homologous functional activity as RPS 19.
  • the production and use of derivatives related to RPS 19, including RPS 19 mutants, are within the scope of the present invention.
  • a truncated form of RPS 19 can be provided.
  • Such a truncated form includes RPS 19 with a deletion.
  • the derivative is functionally active, i.e., capable of exhibiting one or more functional activities associated with a full-length, wild-type RPS 19 of the invention.
  • Such functions include mRNA translation into protein (i.e., ribosome function).
  • RPS 19 derivatives can be made by altering encoding nucleic acid sequences by substitutions, additions or deletions that provide for functionally similar molecules, i.e., molecules that perform one or more RPS 19 functions.
  • non-functional mutant forms of RPS 19, that may for example compete with wild-type RPS 19 in ribosomes, but which are less effective in mediating protein translation, can be prepared for use in treating hyperproliferative disorders, as discussed above.
  • the mutation is selected from the group consisting of: a) a breakpoint in the third intron of the gene for RPS 19; b) an agATG to atATG nucleotide change in intron 1 ; c) an A to G transition at position 1 in exon 2; d) insertion of an A at position 13 of exon 2; e) deletion of 4 base pairs at position 72(+3 - +6) of intron 2, resulting in an AAgtgagtttggg (SEQ ID NO: 10) to AAgtttggg (SEQ ID NO:l 1) transition; f) insertion of an A at position 104 of exon 3; g) a T to C transition at position 154 in exon 3; h) a C to T transition at position 280 of exon 4; i) a C to T transition at position 184 of exon 4; j) deletion of exon 5; and k) a frameshift at codon
  • RPS 19 proteins are encoded by some of the above mutations.
  • DNA sequences which encode substantially the same amino acid sequence as a RPS 19 gene may be used in the practice of the present invention. These include but are not limited to allelic variants, species variants, sequence conservative variants, and functional variants.
  • Amino acid substitutions may also be introduced to substitute an amino acid with a particularly preferable property.
  • a Cys may be introduced a potential site for disulfide bridges with another Cys.
  • RPS 19 derivatives and analogs of the invention can be produced by various methods known in the art. The manipulations which result in their production can occur at the gene or protein level.
  • the cloned RPS 19 gene sequence can be modified by any of numerous strategies known in the art (Sambrook et al, 1989, supra). The sequence can be cleaved at appropriate sites with restriction endonuclease(s), followed by further enzymatic modification if desired, isolated, and ligated in vitro.
  • the RPS19-encoding nucleic acid sequence can be mutated in vitro or in vivo, to create and/or destroy translation, initiation, and/or termination sequences, or to create variations in coding regions and/or form new restriction endonuclease sites or destroy preexisting ones, to facilitate further in vitro modification.
  • modifications can be made to introduce restriction sites and facilitate cloning the RPS 19 gene into an expression vector.
  • Any technique for mutagenesis known in the art can be used, including but not limited to, in vitro site- directed mutagenesis (Hutchinson, C, et al, J. Biol. Chem.
  • the identified and isolated gene can then be inserted into an appropriate cloning vector.
  • vector-host systems known in the art may be used. Possible vectors include, but are not limited to, plasmids or modified viruses, but the vector system must be compatible with the host cell used. Examples of vectors include, but are not limited to, E. coli, bacteriophages such as lambda derivatives, or plasmids such as pBR322 derivatives or pUC plasmid derivatives, e.g., pGEX vectors, pmal-c, pFLAG, etc.
  • the insertion into a cloning vector can, for example, be accomplished by ligating the DNA fragment into a cloning vector which has complementary cohesive termini.
  • the ends of the DNA molecules may be enzymatically modified.
  • any site desired may be produced by ligating nucleotide sequences (linkers) onto the DNA termini; these ligated linkers may comprise specific chemically synthesized oligonucleotides encoding restriction endonuclease recognition sequences.
  • Recombinant molecules can be introduced into host cells via transformation, transfection, infection, electroporation, etc., so that many copies of the gene sequence are generated.
  • the cloned gene is contained on a shuttle vector plasmid, which provides for expansion in a cloning cell, e.g., E.
  • a shuttle vector which is a vector that can replicate in more than one type of organism, can be prepared for replication in both E. coli and Saccharomyces cerevisiae by linking sequences from an E. coli plasmid with sequences form the yeast 2m plasmid. Expression of RPS 19 Polypeptides
  • the nucleotide sequence coding for RPS 19, or antigenic fragment, derivative or analog thereof, or a functionally active derivative, including a chimeric protein, thereof, can be inserted into an appropriate expression vector, i.e., a vector which contains the necessary elements for the transcription and translation of the inserted protein-coding sequence.
  • a nucleic acid encoding RPS 19 of the invention can be operationally associated with a promoter in an expression vector of the invention. Both cDNA and genomic sequences can be cloned and expressed under control of such regulatory sequences.
  • Such vectors can be used to express functional or functionally inactivated RPS 19 polypeptides.
  • an "RPS 19 polypeptide" refers to all or a portion of RPS 19.
  • the portion of RPS 19 preferably binds to a binding partner of RPS 19, such as a ribosome or component thereof, or an RPS19-specific antibody, or a small molecule modulator of RPS 19.
  • the necessary transcriptional and translational signals can be provided on a recombinant expression vector, or they may be supplied by the native gene encoding RPS 19 and/or its flanking regions.
  • Potential host-vector systems include but are not limited to mammalian cell systems infected with virus (e.g., vaccinia virus, adenovirus, adeno-associated virus, herpes virus, etc.); insect cell systems infected with virus (e.g., baculovirus); microorganisms such as yeast containing yeast vectors; or bacteria transformed with bacteriophage, DNA, plasmid DNA, or cosmid DNA.
  • virus e.g., vaccinia virus, adenovirus, adeno-associated virus, herpes virus, etc.
  • insect cell systems infected with virus e.g., baculovirus
  • microorganisms such as yeast containing yeast vectors
  • bacteria transformed with bacteriophage DNA, plasmid DNA, or cosmid DNA.
  • the expression elements of vectors vary in their strengths and specificities. Depending on the host-vector system utilized, any one of a number of suitable transcription and translation elements may be used.
  • yeast expression systems can also be used according to the invention to express RPS 19.
  • the non- fusion pYES2 vector (Xba , Sph , Sho ⁇ , Notl, GstXI, EcoRI, RstXI, BamUl, Sad, Kpn ⁇ , and Hindlll cloning sit; Invitrogen) or the fusion pY ⁇ SHisA, B, C (Xba , Sph , Shol, Notl, BstXl, EcoRI, R mHl, Sad, Kpnl, and Hindlll cloning site, N-terminal peptide purified with ProBond resin and cleaved with enterokinase; Invitrogen), to mention just two, can be employed according to the invention.
  • RPS 19 protein may be controlled by any promoter/enhancer element known in the art, but these regulatory elements must be functional in the host selected for expression.
  • Promoters which may be used to control RPS 19 gene expression include, but are not limited to, cytomegalovirus (CMV) promoter, the S V40 early promoter region (Benoist and Chambon, 1981, Nature 290:304-310), the promoter contained in the 3' long terminal repeat of Rous sarcoma virus (Yamamoto, et al, Cell 22:787-797, 1980), the herpes thymidine kinase promoter (Wagner et al, Proc. Natl Acad. Sci. U.S.A.
  • a wide variety of host expression vector combinations may be employed in expressing the DNA sequences of this invention.
  • Useful expression vectors may consist of segments of chromosomal, non-chromosomal and synthetic DNA sequences.
  • Suitable vectors include derivatives of SV40 and known bacterial plasmids, e.g., E.
  • coli plasmids col ⁇ l, pCRl, pBR322, pMal-C2, p ⁇ T, pG ⁇ X (Smith et al, Gene 67:31-40, 1988), pMB9 and their derivatives, plasmids such as RP4; phage DNAS, e.g., the numerous derivatives of phage 1, e.g., NM989, and other phage DNA, e.g., Ml 3 and filamentous single stranded phage DNA; yeast plasmids such as the 2m plasmid or derivatives thereof; vectors useful in eukaryotic cells, such as vectors useful in insect or mammalian cells; vectors derived from combinations of plasmids and phage DNAs, such as plasmids that have been modified to employ phage DNA or other expression control sequences; and the like.
  • phage DNAS e.g., the numerous derivatives of phage 1, e.g
  • Preferred vectors are viral vectors, such as lentiviruses, retroviruses, herpes viruses, adenoviruses, adeno-associated viruses, vaccinia virus, baculovirus, and other recombinant viruses with desirable cellular tropism.
  • a gene encoding a functional or mutant RPS 19 protein or polypeptide domain fragment thereof can be introduced in vivo, ex vivo, or in vitro using a viral vector or through direct introduction of DNA.
  • Expression in targeted tissues can be effected by targeting the transgenic vector to specific cells, such as with a viral vector or a receptor ligand, or by using a tissue-specific promoter, or both. Targeted gene delivery is described in International Patent Publication WO 95/28494, published October 1995.
  • Viral vectors commonly used for in vivo or ex vivo targeting and therapy procedures are DNA-based vectors and retroviral vectors. Methods for constructing and using viral vectors are known in the art (see, e.g., Miller and Rosman, BioTechniques, 7:980-990, 1992).
  • the viral vectors are replication defective, that is, they are unable to replicate autonomously in the target cell.
  • the genome of the replication defective viral vectors which are used within the scope of the present invention lack at least one region which is necessary for the replication of the virus in the infected cell. These regions can either be eliminated (in whole or in part), be rendered non- functional by any technique known to a person skilled in the art.
  • These techniques include the total removal, substitution (by other sequences, in particular by the inserted nucleic acid), partial deletion or addition of one or more bases to an essential (for replication) region.
  • Such techniques may be performed in vitro (on the isolated DNA) or in situ, using the techniques of genetic manipulation or by treatment with mutagenic agents.
  • the replication defective virus retains the sequences of its genome which are necessary for encapsidating the viral particles.
  • DNA viral vectors include an attenuated or defective DNA virus, such as but not limited to herpes simplex virus (HSV), papillomavirus, Epstein Barr virus (EBV), adenovirus, adeno-associated virus (AAV), and the like.
  • HSV herpes simplex virus
  • EBV Epstein Barr virus
  • AAV adeno-associated virus
  • Defective viruses which entirely or almost entirely lack viral genes, are preferred. Defective virus is not infective after introduction into a cell.
  • Use of defective viral vectors allows for administration to cells in a specific, localized area, without concern that the vector can infect other cells. Thus, a specific tissue can be specifically targeted.
  • particular vectors include, but are not limited to, a defective herpes virus 1 (HSV1) vector (Kaplitt et al, Molec. Cell. Neurosci.
  • viral vectors commercially, including but by no means limited to Avigen, Inc. (Alameda, CA; AAV vectors), Cell Genesys (Foster City, CA; retroviral, adenoviral, AAV vectors, and lentiviral vectors), Clontech (retroviral and baculoviral vectors), Genovo, Inc.
  • Avigen, Inc. Almeda, CA; AAV vectors), Cell Genesys (Foster City, CA; retroviral, adenoviral, AAV vectors, and lentiviral vectors), Clontech (retroviral and baculoviral vectors), Genovo, Inc.
  • an appropriate immunosuppressive treatment is employed in conjunction with the viral vector, e.g., adenovirus vector, to avoid immuno-deactivation of the viral vector and transfected cells.
  • the viral vector e.g., adenovirus vector
  • immunosuppressive cytokines such as interleukin-12 (IL-12), interferon-g (IFN-g), or anti-CD4 antibody
  • IL-12 interleukin-12
  • IFN-g interferon-g
  • anti-CD4 antibody can be administered to block humoral or cellular immune responses to the viral vectors (see, e.g., Wilson, Nature Medicine, 1995).
  • a viral vector that is engineered to express a minimal number of antigens.
  • Adenovirus vectors are eukaryotic DNA viruses that can be modified to efficiently deliver a nucleic acid of the invention to a variety of cell types.
  • Various serotypes of adenovirus exist. Of these serotypes, preference is given, within the scope of the present invention, to using type 2 or type 5 human adenoviruses (Ad 2 or Ad 5) or adenoviruses of animal origin (see WO94/26914).
  • adenoviruses of animal origin which can be used within the scope of the present invention include adenoviruses of canine, bovine, murine (example: Mavl, Beard et al, Virology 75 (1990) 81), ovine, porcine, avian, and simian (example:
  • the adenovirus of animal origin is a canine adenovirus, more preferably a CAV2 adenovirus (e.g. Manhattan or A26/61 strain (ATCC VR-800), for example).
  • a CAV2 adenovirus e.g. Manhattan or A26/61 strain (ATCC VR-800), for example.
  • the replication defective adenoviral vectors of the invention comprise the ITRs, an encapsidation sequence and the nucleic acid of interest. Still more preferably, at least the El region of the adenoviral vector is non-functional The deletion in the El region preferably extends from nucleotides 455 to 3329 in the sequence of the Ad5 adenovirus (PvuII-BgHI fragment) or 382 to 3446 (HinfII-Sau3A fragment).
  • E3 region WO95/02697
  • E2 region WO94/28938
  • E4 region WO94/28152, WO94/12649 and WO95/02697
  • the adenoviral vector has a deletion in the El region (Ad 1.0). Examples of El -deleted adenoviruses are disclosed in EP 185,573, the contents of which are incorporated herein by reference. In another embodiment, the adenoviral vector has a deletion in the El and E4 regions (Ad 3.0). Examples of El/E4-deleted adenoviruses are disclosed in WO95/02697 and WO96/22378, the contents of which are incorporated herein by reference. In still another preferred embodiment, the adenoviral vector has a deletion in the El region into which the E4 region and the nucleic acid sequence are inserted (see FR94 13355, the contents of which are incorporated herein by reference).
  • the replication defective recombinant adenoviruses according to the invention can be prepared by any technique known to the person skilled in the art (Levrero et al, Gene 101:195 1991; EP 185 573; Graham, EMBO J. 3:2917, 1984). In particular, they can be prepared by homologous recombination between an adenovirus and a plasmid which carries, inter alia, the DNA sequence of interest. The homologous recombination is effected following cotransfection of the said adenovirus and plasmid into an appropriate cell line.
  • the cell line which is employed should preferably (i) be transformable by the said elements, and (ii) contain the sequences which are able to complement the part of the genome of the replication defective adenovirus, preferably in integrated form in order to avoid the risks of recombination.
  • Examples of cell lines which may be used are the human embryonic kidney cell line 293 (Graham et al, J. Gen. Virol. 36:59 1977) which contains the left-hand portion of the genome of an Ad5 adenovirus (12%) integrated into its genome, and cell lines which are able to complement the El and E4 functions, as described in applications WO94/26914 and WO95/02697.
  • Recombinant adenoviruses are recovered and purified using standard molecular biological techniques, which are well known to one of ordinary skill in the art.
  • Adeno-associated viruses are DNA viruses of relatively small size which can integrate, in a stable and site-specific manner, into the genome of the cells which they infect. They are able to infect a wide spectrum of cells without inducing any effects on cellular growth, morphology or differentiation, and they do not appear to be involved in human pathologies.
  • the AAV genome has been cloned, sequenced and characterized. It encompasses approximately 4700 bases and contains an inverted terminal repeat (ITR) region of approximately 145 bases at each end, which serves as an origin of replication for the virus.
  • ITR inverted terminal repeat
  • the remainder of the genome is divided into two essential regions which carry the encapsidation functions: the left-hand part of the genome, which contains the rep gene involved in viral replication and expression of the viral genes; and the right-hand part of the genome, which contains the cap gene encoding the capsid proteins of the virus.
  • the replication defective recombinant AAVs according to the invention can be prepared by cotransfecting a plasmid containing the nucleic acid sequence of interest flanked by two AAV inverted terminal repeat (ITR) regions, and a plasmid carrying the AAV encapsidation genes (rep and cap genes), into a cell line which is infected with a human helper virus (for example an adenovirus).
  • ITR inverted terminal repeat
  • Retrovirus vectors In another embodiment the gene can be introduced in a retroviral vector, e.g., as described in Anderson et al, U.S. Patent No. 5,399,346; Mann et al, 1983, Cell 33:153; Temin et al, U.S. Patent No. 4,650,764; Temin et al, U.S. Patent No. 4,980,289; Markowitz et al, 1988, J. Virol. 62:1120; Temin et al, U.S. Patent No. 5,124,263; EP 453242, EP178220; Bernstein et al. Genet. Eng.
  • the retro viruses are integrating viruses which infect dividing cells.
  • the retrovirus genome includes two LTRs, an encapsidation sequence and three coding regions (gag, pol and env).
  • the gag, pol and env genes are generally deleted, in whole or in part, and replaced with a heterologous nucleic acid sequence of interest.
  • retrovirus can be constructed from different types of retrovirus, such as, HIV, MoMuLV ("murine Moloney leukaemia virus” MSV ("murine Moloney sarcoma virus”), HaSV ("Harvey sarcoma virus”); SNV ("spleen necrosis virus”); RSV ("Rous sarcoma virus”) and Friend virus.
  • Defective retroviral vectors are disclosed in WO95/02697.
  • a plasmid is constructed which contains the LTRs, the encapsidation sequence and the coding sequence.
  • This construct is used to transfect a packaging cell line, which cell line is able to supply in trans the retroviral functions which are deficient in the plasmid.
  • the packaging cell lines are thus able to express the gag, pol and env genes.
  • Such packaging cell lines have been described in the prior art, in particular the cell line PA317 (US4,861,719); the PsiCRIP cell line (WO90/02806) and the GP+envAm-12 cell line (WO89/07150).
  • the recombinant retroviral vectors can contain modifications within the LTRs for suppressing transcriptional activity as well as extensive encapsidation sequences which may include a part of the gag gene (Bender et al, J. Virol. 61 (1987) 1639). Recombinant retroviral vectors are purified by standard techniques known to those having ordinary skill in the art.
  • Retroviral vectors can be constructed to function as infectious particles or to undergo a single round of transfection. In the former case, the virus is modified to retain all of its genes except for those responsible for oncogenic transformation properties, and to express the heterologous gene. Non-infectious viral vectors are manipulated to destroy the viral packaging signal, but retain the structural genes required to package the co-introduced virus engineered to contain the heterologous gene and the packaging signals. Thus, the viral particles that are produced are not capable of producing additional virus. Lentivirus vectors.
  • lentiviral vectors are can be used as agents for the direct delivery and sustained expression of a transgene in several tissue types, including brain, retina, muscle, liver and blood. The vectors can efficiently transduce dividing and nondividing cells in these tissues, and maintain long-term expression of the gene of interest. For a review, see, Naldini, Curr. Opin. Biotechnol, 9:457-63, 1998.
  • Lentiviruses contain at least two regulatory genes, t ⁇ t and rev, that are essential for replication, and four accessory genes that encode critical virulence factors. The viral sequences non-essential for transduction are eliminated, thereby improving the biosafety of this particular vector.
  • Self-inactivating HIV-1 vectors are known, which have a deletion in the 3' long terminal repeat (LTR) including the TATA box, and significantly improve the biosafety of HIV-derived vectors by reducing the likelihood that replication-competent retroviruses will originate in the vector producer and target cells (Zufferey, et al, J. Virol, 72:9873-80, 1998). In addition, the deletion improves the potential performance of the vector by removing LTR sequences previously associated with transcriptional interference and suppression in vivo and by allowing the construction of more-stringent tissue-specific or regulatable vectors.
  • LTR 3' long terminal repeat
  • Lentiviral packaging cell lines are available and known generally in the art. They facilitate the production of high-titer lentivirus vectors for gene therapy.
  • An example is a tetracycline-inducible VSV-G pseudotyped lentivirus packaging cell line which can generate virusparticles at titers greater than 106 IU/ml for at least 3 to 4 days (Kafri, et al, J. Virol, 73: 576-584, 1999).
  • the vector produced by the inducible cell line can be concentrated as needed for efficiently transducing nondividing cells in vitro and in vivo.
  • Non-viral vectors can be introduced in vivo by lipofection, as naked DNA, or with other transfection facilitating agents (peptides, polymers, etc.).
  • Synthetic cationic lipids can be used to prepare liposomes for in vivo transfection of a gene encoding a marker (Feigner, et. al, Proc. Natl. Acad. Sci. U.S.A. 84:7413-7417, 1987; Feigner and Ringold, Science 337:387-388, 1989; see Mackey, et al, Proc. Natl. Acad. Sci. U.S.A.
  • lipid compounds and compositions for transfer of nucleic acids are described in International Patent Publications WO95/18863 and WO96/17823, and in U.S. Patent No. 5,459,127.
  • Lipids may be chemically coupled to other molecules for the purpose of targeting (see Mackey, et. al, supra).
  • Targeted peptides e.g., hormones or neurotransmitters, and proteins such as antibodies, or non- peptide molecules could be coupled to liposomes chemically.
  • a nucleic acid in vivo, is also useful for facilitating transfection of a nucleic acid in vivo, such as a cationic oligopeptide (e.g., International Patent Publication WO95/21931), peptides derived from DNA binding proteins (e.g. , International Patent Publication WO96/25508), or a cationic polymer (e.g., International Patent Publication WO95/21931).
  • a cationic oligopeptide e.g., International Patent Publication WO95/21931
  • peptides derived from DNA binding proteins e.g. , International Patent Publication WO96/25508
  • a cationic polymer e.g., International Patent Publication WO95/21931.
  • naked DNA vectors for gene therapy can be introduced into the desired host cells by methods known in the art, e.g., electroporation, microi jection, cell fusion, DEAE dextran, calcium phosphate precipitation, use of a gene gun, or use of a DNA vector transporter (see, e.g., Wu et al, J. Biol. Chem. 267:963-967, 1992; Wu and Wu, J. Biol. Chem. 263:14621-14624, 1988; Hartmut et al, Canadian Patent Application No. 2,012,311, filed March 15, 1990; Williams et al, Proc. Natl Acad. Sci.
  • RPS 19 polypeptides produced recombinantly or by chemical synthesis, and fragments or other derivatives or analogs thereof, including fusion proteins, may be used as an immunogen to generate antibodies that recognize the RPS 19 polypeptide.
  • Such antibodies include but are not limited to polyclonal, monoclonal, chimeric, single chain, Fab fragments, and an Fab expression library. Such an antibody is specific for human RPS 19; it may recognize a mutant form of RPS 19, or wild-type RPS19.
  • RPS 19 polypeptide or derivative or analog thereof various procedures known in the art may be used for the production of polyclonal antibodies to RPS 19 polypeptide or derivative or analog thereof.
  • various host animals can be immunized by injection with the RPS 19 polypeptide, or a derivative (e.g., fragment or fusion protein) thereof, including but not limited to rabbits, mice, rats, sheep, goats, etc.
  • the RPS 19 polypeptide or fragment thereof can be conjugated to an immunogenic carrier, e.g., bovine serum albumin (BSA) or keyhole limpet hemocyanin (KLH).
  • BSA bovine serum albumin
  • KLH keyhole limpet hemocyanin
  • adjuvants may be used to increase the immuno logical response, depending on the host species, including but not limited to Freund's (complete and incomplete), mineral gels such as aluminum hydroxide, surface active substances such as lysolecithin, pluronic polyols, polyanions, peptides, oil emulsions, keyhole limpet hemocyanins, dinitrophenol, and potentially useful human adjuvants such as BCG (bacille Calmette-Gueri ) and Corynebacterium parvum.
  • any technique that provides for the production of antibody molecules by continuous cell lines in culture may be used. These include but are not limited to the hybridoma technique originally developed by Kohler and Milstein (Nature 256:495-497, 1975), as well as the trioma technique, the human B-cell hybridoma technique (Kozbor et al, Immunology Today 4:72, 1983; Cote et al, Proc. Natl. Acad. Sci. U.S.A.
  • monoclonal antibodies can be produced in germ- free animals (International Patent Publication No. WO 89/12690, published 28 December 1989).
  • techniques developed for the production of "chimeric antibodies" (Morrison et al, J.
  • such fragments include but are not limited to: the F(ab') 2 fragment which can be produced by pepsin digestion of the antibody molecule; the Fab' fragments which can be generated by reducing the disulfide bridges of the F(ab') 2 fragment, and the Fab fragments which can be generated by treating the antibody molecule with papain and a reducing agent.
  • techniques described for the production of single chain antibodies can be adapted to produce RPS 19 polypeptide-specific single chain antibodies.
  • An additional embodiment of the invention utilizes the techniques described for the construction of Fab expression libraries (Huse et al, Science 246:1275-1281, 1989) to allow rapid and easy identification of monoclonal Fab fragments with the desired specificity for an RPS 19 polypeptide, or its derivatives, or analogs.
  • screening for or testing with the desired antibody can be accomplished by techniques known in the art, e.g., radioimmunoassay, ELISA (enzyme-linked immunosorbant assay), "sandwich” immunoassays, immunoradiometric assays, gel diffusion precipitin reactions, immunodiffusion assays, in situ immunoassays (using colloidal gold, enzyme or radioisotope labels, for example), western blots, precipitation reactions, agglutination assays (e.g., gel agglutination assays, hemagglutination assays), complement fixation assays, immunofluorescence assays, protein A assays, and immunoelectrophoresis assays, etc.
  • radioimmunoassay e.g., ELISA (enzyme-linked immunosorbant assay), "sandwich” immunoassays, immunoradiometric assays, gel diffusion precipitin reactions, immunodiffusion assays, in
  • antibody binding is detected by detecting a label on the primary antibody.
  • the primary antibody is detected by detecting binding of a secondary antibody or reagent to the primary antibody.
  • the secondary antibody is labeled.
  • Many means are known in the art for detecting binding in an immunoassay and are within the scope of the present invention. For example, to select antibodies which recognize a specific epitope of an RPS 19 polypeptide, one may assay generated hybridomas for a product which binds to an RPS 19 polypeptide fragment containing such epitope. For selection of an antibody specific to an RPS 19 polypeptide from a particular species of animal, one can select on the basis of positive binding with RPS 19 polypeptide expressed by or isolated from cells of that species of animal.
  • the foregoing antibodies can be used in methods known in the art relating to the localization and activity of the RPS 19 polypeptide, e.g., for Western blotting, imaging RPS 19 polypeptide in situ, measuring levels thereof in appropriate physiological samples, etc. using any of the detection techniques mentioned above or known in the art.
  • Such antibodies can also be used in assays for ligand binding, e.g., as described in US Patent No. 5,679,582.
  • antibodies that agonize or antagonize the activity of RPS 19 polypeptide can be generated.
  • intracellular single chain FV antibodies can be used to regulate (inhibit) RPS 19.
  • Such antibodies can be tested using the assays described infra for identifying ligands. Screening and Chemistry
  • nucleotide sequences derived from the gene encoding a polymorphic form of a RPS 19, and peptide sequences derived from that polymorphic form of RPS 19, are useful targets to identify drugs that are effective in treating aplastic, hypoplastic, or hyperproliferative disorders.
  • Drug targets include without limitation (i) isolated nucleic acids derived from the gene encoding a RPS 19 and (ii) isolated peptides and polypeptides derived from RPS 19 polypeptides, each of which may comprise one or more polymorphic positions.
  • identification and isolation of RPS 19 provides for development of screening assays, particularly for high throughput screening of molecules that up- or down-regulate the activity of RPS 19, e.g., by permitting expression of RPS 19 in quantities greater than can be isolated from natural sources, or in indicator cells that are specially engineered to indicate the activity of RPS 19 expressed after transfection or transformation of the cells. Accordingly, the present invention contemplates methods for identifying specific ligands of RPS 19 using various screening assays known in the art.
  • Any screening technique known in the art can be used to screen for RPS 19 agonists or antagonists.
  • the present invention contemplates screens for small molecule ligands or ligand analogs and mimics, as well as screens for natural ligands that bind to and agonize or antagonize activates RPS 19 in vivo.
  • natural products libraries can be screened using assays of the invention for molecules that agonize or antagonize RPS 19 activity.
  • synthetic libraries (Needels et al, Proc. Natl. Acad. Sci. USA 90:10700-4, 1993; Ohlmeyer et al, Proc. Natl Acad. Sci. USA 90:10922- 10926, 1993 ; Lam et al. , International Patent Publication No. WO 92/00252; Kocis et al, International Patent Publication No. WO 9428028) and the like can be used to screen for RPS 19 ligands according to the present invention.
  • Test compounds are screened from large libraries of synthetic or natural compounds. Numerous means are currently used for random and directed synthesis of saccharide, peptide, and nucleic acid based compounds. Synthetic compound libraries are commercially available from Maybridge Chemical Co. (Trevillet, Cornwall, UK), Comgenex (Princeton, NJ), Brandon Associates (Merrimack, NH), and Microsource (New Milford, CT). A rare chemical library is available from Aldrich (Milwaukee, WI). Alternatively, libraries of natural compounds in the form of bacterial, fungal, plant and animal extracts are available from e.g. Pan Laboratories (Bothell, WA) or MycoSearch (NC), or are readily producible. Additionally, natural and synthetically produced libraries and compounds are readily modified through conventional chemical, physical, and biochemical means (Blondelle et al, Tib Tech, 14:60, 1996). In vitro screening methods
  • an isolated nucleic acid comprising one or more polymorphic positions is tested in vitro for its ability to bind test compounds in a sequence-specific manner.
  • the methods comprise: (i) providing a first nucleic acid containing a particular sequence at a polymorphic position and a second nucleic acid whose sequence is identical to that of the first nucleic acid except for a different sequence at the same polymo ⁇ hic position;
  • Selective binding refers to any measurable difference in any parameter of binding, such as, e.g., binding affinity, binding capacity, etc.
  • an isolated peptide or polypeptide comprising one or more polymo ⁇ hic positions is tested in vitro for its ability to bind test compounds in a sequence-specific manner.
  • the screening methods involve: (i) providing a first peptide or polypeptide containing a particular sequence at a polymo ⁇ hic position and a second peptide or polypeptide whose sequence is identical to the first peptide or polypeptide except for a different sequence at the same polymo ⁇ hic position;
  • Intact cells or whole animals expressing polymo ⁇ hic variants of a gene encoding RPS 19 can be used in screening methods to identify candidate drugs.
  • a permanent cell line is established from an individual exhibiting a particular polymo ⁇ hic pattern.
  • cells including without limitation mammalian, insect, yeast, or bacterial cells
  • Identification of candidate compounds can be achieved using any suitable assay, including without limitation (i) assays that measure selective binding of test compounds to particular polymo ⁇ hic variants of RPS 19 (ii) assays that measure the ability of a test compound to modify (i.e., inhibit or enhance) a measurable activity or function of RPS 19 and (iii) assays that measure the ability of a compound to modify (i.e., inhibit or enhance) the transcriptional activity of sequences derived from the promoter (i.e., regulatory) regions the RPS 19 gene.
  • RPS 15 knockout mammals can be prepared for evaluating the molecular pathology of this defect in greater detail than is possible with human subjects. Such animals also provide excellent models for screening drug candidates.
  • a "knockout mammal” is an mammal (e.g., mouse) that contains within its genome a specific gene that has been inactivated by the method of gene targeting (see, e.g., US Patents No. 5,777,195 and No. 5,616,491).
  • a knockout mammal includes both a heterozygote knockout (i.e., one defective allele and one wild-type allele) and a homozygous mutant (i.e., two defective alleles; however, in this case a heterologous construct for expression of an RPS 19, such as a human RPS 19, would be inserted to permit the knockout mammal to live).
  • Preparation of a knockout mammal requires first introducing a nucleic acid construct that will be used to suppress expression of a particular gene into an undifferentiated cell type termed an embryonic stem cell. This cell is then injected into a mammalian embryo. A mammalian embryo with an integrated cell is then implanted into a foster mother for the duration of gestation.
  • Pfeffer et al. (Cell, 73:457-467, 1993) describe mice in which the gene encoding the tumor necrosis factor receptor p55 has been suppressed.
  • Fung-Leung et al (Cell, 65:443-449, 1991; J. Exp. Med., 174:1425-1429, 1991) describe knockout mice lacking expression of the gene encoding CD8.
  • knockout refers to partial or complete suppression of the expression of at least a portion of a protein encoded by an endogenous DNA sequence in a cell.
  • knockout construct refers to a nucleic acid sequence that is designed to decrease or suppress expression of a protein encoded by endogenous DNA sequences in a cell
  • the nucleic acid sequence used as the knockout construct is typically comprised of (1) DNA from some portion of the gene (exon sequence, intron sequence, and/or promoter sequence) to be suppressed and (2) a marker sequence used to detect the presence of the knockout construct in the cell.
  • the knockout construct is inserted into a cell, and integrates with the genomic DNA of the cell in such a position so as to prevent or interrupt transcription of the native DNA sequence.
  • Such insertion usually occurs by homologous recombination (i.e., regions of the knockout construct that are homologous to endogenous DNA sequences hybridize to each other when the knockout construct is inserted into the cell and recombine so that the knockout construct is inco ⁇ orated into the corresponding position of the endogenous DNA).
  • the knockout construct nucleic acid sequence may comprise 1) a full or partial sequence of one or more exons and/or introns of the gene to be suppressed, 2) a full or partial promoter sequence of the gene to be suppressed, or 3) combinations thereof.
  • the knockout construct is inserted into an embryonic stem cell (ES cell) and is integrated into the ES cell genomic DNA, usually by the process of homologous recombination. This ES cell is then injected into, and integrates with, the developing embryo.
  • ES cell embryonic stem cell
  • disruption of the gene and “gene disruption” refer to insertion of a nucleic acid sequence into one region of the native DNA sequence (usually one or more exons) and/or the promoter region of a gene so as to decrease or prevent expression of that gene in the cell as compared to the wild-type or naturally occurring sequence of the gene.
  • a nucleic acid construct can be prepared containing a DNA sequence encoding an antibiotic resistance gene which is inserted into the DNA sequence that is complementary to the DNA sequence (promoter and/or coding region) to be disrupted. When this nucleic acid construct is then transfected into a cell, the construct will integrate into the genomic DNA. Thus, many progeny of the cell will no longer express the gene at least in some cells, or will express it at a decreased level, as the DNA is now disrupted by the antibiotic resistance gene.
  • the DNA will be at least about 1 kilobase (kb) in length and preferably 3-4 kb in length, thereby providing sufficient complementary sequence for hybridization when the knockout construct is introduced into the genomic DNA of the ES cell (discussed below).
  • mammals in which two or more genes have been knocked out.
  • Such mammals can be generated by repeating the procedures set forth herein for generating each knockout construct, or by breeding to mammals, each with a single gene knocked out, to each other, and screening for those with the double knockout genotype.
  • Regulated knockout animals can be prepared using various systems, such as the tet-repressor system (see US Patent No. 5,654,168) or the Cre-Lox system (see US Patents No. 4,959,317 and No. 5,801,030).
  • transgenic animals are created in which (i) a human RPS 19 having different sequences at particular polymo ⁇ hic positions are stably inserted into the genome of the transgenic animal; and/or (ii) the endogenous RPS 19 genes are inactivated and replaced with human RPS 19 genes having different sequences at particular polymo ⁇ hic positions.
  • a human RPS 19 having different sequences at particular polymo ⁇ hic positions are stably inserted into the genome of the transgenic animal; and/or (ii) the endogenous RPS 19 genes are inactivated and replaced with human RPS 19 genes having different sequences at particular polymo ⁇ hic positions.
  • Agents according to the invention may be identified by screening in high-throughput assays, including without limitation cell-based or cell-free assays. It will be appreciated by those skilled in the art that different types of assays can be used to detect different types of agents. Several methods of automated assays have been developed in recent years so as to permit screening of tens of thousands of compounds in a short period of time. Such high-throughput screening methods are particularly preferred. The use of high-throughput screening assays to test for agents is greatly facilitated by the availability of large amounts of purified polypeptides, as provided by the invention.
  • Kits The components required to practice the screening methods described above can be prepared in kit form, for the convenience of the user. Such kits are preferably adapted for use in an automated screening apparatus.
  • the present invention provides for identification of RPS 19 binding partners, which can then be analyzed for mutations that are associated with other forms of aplastic or hypoplastic anemias.
  • One method for identifying such binding partners is a yeast two-hybrid assay system, preferably using a hematopoietic stem cell library with yeast that are transformed with recombinant RPS 19.
  • RPS 19 can be used to affinity purify proteins from cell preparations. Again, the preferred source material for such preparations is hematopoietic stem cells.
  • Partially purified preparations can be probed with labelled RPS 19 to identify specific binding partners, e.g., in a Western-type or other antibody- assay type of system (see the description above of antibodies for examples of such assays; naturally, any protein can be labelled as an antibody and its binding to a binding partner evaluated).
  • genetic variants of RPS 19 can be detected to diagnose an aplastic anemia.
  • the various methods for detecting such variants are described herein. Where such variants impact RPS 19 function, either as a result of a mutated amino acid sequence or because the mutation results in expression of a truncated protein, or no expression at all, they are expected to result in an aplastic or hypoplastic anemia.
  • a mutation results in DBA.
  • sample refers to a biological sample, such as, for example, tissue (or cells) or fluid isolated from an individual or from in vitro cell culture constituents, as well as samples obtained from the environment or laboratory procedures.
  • the DNA may be obtained from any cell source.
  • Non-limiting examples of cell sources available in clinical practice include without limitation blood cells, buccal cells, cervicovaginal cells, epithelial cells from urine, fetal cells, or any cells present in tissue obtained by biopsy.
  • Cells may also be obtained from body fluids, including without limitation blood, plasma, serum, lymph, milk, cerebrospinal fluid, saliva, sweat, urine, feces, and tissue exudates (e.g., pus) at a site of infection or inflammation.
  • DNA is extracted from the cell source or body fluid using any of the numerous methods that are standard in the art. It will be understood that the particular method used to extract DNA will depend on the nature of the source. Generally, the minimum amount of DNA to be extracted for use in the present invention is about 25 pg (corresponding to about 5 cell equivalents of a genome size of 4 x 10 9 base pairs). Sequencing methods are described in detail, supra.
  • RNA is isolated from biopsy tissue using standard methods well known to those of ordinary skill in the art such as guanidium thiocyanate-phenol-chlorofo ⁇ n extraction (Chomocyznski et al, Anal. Biochem., 162:156, 1987).
  • the isolated RNA is then subjected to coupled reverse transcription and amplification by polymerase chain reaction (RT-PCR), using specific ohgonucleotide primers that are specific for a selected site.
  • RT-PCR polymerase chain reaction
  • Conditions for primer annealing are chosen to ensure specific reverse transcription and amplification; thus, the appearance of an amplification product is diagnostic of the presence of a particular genetic variation.
  • RNA is reverse- transcribed and amplified, after which the amplified sequences are identified by, e.g., direct sequencing.
  • cDNA obtained from the RNA can be cloned and sequenced to identify a mutation.
  • biopsy tissue is obtained from a subject.
  • Antibodies that are capable of distinguishing between different polymo ⁇ hic forms of RPS 19 are then contacted with samples of the tissue to determine the presence or absence of a RPS 19 polypeptide specified by the antibody.
  • the antibodies may be polyclonal or monoclonal, preferably monoclonal. Measurement of specific antibody binding to cells may be accomplished by any known method, e.g., quantitative flow cytometry, or enzyme-linked or fluorescence-linked immunoassay.
  • kits for the determination of the sequence within the RPS 19 gene in an individual comprise a means for determining the sequence at the variant positions, and may optionally include data for analysis of mutations.
  • the means for sequence determination may comprise suitable nucleic acid-based and immunological reagents.
  • the kits also comprise suitable buffers, control reagents where appropriate, and directions for determining the sequence at a polymo ⁇ hic position.
  • nucleic Acid Based Diagnostic Kits The invention provides nucleic acid-based methods for detecting genetic variations of RPS 19 in a biological sample.
  • the sequence at particular positions in the RPS19 gene is determined using any suitable means known in the art, including without limitation hybridization with specific probes and direct sequencing.
  • the present invention also provides kits suitable for nucleic acid-based diagnostic applications.
  • diagnostic kits include the following components:
  • Probe DNA The probe DNA may be pre-labelled; alternatively, the probe DNA may be unlabelled and the ingredients for labelling may be included in the kit in separate containers; and
  • Hybridization reagents The kit may also contain other suitably packaged reagents and materials needed for the particular hybridization protocol, including solid-phase matrices, if applicable, and standards.
  • diagnostic kits include:
  • Sequence determination primers Sequencing primers may be pre-labelled or may contain an affinity purification or attachment moiety
  • the kit may also contain other suitably packaged reagents and materials needed for the particular sequencing protocol.
  • the kit comprises a panel of sequencing primers, whose sequences correspond to sequences adjacent to variant positions.
  • the invention also provides antibody-based methods for detecting mutant (or wild type) RPS 19 proteins in a biological sample.
  • the methods comprise the steps of: (i) contacting a sample with one or more antibody preparations, wherein each of the antibody preparations is specific for mutant (or wild type) RPS 19 under conditions in which a stable antigen-antibody complex can form between the antibody and RPS 19 in the sample; and (ii) detecting any antigen-antibody complex formed in step (i) using any suitable means known in the art, wherein the detection of a complex indicates the presence of mutant (or wild type) RPS 19.
  • immunoassays use either a labelled antibody or a labelled antigenic component (e.g., that competes with the antigen in the sample for binding to the antibody).
  • Suitable labels include without limitation enzyme-based, fluorescent, chemilummescent, radioactive, or dye molecules.
  • Assays that amplify the signals from the probe are also known, such as, for example, those that utilize biotin and avidin, and enzyme-labelled immunoassays, such as ELISA assays.
  • Diagnostic kits typically include one or more of the following components:
  • RPS19-specif ⁇ c antibodies The antibodies may be pre- labelled; alternatively, the antibody may be unlabelled and the ingredients for labelling may be included in the kit in separate containers, or a secondary, labelled antibody is provided; and (ii) Reaction components: The kit may also contain other suitably packaged reagents and materials needed for the particular immunoassay protocol, including solid-phase matrices, if applicable, and standards.
  • kits referred to above may include instructions for conducting the test. Furthermore, in preferred embodiments, the diagnostic kits are adaptable to high-throughput and/or automated operation.
  • the present invention contemplates various strategies for treatment of diseases or disorders associated with a defect in the expression of a functional RPS 19 gene, e.g., an aplastic or hypoplastic anemia. Also provided are methods of treatment for a disease or disorder associated with hype ⁇ roliferative disorders, e.g., ove ⁇ roduction of bone marrow derived cells or blood cancers.
  • a subject in whom such treatment is desired will be a human.
  • teachings herein to treat similar diseases in any animal, particularly any mammal.
  • compositions of the invention are preferably prepared by an admixture of the active component (e.g., a vector or anti-sense nucleic acid) and a pharmaceutically acceptable carrier or excipient.
  • active component e.g., a vector or anti-sense nucleic acid
  • pharmaceutically acceptable refers to molecular entities and compositions that are physiologically tolerable and do not typically produce an allergic or similar untoward reaction, such as gastric upset, dizziness and the like, when administered to a human.
  • pharmaceutically acceptable means approved by a regulatory agency of the Federal or a state government or listed in the U.S. Pharmacopeia or other generally recognized pharmacopeia for use in animals, and more particularly in humans.
  • carrier refers to a diluent, adjuvant, excipient, or vehicle with which the compound is administered.
  • Such pharmaceutical carriers can be sterile liquids, such as water and oils, including those of petroleum, animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil and the like.
  • Water or aqueous solution saline solutions and aqueous dextrose and glycerol solutions are preferably employed as carriers, particularly for injectable solutions. Suitable pharmaceutical carriers are described in "Remington's Pharmaceutical Sciences” by E.W. Martin.
  • a treatment of aplastic or hypoplastic anemia involves transferring a vector comprising a gene for a functional RPS 19 into target cells, preferably hematopoietic stem cells or bone marrow cells, of a subject suffering from aplastic or hypoplastic anemia.
  • target cells preferably hematopoietic stem cells or bone marrow cells
  • the gene transfer techniques and vectors described above are particularly suited for this sort of gene therapy.
  • lentivirus vectors are preferred for delivery of the therapeutic RPS 19 gene to bone marrow/hematopoietic stem cells.
  • the RPS 19 coding sequence is operatively associated with a promoter that permits high level expression in human cells, and preferably in hematopoietic stem cells.
  • RPS 19 gene therapy is particularly useful for treatment of DBA
  • augmenting RPS 19 activity will benefit subjects suffering from other forms of aplastic or hypoplastic anemia.
  • the therapeutic aspects of this invention are broader than the treatment of DBA.
  • enough RPS 19 vector must be delivered so that enough cells must be transformed with an RPS 19 gene therapy vector to overcome the anemic condition.
  • the determination of the dose of an RPS 19 gene therapy vector depends on the type of vector, how it is delivered, and the susceptibility and receptivity of the subject. All of these factors can be determined by routine dosing methods well known in the art.
  • an agonist of RPS 19 activity e.g., a molecule that overcomes a mutation of an RPS 19 gene that results in a defect in expression of functional RPS 19, that is discovered using the screening techniques of the present invention, can be used.
  • RPS 19 functional activity include mutant RPS 19 proteins, RPS 19 antisense oligonucleotides, anti-RPS19 intracellular antibodies, and molecular inhibitors of RPS 19 functional activity that are discovered as described in this application.
  • antisense nucleic acids The function of antisense nucleic acids is well understood and documented.
  • An antisense ohgonucleotide may be delivered to the cell, e.g., as a pharmaceutical agent.
  • antisense gene can be delivered to the cell, e.g., using the technique described above, for expression of an RNA that is complementary to an RPS 19 mRNA. Only those cells that express RPS 19 would be affected in such an embodiment.
  • Intracellular antibodies (sometime referred to as "intrabodies”) have been used to regulate the activity of intracellular proteins in a number of systems (see, Marasco, Gene Ther. 4:11, 1997; Chen et al, Hum. Gene Ther.
  • RPS 19 inhibitory gene therapies can be administered, and dosages determined, as described above using routine experimentation.
  • 29 multiplex DBA families and 50 families comprising sporadic DBA cases were analyzed using polymo ⁇ hic 19ql3 markers, including a newly identified short tandem repeat in the critical gene region.
  • the results from DNA analysis of 29 multiplex families revealed that 26 were consistent with a DBA gene on 19q localized within a 4.1 cM interval restricted by loci D19S200 and D19S178.
  • the DBA candidate region on 19ql3 was excluded from the segregation of marker alleles.
  • Fetal hemoglobin and ADA were not consistently determined in all family members as the tests were not available at some hospitals.
  • a variety of associated malformations were identified among the affected patients including skeletal anomalies of the hand and forearm, heart defects, cataract and short stature.
  • Mental retardation associated with DBA was found in 7 sporadic cases.
  • Family members were considered non-affected if they had normal hemoglobin levels for two or more years, no history of transient anemia or of transfusion requirements, and by exclusion of associated physical anomalies including clinical examination of the hands. Co-existence of mild and severe anemia were observed in several multiplex families.
  • Fanconi anemia was excluded by chromosome fragility test (mitomycin C or diepoxybutane) in at least one affected member per family (frequency of breakage ⁇ 10%).
  • chromosome fragility test mitomycin C or diepoxybutane
  • the same individuals were also karyotyped by conventional cytogenetic studies.
  • One sporadic DBA patient had an apparently balanced de novo translocation, t(8;19)(q35;ql3). Lymphoblastoid cell lines were established from peripheral blood of a few patients, by transformation with the Epstein-Barr virus, for further genetic analysis.
  • the minimal diagnostic criteria included normochromic anemia in infancy (less than 2 years), low reticulocyte counts, absent or decreased bone marrow red cell precursors (less than 5% of nucleated cells) and a normal chromosome fragility test (mitomycin C or dipolybutane). Additional characteristic included presence of malformations, macrocytosis, elevated fetal hemoglobin and elevated erythrocyte adenosine deaminase (ADA) levels (Glader et al, Br. J. Haemal 68:165-168, 1988).
  • ADA erythrocyte adenosine deaminase
  • the polymo ⁇ hic dinucleotide repeats D19S200, D19S197, LIPE, D19S408 and D19S178, assigned to the 19ql3 region were amplified from genomic DNA of all families as decribed elsewhere (Gustavsson et al, Nat. Genet., 16:368-371, 1997).
  • a newly identified polymo ⁇ hic repeat, PG1 (GenBank accession number L32754), was located within the critical DBA gene region between markers D19SI97 and LIPE.
  • the PG1 repeat was amplified from genomic DNA of the families with the specific primers: 5'-TGATGTTGCCACAGCACTTC (SEQ ID NO: 12), forward and; 5'CTCTCTGAGTCTACAACCAG (SEQ ID NO: 13), reverse.
  • PCR was carried out at optimized conditions for genomic DNA using primers end-labelled with ⁇ - 32 P-ATP.
  • the PCR reactions were performed in 96-well microtitre plates, in a reaction volume of 10 ⁇ l, with 20 ng of genomic DNA.
  • the PCR mixture contained 2 pmol of each primer, 0.1 mM of each of the four deoxytrinucleotide triphosphates and 0.5 U of Taq DNA polymerase.
  • PCR conditions were 4 min at 94°C (denaturing), followed by 28 cycles of 30 sec at 94°C, 30 sec at 55°C and 30 sec at 72°C.
  • PCR products were separated on polyacrylamide gels using electrophoresis and visualized by autoradiography. The genotypes and the haplotypes were assigned manually.
  • GDB Genome Data Base
  • marker loci centromere-D19S200-D19SI97PGl-LIPE-D19S408-D19S178-telomere.
  • Two-point lod scores were performed using the FASTLINK version 3.
  • OP Lathrop et al, Am. J. Hum. Genet., 3:460-465, 1984
  • LINKAGE analysis computer package Ott, J. Analysis of Human Genetic Lilnkage, The Johns Hopkins Press, 1991).
  • FISH analyses of microdeletions Chromosome preparations from three DBA patients showing constitutional microdeletions for the 19ql3 region were analyzed by FISH. The deletion found in patient RG was described previously (Gustavsson et al, supra, 1997). Fluorescent in situ hybridization to metaphase chromosomes was performed essentially as described elsewhere (Lichter et al, Human Genet. 80:224-234, 1988; Gustavsson et al, J. Med. Genet., 34:779-782, 1997). Cosmid DNA was labelled either with biotin or digoxigenin using nick translation.
  • Hybridization of probes was detected by the application of a single layer of FITC-avidin (Vector labs) or rhodamine labelled anti-digoxigenin (Boehringer Mannheim). Double hybridization was detected using a mixture of FITC-avidin and rhodarnine labelled anti-digoxigenin. Chromosomes were counterstained with DAPI (Serva) and mounted in antifade solution (Vector labs). The slides were analysed with a Zeiss Axioskop epifluorescence microscope and images were merged using a CCD camera (Photometries) and the Quips SmartCapture FISH software (Vysis).
  • Cosmids A physical map has been constructed over the 19ql3 region (Ashworth et al, supra, 1995; Mohrenweiser et al, supra, 1996).
  • the chromosome 19 cosmids used were obtained exclusively from LLNL with their corresponding numbers (Ashworth et al, 1995). In total, 7 cosmids were used for FISH analyses and their relative order from the centromere to the telomere is: 9476 (RYR1), 16767
  • CYP2A12 14353 (CGMI), 24450 (ATP1A3), 19343 (D19S336), 9933 (CGM9) and 8764 (XRCC1).
  • the clinical picture was typical for DBA (diagnostic criteria included age of onset, bone marrow biopsies, reticulocyte counts and chromosome fragility tests) and similar to patients from families in which the 19q markers co-segregate with DBA. Fetal hemoglobin measurements were available only from affected individuals of family I (see Figure 1) and the levels were found elevated. With the exception of families I-III, no evidence for genetic heterogeneity was found. However, in five families with a dominant mode of inheritance for DBA, the disease associated chromosome 19 haplotype was also transmitted to a healthy family member (>2 years and normal hemoglobin levels) ( Figure 2).
  • Haplotype analysis in sporadic DBA cases Fifty families comprising a sporadic case of DBA, parents and at least one healthy sibling were analyzed for the segregation of 19q marker alleles at loci D19S200, D19S197, PG1, LIPE, D19S408 and D19S178. Apparent loss of parental alleles was observed in three affected individuals. The three patients presented with common clinical features in addition to DBA including mental retardation and skeletal malformations of the long bones and the spine. Patient MH, who carries an apparent balanced translocation t(8;19)(q35;ql3), was hemizygous for the microsatellite loci D19S197 and PG1 with loss of the paternal allele.
  • markers D19S197, PG1 and LIPE revealed loss of the maternal alleles.
  • markers PG1 and LIPE revealed loss of the paternal alleles ( Figure 3).
  • the segregation of marker alleles was analyzed in 93 healthy siblings to sporadic DBA patients. Forty-eight healthy siblings shared one inherited 19ql3 haplotype with the proband, twenty-three shared both 19ql3 haplotypes and twenty-two did not share any haplotype. The results indicate an almost random segregation of marker alleles on chromosome 19q to healthy siblings of sporadic DBA cases.
  • the size of the common overlap of the microdeletions is approximately 1 Mb and the region spans more than 10 genes (Ashworth et al, supra, 1995; Mohrenweiser et al, supra, 1996).
  • the cause of DBA is not known and the large number of genes mapped to the deleted interval does not yet allow the identification of the gene responsible for the disease.
  • ESTs expressed sequence tags
  • ESTs expressed sequence tags
  • gene families are clustered in the region corresponding to the microdeletions.
  • CEA carcinoembryonic antigen
  • CGM CEA gene family members
  • PSG pregnancy specific glycoprotein
  • the CEA gene family encodes a large family of glycoproteins with an unknown function. Tandemly repeated and homologous sequences may predispose to homologous unequal recombination. Such events have been suggested to be the mechanism for microdeletions in chromosome 17pll.2 associated with Smith-Magenis syndrome (Chen et al, Nat. Genet., 17:154-163, 1997). However, a similar mutation mechanism needs to be confirmed by DNA sequencing of the deletion breakpoints in patients described herein.
  • the cloning of translocation breakpoints from rare patients with a specific phenotype has proven one method for the positional identification of disease genes.
  • This approach described above, has identified transcribed sequences adjacent to the translocation breakpoint on chromosome 19ql3 associated with DBA.
  • the present example reports the cloning of this chromosome 19 translocation breakpoint which interrupts the gene encoding the ribosomal protein S19 (RPS 19). Mutations in the RPS 19 gene were identified in several unrelated DBA cases and the data presented herein provide convincing evidence that mutations in this gene cause DBA. These results suggest an involvement of the RPS 19 gene in erythroid differentiation and proliferation, as well as in the normal development of other tissues frequently affected in DBA.
  • Samples were obtained from patients as described in Example 1. FISH analysis. Chromosome preparations from the patient with t(X; 19) were analyzed by FISH as described in Example 1.
  • M13 clones were grown in a 96-well format and high-quality DNA templates were prepared using a 96-well glass-fiber filter protocol as described by Andersson et al, Biotechniques, 20(6): 1022- 1027, (1996a).
  • RP4 (5'-CAAGGAATTGTTTACCTGAGAC-3') (SEQ ID NO: 18), and RP3(5'-TGGAAATGCTTGGGCAGCG-3') (SEQ ID NO: 19); and for the 354 bp fragment: RP20(5'-CCTTGAGACCCAGTTTCCAC-3') (SEQ ID NO:20), and RP19(5'-CATTTGAACCCAGAAGGCGG-3') (SEQ ID NO:21).
  • Amplification was carried out with 200 ng template DNA in 50 ml reactions using Taq polymerase (Perkin Elmer Cetus).
  • Amplification bands were excised from 1% agarose gels, purified using QIAquick spin columns (Qiagen), and sequenced using ABI dye- terminator sequencing kits. Mutations were sequenced on both strands derived from independant PCR reactions for the verification of mutations. Mutations were analyzed on several family members in all multiplex families.
  • the presence of the missense mutations was confirmed by restriction digestion due to the loss of a RstUI site (pedigrees DF04, DS05) and a Bsrl site (pedigree DS08).
  • the mutations were analyzed by genomic amplification by appropriate restriction digestion using the primer pair RP3 and RP4 for the RstUI site and primer pair RP 13 and R51 (5'-CCACGGTTTAGGATGGCGTG-3') (SEQ ID NO:22) for the Rsrl site.
  • RNA isolation, RT-PCR and cDNA synthesis Total RNA was extracted from EBV transformed lymphoblastoid cell lines as described previously (Chomczynski and Sacchi 1987).
  • First strand cDNA for RT-PCR was synthesized using a primer co ⁇ esponding to nucleotides 448-469 in RPS19 cDNA (5'- GAGGCAATTTATTAACCCAGCA-3') (SEQ ID NO:23).
  • the cDNA was amplified using the first strand synthesis primer and a forward primer (5'- GACCCTACGCCCGACTTGTG-3') (SEQ ID NO:24) designed from the nucleotides (-76)-(-57).
  • PCR was performed with an initial cycle of 94°C for 3 min, then 34 cycles of 94°C for 40 sec, 62°C for 40 sec, 72°C for 60 sec, followed by 72°C for 10 min. Control reactions for the RT-PCR without reverse transcriptase were run in all experiments in order to exclude contaminations of genomic DNA containing RPS 19 homologous sequences.
  • RNA 15 mg was denatured in formamide and fractionated in an 1% gel containing formaldehyde (4 ml/ 100 ml gel). After electrophoresis, the RNA was transferred to nitrocellulose filters. Northerns containing EBV transformed lymphoblastoid mRNA from 18 DBA patients and the multiple tissue Northen blots 7760-1 and 7768-1 (Clontech) were hybridized according to Pettersson et al. (Blood, 86:2747-2753, 1995).
  • Hybridization probes were labelled by random priming with 32 P-(dCTP) and hybridized for 16 h at 42°C in 50% formamide, 5X SSC, IX Denhardt's solution, 20 mM phosphate buffer (pH 7.6), 1% SDS and 100 ⁇ g/ml salmon sperm DNA. The filters were then washed twice in 2X SSC and 0.5%SDS at 60°C. Southern blot analysis of DNA from leukocytes and spotted human genomic PAC library 709 (http://resource.rzpd.de/cgi-resource/newlib) were hybridized as described previously (Oberle et al. , Hum. Genet., 72(l):43-49, 1986). Kodak XAR-5 film was exposed at -70°C with Dupont Cronex Lightning Plus intensifying screens. The relative signal intensity for RPS 19 and RPS29 was assesed by densitometric scanning.
  • Hybridization probes were gel-purified DNA fragments amplified from a human thymus cDNA library (Clontech HL5010b).
  • a 450 bp probe for the human RPS 19 cDNA was generated by the primers F(5'- CCGCACGATGCCTGGAGTTA-3') (SEQ ID NO:25) and R(5'- CCAGCATGGTTTGTTCTAATGC-3') (SEQ ID NO:26).
  • Probes for exon 3 of the human RPS 19 cDNA were amplified with the intron derived primers F(5'- TTGTACTCTGGGCACAGCA-3') (SEQ ID NO:27) and
  • Rho-GEF The cDNA probe for Rho-GEF was amplified with primers (5'- GGGGGATCCCACGTGGCCCTGCAGTTT-3') (SEQ ID NO:31) and R(5'-
  • the cDNA probe for IGA (CD79a) was amplified with primers F(5'-GACTGCTGCAACTCAAACTAACC-3') (SEQ ID NO:33) and R(5'-GGAAGTGAGCTGAGACACTGG-3') (SEQ ID NO:34).
  • the human RPS29 probe of 290 bp was amplified using the primers F(5'- TTACCTCGTTGCACTGCTGA-3') (SEQ ID NO:35) and R(5'-
  • Human ESTs with homology to RRS7P D28389, AA170846, R68032.
  • Human genomic RPS19 sequences AF092906 (SEQ ID NO:l) and AF092907 (SEQ ID NO:2).
  • Human RRS2P cDNA U14973.
  • Mouse RPS19 cDNA W54527.
  • Rat RRSiP cDNA X51707.
  • cosmids from a chromosome 19 map were hybridized to metaphase chromosomes from the patient.
  • the 19ql3 breakpoint was found to be located in a 400 kb region flanked by the cosmids 14353 and 24450 (LLNL, CA).
  • cosmid 27589 three overlapping cosmids were tested of which one, cosmid 27589, showed hybridization signals on both chromosome 19 derivatives from the patient with a t(X;19). This suggested that the cosmid spans the breakpoint.
  • Exon Exon 3' splice site SEQ 5' splice site SEQ number size ID ID (bp) NO NO 1 159 AGGCCGCACGgtaagcggg 39 g
  • the RPS 19 gene is 11 kb in size and 6 exons were identified (Figure 6).
  • the first exon is untranslated and contains a polypyrimidine stretch of 13 nucleotides.
  • the ATG corresponding to the start codon (AUG) in the cDNA is located at the beginning of exon 2.
  • No TATA box or CAAT box were identified, but genomic sequence analysis of 1,260 bp upstream of the translational start revealed several sequence motifs that matched human promotor elements.
  • the genomic sequence including the 5'UTR and the first intron has a GC content of 75% over a 646 bp segment.
  • the RPS 19 coding sequence predicted from the sequenced cosmid was was identical to the RPS19 cDNA sequence (GenBank Accession M81757). Further comparison of the genomic sequence to the restriction fragments identified by the RPS19 cDNA revealed that the 19ql3 breakpoint was located in the third intron ( Figure 6).
  • the 5' UTR contains an oligopyrimidine tract of 13 nucleotides including the core motif CTTTCC observed in several other mRNAs encoding ribosomal proteins (Wool et al, in: Translational Control, Cold Spring Harbor Laboratory Press, 685-718, 1996a).
  • the 3' UTR spans 40 nucleotides and the predicted size of the RPS 19 transcript is 635 bp from the two spliced ESTs and the published cDNA.
  • the expression pattern of the gene was evaluated by Northern blot analysis.
  • the RPS 19 gene was screened for mutations in unrelated probands with DBA to conclusively demonstrate that it causes disease. Forty probands, twenty-one with a family history for the disease and nineteen sporadic cases, were analyzed by direct sequencing on genomic DNA. Thirty of these proved to have a normal sequence corresponding to the 5 'UTR and the five translated exons. A total of nine different mutations were found in the RPS 19 gene of 10 probands (Table 3). Six of these patients had a family history of the disease and the mutations were found to cosegregate with affected family members.
  • the sisters were discordant for associated malformations; one of them presents with thumb malformations and duplicated urether whereas the other has congenital glaucoma.
  • the mother has normal hemoglobin levels and no malformations.
  • An A to G transition within the start codon was found in family F18.
  • the three affected family members presented with similar degrees of hypoplastic anemia. The transition was verified in RT-PCR products from lymphoblastoid derived mRNA of the proband. Different single nucleotide insertions were identified in two sporadic cases. One insertion of an A is located in exon 2 (13 insert A; family S14) and predicts a frameshift after codon 4.
  • exon 3 104 insert A; family SI 1
  • a G to T transversion that alters the acceptor splice site of exon 2 was found in a proband and that of his affected father (family F38; Figure 8 A).
  • the mutation predicts a truncated transcript missing exon 2.
  • a 4 bp deletion was found in the donor splice site of intron 2 (AAgtgagtttggg [SEQ ID NO: 10] to AAgtttggg [SEQ ID NO: 11]) in the mother and four children of family F03, which shows a dominant segregation.
  • a disruption of the consensus donor splice site was predicted when the sequence was analyzed with a human splice site prediction program (Brunak et al, J. Mol. Biol, 220:49-65, 1991).
  • a C to T transition at position 184 from the start codon was identified in two non- related patients of Swedish and Italian origin (F04 and S05). The patients do not share a flanking haplotype suggesting recurrent mutation events. This substitution results in the replacement of arginine with tryptophan (Arg62T ⁇ ).
  • the mutation was found to segregate with the two affected individuals of the Swedish family whereas the mutation in the Italian family had occurred de novo in a sporadic case ( Figures 8B and 8C).
  • Northern blot analysis was performed using lymphoblastoid mRNA derived from 4 controls and 20 DBA patients. Three of these patients had deletions spanning the RPS 19 gene (Example 1). Northern analysis showed a single 0.6 kb band in all patients (not shown). The same blots were also hybridized with the RPS29 probe and the ratio of RPS29 to RPS 19 signal intensity was assessed by densitometric analysis.
  • Ribosomal protein S19 consists of 145 amino acids with a predicted molecular weight of 16 kD.
  • the protein is basic having an isoelectric point of 10.3.
  • the hydropathy profile predicts the presence of hydrophobic domains which suggests their interaction with other ribosomal proteins.
  • the protein lacks cystein residues.
  • BLASTN homology searches at the peptide level, BLASTX, BLASTP and BEAUTY searches revealed highly significant homologies of RPS 19 to proteins from diverse organisms.
  • DBA is a model for abberrant differentiation of the erythroid lineage.
  • the specific absence, or reduced levels, of erythroid precursors in the bone marrow suggests that the deficient protein has a key regulatory role in erythropoiesis.
  • the frequent anomalies associated with DBA such as heart, eye and urinary tract malformations, short stature and skeletal malformations, suggest a function of this protein in organogenesis.
  • a strong candidate gene encodes the ribosomal protein S19 associated with the ribosomal 40S subunit (Lutsch et al, Eur. J. Cell Biol, 51(1):140-150, 1990; Kondoh et al, Cancer Res., 52(4):791-796, 1992).
  • RPS 19 DNA from affected individuals were screened for mutations in this gene. Mutations in ten out of - forty patients (25%) with DBA were identified. Seven mutations were predicted to result in truncated transcripts and/or truncated proteins. The six RPS 19 mutations identified in multiplex families were found to cosegregate with the DBA phenotype and the observation of mutations in consecutive generations shows an autosomal dominant mode of transmission. Although the penetrance for RPS 19 mutations appear high, incomplete penetrance was observed in one of the families and a variable expression was seen in several families.
  • the genes are homologous on the X and Y chromomal region for part of the Turner phenotype which is caused by haploinsufficiency of the region including S4.
  • the data are inconclusive. Due to the large number of transcribed ribosomal genes scattered throughout the genome (Kenmochi et al, Genome Res. 8(5):509-523, 1998) several of these would be expected to be involved in deletions, chromosomal rearrangements or, point mutations.
  • the ribosome is known to be essential for cellular growth and the findings of a ribosomal protein as a cause of DBA presented herein is unexpected in view of the fact that clinical symptoms in the majority of patients are confined to the erythropoiesis. Other cell types requiring a likewise high proliferation rate, e.g., intestinal mucosa cells, are not affected in DBA, suggesting that deficiency of the RPS 19 protein is not rate limiting in most tissues.
  • a collection of mutations in D. melanogaster at about 50 loci have been designated Minute (FlyBase: A Drosophila database, Nucl. Acids Res., 25:63, 1997). Flies with the Minute phenotype have delayed larval development, diminished viability, reduced body size, decreased fertility and thin bristles. Several Minute genes have been identified and all encode ribosomal proteins (Kongsuwan et al, Nature, 317(6037):555-558, 1985; Hart et al, Mech. Dev.
  • the nematode Ascaris lumbricrdes has two homologous genes encoding RPS, one of which is eliminated (S19G) in presomatic cells during early development (Etter, et al, Science, 265:954-956, 1994). It is speculated that the S19G copy, encoding a protein that differs at 24 amino acids from the somatic S19 copy, has a function in early embryogenesis apart from the ribosome (Wool, I.G., Extraribsomal functions of ribosomal proteins, in Ribosomal RNA and Group I Introns, eds. Green and Schroeder, pp. 153-178, R.G. Landes Co., 1996). This is supported by the preserved preferential transcription of Si PG in germ cell lines.
  • Drosophila melanogaster this is exemplified by mutations in the genes encoding ribosomal proteins S2, S6 and L19, respectively.
  • Mutant S6 results in hypertrophied haemopoietic organs (Watson et al, Proc. Natl Acad. Sci. 89(23): 11302-11306, 1992)
  • mutants LI 9 displays an abnormal wing blade development (Hart et al, Mech. Dev. 43(2-3):101-l l l, 1993)
  • S2 mutations string-of-pearls
  • result in an arrest of oogenesis at stage 5 of development Cramton and Laski, Genetics, 137(4):1039-1048, 1994.
  • the clinical features of DBA suggest extraribosomal and tissue specific functions for RPS 19.
  • the ribosome having a basic structural conservation between procaryotes and eucaroyotes is comprised of approximately 80 proteins and four RNA molecules (Ramakrishnan and White, Trends Biochem. Sci. 23(6):208-212, 1998; Wilson and Noller, Cell, 92(3):337-349, 1998).
  • the ribosomal proteins constitute a major component of cellular proteins but their individual functions, apart from being associated with the ribosome, are barely known (Wool et al. , Cold Sprin Harbor Laboratory Press, 685-718, 1996).
  • the ribosome is assembled in the nucleolus and requires a single copy of each of the ribosomal proteins (Meyuhas et al, Cold Spring Harbor Laboratory Press, 363-388, 1996). With the lack of a single protein, the entire ribosome is lost. Consequently, deletion of any of the ribosomal protein genes are believed to result in a substantially reduced growth rate.
  • the expression of rRNA and ribosomal proteins is coordinated and correlates with the requirements for protein synthesis at different rates of growth (Meyuhas et al, Cold Spring Harbor Laboratory Press, 363-388, 1996). In vertebrates, the control of ribosomal protein gene expression at the translational level is the most prevalent regulatory mechanism (Avni et al, Mol.
  • the regulatory cis-acting elements consists of a 5' oligopyrimidine tract (5' TOP) located in the 5'UTR of the mRNAs (Meyuhas et al, Cold Spring Harbor Laboratory Press, 363-388, 1996). This 5' TOP, also shared by RPS 19, is critical for the translational control of ribosomal proteins (Levy et al, Proc. Natl Acad. Sci. 88(8):3319-3323, 1991; Avni et al, Mol. Cell. Biol, 14(6):3822-3833, 1994).
  • a genetic linkage analysis showed at least 10% of multiplex families harbor a gene unlinked to chromosome 19q 13. From the sequencing of the RPS 19 ORF in patients with DBA mutations in approximately 25% of these patients with similar figures for sporadic and familiar cases were identified herein. The unexpectedly low proportion of RPS 19 mutations found in multiplex families may have several explanations. One possibility is that mutations in regulatory elements or in other non-coding regions of the RPS 19 gene are involved. Furthermore, small deletions involving one or both primers used to generate sequencing templates from genomic DNA may have escaped identification. Another possibility is that the DBA phenotype in some of the smaller families included in previous linkage analyses segregates with 19ql3 by chance.
  • Primer pairs were designed from the third and fourth exons, respectively. The strategy emerged from the consideration that pseudogenes would cross-amplify with the structural gene.
  • Results from PCR across intron 4 revealed an amplicon of 732 bp in one out of the 24 clones. Sequencing verified that this clone correspond to the structural RPS 19 gene. From the remaining 23 clones the sizes of the amplicons across intron 4 were approximately 240 bp, which corresponds to the size of amplicons from the RPS 19 cDNA. The results suggest that the 23 clones harbor processed pseudogenes.
  • the primer pair spanning exon two to exon six was used to amplify genomic DNA.
  • the RPS 19 gene has been inserted into a retrovirus vector together with the marker gene FTP.
  • the construct was transduced into CD34+ cells selected from bone marrow of controls as well as two patients with Diamond-Blackfan anemia (DBA). After growth in vitro, FTP expressing cells were selected by FACS. These cells were further cultured and erythroid colony formation was evaluatede.
  • Bone marrow cells expressing FTP from the two DBA patients tested to date showed an approximately 4-fold increase in erythroid colony formation.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • Pathology (AREA)
  • Toxicology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Medicinal Chemistry (AREA)
  • Immunology (AREA)
  • Plant Pathology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

La présente invention concerne l'identification d'un gène qui est inactivé dans le cas d'une anémie aplasique. L'invention concerne, en particulier, des mutations qui dérèglent une protéine ribosomale, de préférence RP S19, dans le cas de l'anémie de Blackfan-Diamond. L'invention concerne également des acides nucléiques de recombinaison codant des formes mutantes de l'anémie de Blackfan-Diamond, des oligonucléotides spécifiques de ces mutations, ainsi que les applications diagnostiques et thérapeutiques associées à ces découvertes.
PCT/IB1999/001794 1998-11-09 1999-11-08 Variation genetique associee a l'anemie aplasique, et applications diagnostiques et therapeutiques basees sur cette variation WO2000028079A2 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU64834/99A AU6483499A (en) 1998-11-09 1999-11-08 Genetic variation associated with aplastic anemia, and diagnosis and therapy based thereon

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US10761398P 1998-11-09 1998-11-09
US60/107,613 1998-11-09
US11866499P 1999-01-26 1999-01-26
US60/118,664 1999-01-26

Publications (2)

Publication Number Publication Date
WO2000028079A2 true WO2000028079A2 (fr) 2000-05-18
WO2000028079A3 WO2000028079A3 (fr) 2000-08-31

Family

ID=26804964

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/IB1999/001794 WO2000028079A2 (fr) 1998-11-09 1999-11-08 Variation genetique associee a l'anemie aplasique, et applications diagnostiques et therapeutiques basees sur cette variation

Country Status (2)

Country Link
AU (1) AU6483499A (fr)
WO (1) WO2000028079A2 (fr)

Cited By (15)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001070789A1 (fr) * 2000-03-02 2001-09-27 Biowindow Gene Development Inc. Shanghai Nouveau polypeptide, proteine ribosomale humaine s5-17, et polynucleotide codant pour ce polypeptide
WO2001070780A1 (fr) * 2000-03-07 2001-09-27 Biowindow Gene Development Inc. Shanghai Nouveau polypeptide, proteine ribosomale humaine sii 12, et polynucleotide codant pour ce polypeptide
WO2001072811A1 (fr) * 2000-03-28 2001-10-04 Shanghai Biowindow Gene Development Inc. Nouveau polypeptide, proteine ribosomale humaine s4 15, et polynucleotide codant pour ce polypeptide
WO2001075048A2 (fr) * 2000-03-27 2001-10-11 Shanghai Biowindow Gene Development Inc. Nouveau polypeptide, proteine ribosomale humaine s11 23, et polynucleotide codant pour ce polypeptide
WO2001075028A2 (fr) * 2000-03-24 2001-10-11 Shanghai Biowindow Gene Development Inc. Nouveau polypeptide, proteine ribosomale humaine s4-12, et polynucleotide codant pour ce polypeptide
WO2001075057A2 (fr) * 2000-03-29 2001-10-11 Biowindow Gene Development Inc. Shanghai Nouveau polypeptide, proteine ribosomale s4 humaine 12, et polynucleotide codant pour ce polypeptide
WO2001081396A1 (fr) * 2000-04-27 2001-11-01 Biowindow Gene Development Inc. Shanghai Nouveau polypeptide, proteine ribosomale s7 humaine 14, et polynucleotide codant pour ce polypeptide
WO2001087952A1 (fr) * 2000-05-19 2001-11-22 Biowindow Gene Development Inc. Shanghai Nouveau polypeptide, proteine ribosomale humaine 13, et polynucleotide codant ce polypeptide
WO2001087963A1 (fr) * 2000-05-09 2001-11-22 Shanghai Biowindow Gene Development Inc. Proteine s18-12 ribosomale, polypeptide humain, et polynucleotide la codant
WO2001090171A1 (fr) * 2000-05-16 2001-11-29 Shanghai Biowindow Gene Development Inc. Nouveau polypeptide, proteine humaine ribosomale sii 12, et polynucleotide codant ce polypeptide
WO2001090172A1 (fr) * 2000-05-24 2001-11-29 Shanghai Biowindow Gene Development Inc. Nouveau polypeptide, proteine ribosomale l39 13, et polynucleotide codant ce polypeptide
WO2001094371A1 (fr) * 2000-05-09 2001-12-13 Shanghai Biowindow Gene Development Inc. Nouveau polypeptide, proteine ribosomale humaine s4-10, et polynucleotide codant ce polypeptide
WO2001094532A2 (fr) * 2000-05-24 2001-12-13 Shanghai Biowindow Gene Development Inc. Nouveau polypeptide, proteine ribosomale l39 9, et polynucleotide codant ce polypeptide
WO2001094372A1 (fr) * 2000-05-16 2001-12-13 Shanghai Biowindow Gene Development Inc. Nouveau polypeptide, proteine ribosomale humaine s4, et polynucleotide codant ce polypeptide
WO2002020784A1 (fr) * 2000-06-07 2002-03-14 Shanghai Biowindow Gene Development Inc. Nouveau polypeptide, proteine ribosomale s1111.22, et polynucleotide codant ce polypeptide

Non-Patent Citations (6)

* Cited by examiner, † Cited by third party
Title
B\CK ET AL: "Tiamulin resistance mutations in Escherichia coli" JOURNAL OF BACTERIOLOGY, vol. 151, no. 3, 1982, pages 1253-1260, XP000907492 *
DRAPTCHINSKAIA N ET AL: "The gene encoding ribosomal protein S19 is mutated in Diamond-Blackfan anaemia." NATURE GENETICS, (1999 FEB) 21 (2) 169-75. , XP002138896 *
GUSTAVSSON P ET AL: "Identification of microdeletions spanning the Diamond-Blackfan anemia locus on 19q13 and evidence for genetic heterogeneity." AMERICAN JOURNAL OF HUMAN GENETICS, 63 (5) 1388-95. , 16 October 1998 (1998-10-16), XP002138894 *
KENMOCHI N ET AL: "A map of 75 human ribosomal protein genes." GENOME RESEARCH, (1998 MAY) 8 (5) 509-23. , XP002138895 cited in the application *
KONDOH N ET AL: "Differential expression of S19 ribosomal protein, laminin-binding protein, and human lymphocyte antigen class-I messenger RNAs associated with colon-carcinoma progression and differentiation" CANCER RESEARCH,US,AMERICAN ASSOCIATION FOR CANCER RESEARCH, BALTIMORE, MD, vol. 52, no. 4, 15 February 1992 (1992-02-15), pages 791-796-796, XP002119317 ISSN: 0008-5472 cited in the application *
MATSSON H ET AL: "Truncating ribosomal protein S19 mutations and variable clinical expression in Diamond-Blackfan anemia." HUMAN GENETICS, (1999 NOV) 105 (5) 496-500. , XP000913499 *

Cited By (19)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001070789A1 (fr) * 2000-03-02 2001-09-27 Biowindow Gene Development Inc. Shanghai Nouveau polypeptide, proteine ribosomale humaine s5-17, et polynucleotide codant pour ce polypeptide
WO2001070780A1 (fr) * 2000-03-07 2001-09-27 Biowindow Gene Development Inc. Shanghai Nouveau polypeptide, proteine ribosomale humaine sii 12, et polynucleotide codant pour ce polypeptide
WO2001075028A2 (fr) * 2000-03-24 2001-10-11 Shanghai Biowindow Gene Development Inc. Nouveau polypeptide, proteine ribosomale humaine s4-12, et polynucleotide codant pour ce polypeptide
WO2001075028A3 (fr) * 2000-03-24 2002-01-24 Shanghai Biowindow Gene Dev Nouveau polypeptide, proteine ribosomale humaine s4-12, et polynucleotide codant pour ce polypeptide
WO2001075048A2 (fr) * 2000-03-27 2001-10-11 Shanghai Biowindow Gene Development Inc. Nouveau polypeptide, proteine ribosomale humaine s11 23, et polynucleotide codant pour ce polypeptide
WO2001075048A3 (fr) * 2000-03-27 2002-03-14 Shanghai Biowindow Gene Dev Nouveau polypeptide, proteine ribosomale humaine s11 23, et polynucleotide codant pour ce polypeptide
WO2001072811A1 (fr) * 2000-03-28 2001-10-04 Shanghai Biowindow Gene Development Inc. Nouveau polypeptide, proteine ribosomale humaine s4 15, et polynucleotide codant pour ce polypeptide
WO2001075057A3 (fr) * 2000-03-29 2002-01-24 Biowindow Gene Dev Inc Nouveau polypeptide, proteine ribosomale s4 humaine 12, et polynucleotide codant pour ce polypeptide
WO2001075057A2 (fr) * 2000-03-29 2001-10-11 Biowindow Gene Development Inc. Shanghai Nouveau polypeptide, proteine ribosomale s4 humaine 12, et polynucleotide codant pour ce polypeptide
WO2001081396A1 (fr) * 2000-04-27 2001-11-01 Biowindow Gene Development Inc. Shanghai Nouveau polypeptide, proteine ribosomale s7 humaine 14, et polynucleotide codant pour ce polypeptide
WO2001087963A1 (fr) * 2000-05-09 2001-11-22 Shanghai Biowindow Gene Development Inc. Proteine s18-12 ribosomale, polypeptide humain, et polynucleotide la codant
WO2001094371A1 (fr) * 2000-05-09 2001-12-13 Shanghai Biowindow Gene Development Inc. Nouveau polypeptide, proteine ribosomale humaine s4-10, et polynucleotide codant ce polypeptide
WO2001094372A1 (fr) * 2000-05-16 2001-12-13 Shanghai Biowindow Gene Development Inc. Nouveau polypeptide, proteine ribosomale humaine s4, et polynucleotide codant ce polypeptide
WO2001090171A1 (fr) * 2000-05-16 2001-11-29 Shanghai Biowindow Gene Development Inc. Nouveau polypeptide, proteine humaine ribosomale sii 12, et polynucleotide codant ce polypeptide
WO2001087952A1 (fr) * 2000-05-19 2001-11-22 Biowindow Gene Development Inc. Shanghai Nouveau polypeptide, proteine ribosomale humaine 13, et polynucleotide codant ce polypeptide
WO2001094532A2 (fr) * 2000-05-24 2001-12-13 Shanghai Biowindow Gene Development Inc. Nouveau polypeptide, proteine ribosomale l39 9, et polynucleotide codant ce polypeptide
WO2001090172A1 (fr) * 2000-05-24 2001-11-29 Shanghai Biowindow Gene Development Inc. Nouveau polypeptide, proteine ribosomale l39 13, et polynucleotide codant ce polypeptide
WO2001094532A3 (fr) * 2000-05-24 2002-02-28 Shanghai Biowindow Gene Dev Nouveau polypeptide, proteine ribosomale l39 9, et polynucleotide codant ce polypeptide
WO2002020784A1 (fr) * 2000-06-07 2002-03-14 Shanghai Biowindow Gene Development Inc. Nouveau polypeptide, proteine ribosomale s1111.22, et polynucleotide codant ce polypeptide

Also Published As

Publication number Publication date
WO2000028079A3 (fr) 2000-08-31
AU6483499A (en) 2000-05-29

Similar Documents

Publication Publication Date Title
US9523127B2 (en) KCNQ2 and KCNQ3—potassium channel genes which are mutated in benign familial neonatal convulsions (BFNC) and other epilepsies
WO2000028079A2 (fr) Variation genetique associee a l'anemie aplasique, et applications diagnostiques et therapeutiques basees sur cette variation
EP1100825B1 (fr) Mutations geniques mink humaines associees a l'arythmie
CA2268771C (fr) Polymorphismes et nouveaux genes dans la region du gene humain de l'hemochromatose
JP2003528631A (ja) 炎症性腸疾患に関与する遺伝子およびその用途
US7649088B2 (en) Atlastin
EP0870041A2 (fr) KVLQT1- GENE DU SYNDROME DU QT LONG CODANT POUR KVLQT1, QUI SE COASSEMBLE AVEC minK POUR FORMER DES CANAUX POTASSIQUES CARDIAQUES I Ks?
US20040185468A1 (en) Promoter variants of the alpha-7 nicotinic acetylcholine receptor
EP1448587A2 (fr) Gene du syndrome de noonan
US7041448B2 (en) Gene encoding a new TRP channel is mutated in mucolipidosis IV
US20070172919A1 (en) WDR36 Gene Alterations and Glaucoma
EP1100538B1 (fr) Kvlqt1 - gene associe au syndrome du qt long
JP2005528089A (ja) 末梢動脈閉塞疾患の遺伝子
AU2003201728A1 (en) Gene for peripheral arterial occlusive disease
EP1556516A2 (fr) Gene slit-3 du diabete de type ii humain situe sur le chromosome 5q35
US20090215065A1 (en) Atlastin
CA2712809C (fr) Kncq2 et kncq3, genes du canal potassium ayant subi une mutation dans des convulsions neonatales familiales benignes (bfnc) et d'autres epilepsies
WO1997001573A2 (fr) Genes et produits geniques de la maladie d'alzheimer a apparition precoce

Legal Events

Date Code Title Description
ENP Entry into the national phase in:

Ref country code: AU

Ref document number: 1999 64834

Kind code of ref document: A

Format of ref document f/p: F

AK Designated states

Kind code of ref document: A2

Designated state(s): AE AL AM AT AU AZ BA BB BG BR BY CA CH CN CR CU CZ DE DK DM EE ES FI GB GD GE HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GH GM KE LS MW SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
AK Designated states

Kind code of ref document: A3

Designated state(s): AE AL AM AT AU AZ BA BB BG BR BY CA CH CN CR CU CZ DE DK DM EE ES FI GB GD GE HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A3

Designated state(s): GH GM KE LS MW SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase