WO2002006337A1 - Nouveau polypeptide, hydroxyindole-o-methyl transferase humaine 12.43, et polynucleotide codant ce polypeptide - Google Patents

Nouveau polypeptide, hydroxyindole-o-methyl transferase humaine 12.43, et polynucleotide codant ce polypeptide Download PDF

Info

Publication number
WO2002006337A1
WO2002006337A1 PCT/CN2001/001111 CN0101111W WO0206337A1 WO 2002006337 A1 WO2002006337 A1 WO 2002006337A1 CN 0101111 W CN0101111 W CN 0101111W WO 0206337 A1 WO0206337 A1 WO 0206337A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
polynucleotide
human
methyltransferase
oxindole
Prior art date
Application number
PCT/CN2001/001111
Other languages
English (en)
Chinese (zh)
Inventor
Yumin Mao
Yi Xie
Original Assignee
Shanghai Biowindow Gene Development Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shanghai Biowindow Gene Development Inc. filed Critical Shanghai Biowindow Gene Development Inc.
Priority to AU2002210335A priority Critical patent/AU2002210335A1/en
Publication of WO2002006337A1 publication Critical patent/WO2002006337A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/1085—Transferases (2.) transferring alkyl or aryl groups other than methyl groups (2.5)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • the present invention belongs to the field of biotechnology. Specifically, the present invention describes a novel polypeptide, human hydroxyindole-0-methyltransferase 12.43, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and polypeptide.
  • Melatonin is a hormone secreted by the pineal gland, and its synthesis and secretion show a strong physiological cycle. Melatonin is normally secreted at night, regulating the body's sleep-wake cycle. Young people have more melatonin than older people, so young people sleep better than older people. Melatonin is often used as a sleeping medicine. Studies have found that it has a certain effect on prolonging life. It also has a certain effect on the immune system, so it is also used as a commonly used drug for cancer and AIDS. In addition, it has a certain effect on Alzheimer's disease.
  • HYMT Hydroxyindole-0-methyl transferase
  • the human hydroxyP-indole-0-methyltransferase 12.43 protein plays an important role in regulating important functions of the body such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes. There has been a need to identify more human oxindole-0-methyltransferase 12.43 proteins involved in these processes, especially the amino acid sequence of this protein. Isolation of the novel human oxindole-0-methyltransferase 12.43 protein encoding gene also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for developing diagnostic and / or therapeutic drugs for diseases, so It is very important to decode DM. Object of the invention
  • Another object of the invention is to provide a polynucleotide encoding the polypeptide.
  • Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding human oxindole-0-methyltransferase 12.43.
  • Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding human oxindole-0-fluorenyltransferase 12.43.
  • Another object of the present invention is to provide a method for producing human oxindole-0-methyltransferase 12.43.
  • Another object of the present invention is to provide an antibody against the polypeptide of the present invention, human oxindole-0-methyltransferase 12.43.
  • Another object of the present invention is to provide mimic compounds, antagonists, agonists, and inhibitors against the polypeptide of the present invention, human oxindole-0-methyltransferase 12.43.
  • Another object of the present invention is to provide a method for diagnosing and treating diseases related to abnormality of human oxindole-0-fluorenyltransferase 12.43. Summary of invention
  • the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
  • the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
  • sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 40 to 381 in SEQ ID NO: 1; and (b) a sequence having positions 1-1565 in SEQ ID NO: 1 Sequence of bits.
  • the invention further relates to a vector, in particular an expression vector, containing the polynucleotide of the invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; a package
  • the method of preparing the polypeptide of the present invention includes culturing the host cell and recovering the expressed product.
  • the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
  • the present invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of human oxindole-0-methyltransferase 12.43 protein, which comprises utilizing the polypeptide of the present invention.
  • the invention also relates to compounds obtained by this method.
  • the invention also relates to a method for in vitro detection of a disease or disease susceptibility related to abnormal expression of human oxindole-0-methyltransferase 12.43 protein, which comprises detecting the polypeptide or a polynucleotide encoding the same in a biological sample. A mutation in a sequence, or the amount or biological activity of a polypeptide of the invention in a biological sample is detected.
  • the invention also relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
  • the present invention also relates to the polypeptides and / or polynucleotides of the present invention prepared for use in the treatment of cancer, developmental or immune diseases or other due to abnormal expression of human oxindole-0-methyltransferase 12.43 Use of medicine for disease.
  • Fig. 1 is a comparison diagram of gene chip expression profiles of human oxindole-0-methyltransferase 12.43 and human oxindole-0-methyltransferase of the present invention.
  • the upper graph is a graph of the expression profile of human oxindole-0-methyltransferase 12. 43 and the lower graph is a graph of the expression profile of human oxindole-0-methyltransferase.
  • Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of the isolated human oxindole-0-methyltransferase 12.43. 12kDa is the molecular weight of the protein. The arrow indicates the isolated protein band.
  • Nucleic acid sequence refers to oligonucleotides, nucleotides or polynucleotides and fragments or parts thereof, and can also refer to genomic or synthetic DNA or RNA, which can be single-stranded or double-stranded, representing the sense strand or Antisense strand.
  • amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
  • amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
  • a protein or polynucleotide “variant” refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it. The changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or the nucleotide sequence. Variants can have "conservative" changes in which the substituted amino acid has a structural or chemical property similar to the original amino acid, such as the replacement of isoleucine with leucine. Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
  • “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
  • Insertion means that a change in the amino acid sequence or nucleotide sequence results in an increase in one or more amino acids or nucleotides compared to a molecule that exists in nature.
  • Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
  • Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
  • immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response and to bind specific antibodies in a suitable animal or cell.
  • An "agonist” refers to a molecule that, when combined with human oxindole-0-methyltransferase 12.43, can cause the protein to change, thereby regulating the activity of the protein.
  • An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that binds human oxindole-0-methyltransferase 12.43.
  • Antagonists and inhibitors refers to a human hydroxyindole-0-methyltransferase 12.43 when combined with human hydroxyindole-0-fluorenyl transferase 12.43 A biologically or immunologically active molecule.
  • Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates, or any other molecule that can bind to human oxindole-0-fluorenyltransferase 12.43.
  • Regular refers to changes in the function of human oxindole-0-methyltransferase 12.43, including an increase or decrease in protein activity, changes in binding characteristics, and human oxindole-0-methyltransferase 12 .43 any other change in biological, functional or immune properties.
  • Substantially pure means substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated. 43. Those skilled in the art can purify human hydroxy ⁇ indole-0-methyltransferase 12.43 using standard protein purification techniques. Substantially pure human hydroxyl P-indole-0-methyltransferase 12.43 in non-reducing polyacrylamide A single main band can be produced on the glue. The purity of human hydroxyindole-0-methyltransferase 12.43 polypeptide can be analyzed by amino acid sequence.
  • Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
  • sequence C-T-G-A
  • complementary sequence G-A-C-T.
  • the complementarity between two single-stranded molecules may be partial or complete.
  • the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
  • “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
  • Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Southern imprinting or Northern blotting, etc.) under conditions of reduced stringency. Substantially homologous sequences or hybridization probes can compete and inhibit the binding of fully homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.
  • the percent identity between nucleic acid sequences can also be determined by the Clus ter method or by methods known in the art such as Jotun Hein (Hein J., (1990) Methods in enzymology 183: 625-645).
  • Similarity refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
  • Amino acids used for conservative substitution for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
  • Antisense refers to a nucleotide sequence that is complementary to a particular DNA or RM sequence.
  • Antisense strand refers to a nucleic acid strand that is complementary to a “sense strand.”
  • Derivative refers to HFP or a chemical modification of its nucleic acid. This chemical modification can be Replace a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
  • Antibody refers to an intact antibody molecules and fragments thereof, such as Fa, F (a b ') 2 and F V, which specifically binds to human oxindole --0- methyltransferase antigen determinants 12.43 .
  • isolated refers to the removal of a substance from its original environment (for example, its natural environment if it is naturally occurring).
  • a naturally-occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
  • Such a polynucleotide may be part of a certain vector, or the polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not part of its natural environment, they are still isolated.
  • isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
  • polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances in the natural state .
  • isolated human oxindole-0-methyltransferase 12.43 means human oxindole-0-methyltransferase 12.43 is substantially free of other proteins and lipids naturally associated with it. Class, sugar or other substance. Those skilled in the art can purify human oxindole-0-methyltransferase 12.43 using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. Human oxindole-0-methyltransferase 12. 43 The purity of the polypeptide can be analyzed by amino acid sequence.
  • the present invention provides a new polypeptide, human oxindole-0-methyltransferase 12. 43, which consists essentially of the amino acid sequence shown in SEQ ID NO: 2.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
  • the polypeptides of the present invention can be naturally purified products, or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques.
  • polypeptide of the invention may be glycosylated, or it may be non-glycosylated.
  • Polypeptides of the invention may also include or exclude starting methionine residues. .
  • the invention also includes fragments, derivatives and analogs of human oxindole-0-methyltransferase 12.43.
  • fragment refers to a polypeptide that substantially maintains the same biological function or activity of the human hydroxyindole-0-methyltransferase 12.43 of the present invention. .
  • a fragment, derivative or analog of the polypeptide of the present invention may be: (I) one such, one or more of which Amino acid residues are replaced by conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substituted amino acid may or may not be encoded by a genetic codon; or ( ⁇ ) such one of which A group on multiple amino acid residues is substituted by other groups to include substituents; or (III) a type in which the mature polypeptide is associated with another compound (such as a compound that extends the half-life of the polypeptide, such as polyethylene glycol) Fusion; or (IV) a polypeptide sequence (such as a leader sequence or a secreted sequence or a sequence used to purify the polypeptide or a protease sequence) in which an additional amino acid sequence is fused into a mature polypeptide.
  • such fragments, derivatives and analogs are considered to be within the knowledge of those skilled in the art.
  • the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
  • the polynucleotide of the present invention is found from a CDM library of human fetal brain tissue. It contains a polynucleotide sequence of 1565 bases in length and its open reading frame 40-381 encodes 113 amino acids.
  • this polypeptide has a similar expression profile to human hydroxyindole-0-methyltransferase, and it can be inferred that the human hydroxyindole-0-methyltransferase 12.43 has human hydroxyindole. Similar functions of indole-0-methyltransferase.
  • the polynucleotide of the present invention may be in the DM form or the RM form.
  • DNA forms include cDNA, genomic DNA, or synthetic DNA.
  • DNA can be single-stranded or double-stranded.
  • DNA can be coding or non-coding.
  • the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
  • a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
  • the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
  • polynucleotide encoding a polypeptide refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.
  • the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
  • Variants of this polynucleotide may be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
  • an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
  • the present invention also relates to a polynucleotide that hybridizes to a sequence described above (having at least 50%, preferably 70% identity between two sequences).
  • the invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the invention under stringent conditions.
  • stringent conditions refers to: (1) hybridization and wash under lower ionic strength and higher temperature, such as 0. 2 xSSC, 0.
  • the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
  • nucleic acid fragments that hybridize to the sequences described above.
  • nucleic acid fragment having a length can also be used in nucleic acid amplification techniques (such as PCR) to identify and / or isolate polynucleotides encoding human oxindole-0-methyltransferase 12.43.
  • polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
  • the specific polynucleotide sequence encoding human oxindole-0-methyltransferase 12.43 of the present invention can be obtained by various methods.
  • polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
  • the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.
  • genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences.
  • the standard method for isolating the cDNA of interest is to isolate mRM from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDM library.
  • mRM plasmid or phage cDM library.
  • kits are also commercially available (Qiagene).
  • construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manua, Coll Spring Harbor Laboratory. New York, 1989).
  • Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
  • genes can be screened from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DM or DNA-RM hybridization; ( 2 ) the appearance or loss of marker gene function; ( 3 ) determination of human hydroxy "indole-0-methyltransferase 12. 43 transcript level; (4) through immunological techniques or testing Determine biological activity to detect protein products expressed by genes. The above methods can be used singly or in combination.
  • the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
  • the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
  • the probe used here is generally a DNA sequence chemically synthesized based on the gene sequence information of the present invention.
  • the genes or fragments of the present invention can of course be used as probes.
  • DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
  • the protein product expressing human oxindole-0-methyltransferase 12.43 gene can be detected by immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay ELISA) and so on.
  • a method (Sa iki, et al. Sc; 1985; 230: 1350-1354) using PCR technology to amplify DNA / RNA is preferably used to obtain the gene of the present invention.
  • the RACE method RACE-cDM terminal rapid amplification method
  • the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Select and synthesize using conventional methods.
  • the amplified DNA / MA fragment can be isolated and purified by conventional methods such as by gel electrophoresis.
  • polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be measured by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, sequencing needs to be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDM sequence.
  • the present invention also relates to a vector comprising a polynucleotide of the present invention, and a host cell genetically engineered using the vector of the present invention or directly using human oxindole-0-methyltransferase 12.43 coding sequence, and by recombinant technology A method for producing a polypeptide according to the invention.
  • a polynucleotide sequence encoding human hydroxyl p -indole-0-methyltransferase 12.43 can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
  • vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
  • Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al.
  • any plasmid and vector can be used to construct recombinant expression vectors.
  • Body An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
  • Methods well known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding human oxindole-0-methyltransferase 12.43 and appropriate transcription / translation regulatory elements. These methods include in vitro recombinant DM technology, DNA synthesis technology, in vivo recombination technology, etc. (Sambroook, et al. Molecular Cloning, a Laboratory Manua 1, Cold Harbor Harbor Laboratory. New York, 1989).
  • the DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide mRM synthesis. Representative examples of these promoters are: the lac or trp promoter of E.
  • the expression vector also includes a ribosome binding site and a transcription terminator for translation initiation. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors expressed by DM, usually about 10 to 300 base pairs, which act on the promoter to enhance gene transcription. Examples include 100 to 27 G base pair SV40 enhancers on the late side of the origin of replication, polyoma enhancers and adenovirus enhancers on the late side of the origin of replication.
  • the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • GFP fluorescent protein
  • tetracycline or ampicillin resistance for E. coli.
  • a polynucleotide encoding human oxindole-0-methyltransferase 12.43 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute the polynucleotide or the recombinant vector.
  • Genetically engineered host cells refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell.
  • Escherichia coli, Streptomyces bacterial cells such as Salmonella typhimurium
  • fungal cells such as yeast
  • plant cells insect cells
  • fly S2 or Sf9 animal cells
  • animal cells such as CH0, COS or Bowes melanoma cells.
  • Transformation of a host cell with a DNA sequence according to the present invention or a recombinant vector containing the DM sequence can be performed using conventional techniques well known to those skilled in the art.
  • the host is a prokaryote such as E. coli
  • competent cells capable of absorbing DM can be harvested after the exponential growth phase and treated with the CaCl 2 method. The steps used are well known in the art. Alternatively, MgCl 2 is used. If required, transformation can also be performed by electroporation Method.
  • the host is a eukaryotic organism, the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
  • the polynucleotide sequence of the present invention can be used to express or produce recombinant human hydroxy p -indole-0-methyltransferase 12. 43 (Science, 1984; 224: 1431). Generally there are the following steps:
  • polynucleotide or variant
  • encoding human human indole-0-methyltransferase 12.43 of the present invention or a recombinant expression vector containing the polynucleotide for transformation or transduction Host cell
  • the medium used in the culture may be selected from various conventional mediums.
  • the culture is performed under conditions suitable for the growth of the host. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
  • the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If necessary, the recombinant protein can be isolated and purified by various separation methods using its physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
  • conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid
  • polypeptides of the present invention as well as antagonists, agonists and inhibitors of the polypeptides, can be directly used in the treatment of diseases, for example, they can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection, and immune diseases.
  • Melatonin is a hormone secreted by the pineal gland, which has the effects of promoting sleep and regulating immunity.
  • Human hydroxyindole-0-methyltransferase is the last step of the anabolic pathway that catalyzes melatonin.
  • Abnormal expression in the body can cause disorders of melatonin metabolism, cause disorders of immune system function, and then cause related diseases. happened.
  • the expression profile of the polypeptide of the present invention is consistent with the expression profile of human oxindole-0-methyltransferase protein, and both have similar biological functions.
  • the polypeptide of the present invention is the last step in the anabolic pathway that catalyzes melatonin in vivo.
  • Abnormal expression can cause disorders of the melatonin metabolism, lead to disorders of the immune system function, and lead to the occurrence of related diseases. These diseases include but are not Limited to: Humoral immunity mainly fights infection by: 1) neutralizing bacterial exotoxin; 2) inhibiting bacteria Adsorption; 3) conditioning and phagocytosis of bacteria; 4) dissolving and killing bacteria.
  • Humoral immunity works primarily against bacteria that grow outside the cell.
  • Humoral immune deficiency can cause various extracellular parasites and various viral infections. These diseases include but are not limited to:
  • polio virus poliomyelitis
  • hepatitis virus A, B, C, D, E, H, G
  • etc . polio virus (poliomyelitis), hepatitis virus (A, B, C, D, E, H, G), etc .;
  • CD4 T H cells release of soluble mediators (lymphokines) by macrophages and other immune effector play
  • CD8 Tc / Ts direct cell killing of target cells effect.
  • CD4 cells sensitized by antigens release a variety of lymphokines, activate macrophages, and destroy intracellular parasites (tuberculosis, leprosy, brucella, salmonella, etc.) through macrophages.
  • CD8 cell-mediated cellular immunity mainly plays an important role in antiviral infection, and can directly play a cytotoxic effect on the target cells of viral infection, but has no direct killing effect on the virus.
  • Defects in cellular immune function can cause various intracellular parasitic infections and various viral infections. These diseases include, but are not limited to:
  • Intracellular parasitic infections typhoid, paratyphoid (typhoid), tuberculosis (tuberculosis), leprosy (leprosy), wave thermal conductivity (brutella), etc .;
  • measles virus measles, measles bronchitis, pneumonia, otitis media, subacute sclerosing panencephalitis
  • herpes virus herpes zoster, chicken pox
  • polypeptide of the present invention can also be used for the treatment of cancer, AIDS, Alzheimer's disease and insomnia.
  • polypeptide of the present invention and the antagonist, agonist and inhibitor of the polypeptide can be directly used for the treatment of various diseases, such as immune dysfunction diseases, tumors, Alzheimer's disease, and insomnia.
  • the invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) human oxindole-0-methyltransferase 12.43.
  • Agonists enhance human hydroxyindole-0-methyltransferase 12. 43 Stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to cell proliferation, such as various cancers.
  • a mammalian cell or a membrane preparation expressing human oxindole-0-methyltransferase 12.43 can be labeled with a labeled human oxindole-0-methyltransferase 12.43 in the presence of a drug. From cultivation. The ability of the drug to increase or block this interaction is then determined.
  • Antagonists of human hydroxyindole-0-methyltransferase 12. 43 include screened antibodies, compounds, receptor deletions, and the like.
  • An antagonist of human oxindole-0-methyltransferase 12.43 can bind to human oxindole-0-methyltransferase 12.43 and eliminate its function, or inhibit the production of the polypeptide, or The active site binding of the polypeptide prevents the polypeptide from performing a biological function.
  • human oxindole-0-methyltransferase 12.43 When screening compounds as antagonists, human oxindole-0-methyltransferase 12.43 can be added to the bioanalytical assay, and by measuring the compounds for human oxindole-0-methyltransferase 12.43 and The effect of their receptor interactions to determine whether a compound is an antagonist. Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds. Polypeptide molecules capable of binding to human hydroxyl p -indole-0-methyltransferase 12.43 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. When screening, generally 12.43 molecules of human oxindole-0-methyltransferase should be labeled.
  • the present invention provides a method for producing an antibody using a polypeptide, a fragment, a derivative, an analog thereof, or a cell thereof as an antigen.
  • These antibodies can be polyclonal or monoclonal antibodies.
  • the present invention also provides an antibody against the human hydroxyl p -indole-0-methyltransferase 12.43 epitope.
  • These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments and Fab tables Dawen library generated fragments.
  • Polyclonal antibodies can be produced by injecting human hydroxy- 11 -indole-0-methyltransferase 12.43 directly into immunized animals (such as rabbits, mice, rats, etc.).
  • immunized animals such as rabbits, mice, rats, etc.
  • a variety of adjuvants can be used to enhance the immune response, including But it is not limited to Freund's adjuvant.
  • Techniques for preparing monoclonal antibodies to human hydroxyindole-0-methyltransferase 12.43 include, but are not limited to, hybridoma technology (Kohler and Milstein. Nature, 1975, 256: 495-497), triple tumor technology, human B-cells Hybridoma technology, EBV-hybridoma technology, etc.
  • Chimeric antibodies that bind human constant regions to non-human variable regions can be produced using existing techniques (Morrison et al, PNAS, 1985, 81: 6851).
  • the conventional technology for producing single chain antibodies (US Pat No. 4946778) can also be used to produce single chain antibodies against human oxindole-0-methyltransferase 12.43.
  • Antibodies against human hydroxyindole-0-methyltransferase 12.43 can be used in immunohistochemistry to detect human hydroxyindole-0-methyltransferase 12.43 in biopsy specimens. '
  • Monoclonal antibodies that bind to human oxindole-0-methyltransferase 12.43 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
  • Antibodies can also be used to design immunotoxins that target a particular part of the body.
  • human oxindole-0-methyltransferase 12.43 High affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
  • a common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
  • This hybrid antibody can be used to kill human oxindole-0-methyl Cells positive for transferase 12.43.
  • the antibodies of the present invention can be used to treat or prevent diseases related to human oxindole-0-methyltransferase 12.43.
  • Administration of an appropriate dose of the antibody can stimulate or block the production or activity of human oxindole-0-methyltransferase 12.43.
  • the present invention also relates to a diagnostic test method for quantitatively and locally detecting the level of human hydroxyindole-0-methyltransferase 12.43.
  • tests are well known in the art and include FISH assays and radioimmunoassays.
  • the level of human hydroxyindole-0-methyltransferase 12.43 detected in the test can be used to explain the importance of human hydroxyindole-0-methyltransferase 12.43 in various diseases and to diagnose human hydroxyindole Diseases where indole-0-methyltransferase 12.43 works.
  • polypeptide of the present invention can also be used for peptide mapping analysis.
  • the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
  • the polynucleotide encoding human hydroxyindole-0-methyltransferase 12.43 ⁇ can also be used for a variety of therapeutic purposes.
  • Gene therapy technology can be used to treat the absence or expression of human hydroxyindole-0-methyltransferase 12.43 Abnormal cell proliferation, development, or metabolism caused by normal / inactive expression.
  • Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated human hydroxyindole-0-methyltransferase 12. 4 3 to inhibit endogenous human hydroxyindole-0-methyltransferase 12. 43 activity.
  • a mutated human oxindole-0-methyltransferase 12.43 may be a shortened human oxindole-0-methyltransferase 12.43, although it can be related to The downstream substrate binds but lacks signaling activity. Therefore, the recombinant gene therapy vector can be used to treat diseases caused by abnormal expression or activity of human oxindole-0-methyltransferase 12.43.
  • Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to transfer polynucleotides encoding human hydroxyindole-0-fluorenyltransferase 12. 4 3 Into the cell.
  • Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
  • a vector such as a virus, phage, or plasmid
  • This DNA sequence has been integrated downstream of the RM polymerase promoter of the vector.
  • it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the phosphorothioate or peptide bond instead of the phosphodiester bond is used for the ribonucleoside linkage.
  • the polynucleotide encoding human oxindole-0-methyltransferase 12.43 can be used for the diagnosis of diseases related to human oxindole-0-methyltransferase 12.43.
  • a polynucleotide encoding human hydroxyindole-0-methyltransferase U. 4 3 can be used to detect the expression of human hydroxyindole-0-methyltransferase 12. 43 or human hydroxyindole in a disease state -0-Methyltransferase 12. 43 Aberrant expression.
  • a DNA sequence encoding human oxindole-0-methyltransferase 12.43 can be used to hybridize biopsy specimens to determine the expression of human oxindole-0-methyltransferase 12.43.
  • Hybridization techniques include Southern blotting, Nor thern blotting, and in situ hybridization. These techniques and methods are publicly available and mature, and related kits are commercially available.
  • Part or all of the polynucleotides of the present invention can be immobilized on a microarray as probes (Microarray) or DNA chip (also known as "gene chip”), used to analyze differential expression analysis and gene diagnosis of genes in tissues.
  • RNA-polymerase chain reaction in vitro amplification can also detect human hydroxyindole-0-methyltransferase 43 transcripts .
  • Human oxindole-0-methyltransferase 12.43 mutations in the gene can also be used to diagnose human oxindole-0-methyltransferase 12.43-related diseases.
  • Human oxindole-0-methyltransferase 12.43 mutant forms include point mutations, translocations, deletions, and recombinations compared to normal wild-type human oxindole-0-methyltransferase 12.43 DNA sequences And any other exceptions. Mutations can be detected using existing techniques such as Southern blotting, DM sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression. Therefore, Northern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
  • sequences of the invention are also valuable for chromosome identification. This sequence will specifically target a specific position on a human chromosome and can hybridize to it. Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for marking chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DNA sequences on a chromosome.
  • PCR primers (preferably 15-35bp) are prepared based on cDNA, and the sequences can be located on chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
  • PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
  • oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
  • Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.
  • the differences in cDNA or genomic sequences between the affected and unaffected individuals need to be determined. If at A mutation is observed in some or all of the affected individuals, and the mutation is not observed in any normal individuals, then the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in the chromosome, such as deletions or translocations that are visible at the chromosomal level or detectable using cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).
  • the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
  • suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
  • the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
  • the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell.
  • the polypeptides of the invention can be used in combination with other therapeutic compounds.
  • the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
  • Human oxindole-0-methyltransferase 12. 43 is administered in an amount effective to treat and / or prevent a specific indication.
  • the amount and range of human oxindole-0-methyltransferase 12.43 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician. Examples
  • Total human fetal brain RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform.
  • Poly (A) mRNA was isolated from total RNA using Quik niRM Isolat ion Kit (product of Qiegene). 2ug poly (A) mRNA is reverse transcribed to form cDNA. Use Smart cDNA Cloning Kit (purchased from Clontech). The 0 fragment was inserted into the multiple cloning site of the pBSK (+) vector (Clontech), and transformed into DH5 cc. The bacteria formed a cDNA library.
  • the terminate cycle react ion sequencing kit (Perkin-Elmer) and the ABI 377 automatic sequencer (Perkin-Elmer) determined the sequences at the 5 'and 3' ends of all clones.
  • the determined cMA sequence was compared with the existing public D sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 1099a06 was new DNA.
  • a series of primers were synthesized to determine the inserted cDNA fragments of the clone in both directions.
  • the 1099a06 clone contained a full-length cDNA of 1565bp (as shown in Seq ID NO: l), and a 341bp open reading frame (0RF) from 40bp to 381bp, encoding a new protein (such as Seq ID NO : Shown in 2).
  • This clone pBS-1099a06 and the encoded protein was named human oxindole-0-methyltransferase 12.43.
  • Example 2 The gene encoding human oxindole-0-methyltransferase 12.43 was cloned by RT-PCR method.
  • Primer2 5'- ACAGGGTCTCGTTCTGTCACCCTG -3 '(SEQ ID NO: 4)
  • Primerl is a forward sequence located at the 5th end of SEQ ID NO: 1, starting at Ibp;
  • Primer2 is the 3 'end reverse sequence in SEQ ID NO: 1.
  • the tissue was homogenized with 4M guanidine isothiocyanate-25raM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 volume of phenol and 1/5 volume of chloroform were added.
  • -Isoamyl alcohol 49: 1
  • Aspirate the aqueous layer add isopropanol (0.8 volume) and centrifuge the mixture to obtain RM precipitate. Wash the obtained RM precipitate with 70% ethanol, dry and Soluble in water. 20% ⁇ RNA, 1.2% agarose in 20mM 3- (N-morpholino) propanesulfonic acid ( ⁇ 7 ⁇ 0) -5 mM sodium acetate-ImM EDTA-2.
  • Pr imer3 5'-CCCCATATGATGCTTGCTCTGTCTGACTCTAGT-3 '(Seq ID No: 5)
  • Priraer4 5'-CATGGATCCTCAACTAGGACTCTTAAGCTTTTT-3' (Seq ID No: 6)
  • the 5 'ends of these two primers contain Mel and BaraHI restriction sites, respectively , followeded by the coding sequences of the 5 'and 3' ends of the gene of interest, respectively, and the Ndel and BamHI restriction sites correspond to the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865. 3) Selective endonuclease site.
  • the PCR reaction was performed using the pBS-1099a06 plasmid containing the full-length target gene as a template.
  • the PCR reaction conditions were as follows: a total volume of 50 ⁇ 1 containing 10 pg of pBS-1099a06 plasmid, Primer-3 and Primer-4 were lpmol, Advantage polymerase Mix (Clontech) 1 ⁇ 1, respectively. Cycle parameters: 94 ° C 20s, 60 ° C 30s, 68 ° C 2 min, a total of 25 cycles. Ndel and BamHI were used to double-digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase.
  • the ligation product was transformed into coliform bacteria DH5a by the calcium chloride method, and cultured overnight on LB plates containing kanamycin (final concentration 3 ( ⁇ g / ml)), and positive clones were selected by colony PCR method and sequenced. Positive sequence correct clone (PET-1099a06) was used to transform the recombinant plasmid into E. coli BL21 (DE3) plySs (product of Novagen) by calcium chloride method.
  • polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex.
  • hemocyanin and bovine serum albumin For methods, see: Avrameas, et al. Imm, Chemi s try, 1969; 6:43. Rabbits were immunized with 4 mg of the hemocyanin-polypeptide complex plus complete Freund's adjuvant, and 15 days later, the hemocyanin-polypeptide complex plus incomplete Freund's adjuvant was used to boost immunity once.
  • the suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in various aspects.
  • the probes can be used to hybridize to the genome or CDM library of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
  • the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissues or Whether the expression in tissue cells is abnormal.
  • the purpose of this example is to select a suitable oligonucleotide fragment from the polynucleotide SBQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method.
  • Filter hybridization methods include dot blotting, Southern imprinting, Northern blotting, and copying methods. They all use the same steps to immobilize the polynucleotide sample to be tested on the filter.
  • the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
  • the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
  • the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
  • the preferred range of probe size is 18-50 nucleotides
  • Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements The regions are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, then the primary probe should not be used;
  • Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
  • Probe 2 which belongs to the second type of probe, is equivalent to the replacement mutant sequence of the gene fragment or its complementary fragment of SEQ ID NO: 1 (listening):
  • PBS phosphate buffered saline
  • DM phenol extraction method Steps: 1) Wash the cells with 1-10 ml of cold PBS and centrifuge at 1,000 g for 10 minutes. 2) Resuspend the pelleted cells (1 ⁇ 10 8 cells / ml) with cold cell lysate and apply a minimum of 100ul lysis buffer. 3) Add SDS to a final concentration of 1%. If SDS is added directly to the cell pellet before resuspending the cells, the cells may form large clumps that are difficult to break, and reduce the overall yield. This is particularly serious when extracting> 10 7 cells. 4 ) Add proteinase K to a final concentration of 200ug / ral. 5) Incubate at 50 ° C for 1 hour or shake gently at 37 ° C overnight.
  • step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
  • NC membrane nitrocellulose membrane
  • the sample membrane was placed in a plastic bag, and 3-1 Omg pre-hybridization solution (lOxDenhardt's; 6xSSC, 0.1 mg / ml CT DM (calf thymus DNA)) was added. After sealing the mouth of the bag, shake at 68 ° C for 2 hours.
  • 3-1 Omg pre-hybridization solution (lOxDenhardt's; 6xSSC, 0.1 mg / ml CT DM (calf thymus DNA)
  • Gene microarray or gene microarray is a new technology currently being developed by many national laboratories and large pharmaceutical companies. It refers to the orderly and high-density arrangement of a large number of target gene fragments on slopes. , Silicon and other carriers, and then use fluorescence detection and computer software to compare and analyze the data, in order to achieve the purpose of rapid, efficient, high-throughput analysis of biological information.
  • the polynucleotide of the present invention can be used as a target DM for gene chip technology for high-throughput research of new gene functions; searching for and screening new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases . The specific method steps have been reported in the literature.
  • a total of 4,000 polynucleotide sequences of various full-length cDNAs are used as target DNA, including the polynucleotide of the present invention. They were amplified by PCR respectively. After purification, the concentration of the amplified product was adjusted to about 500ng / ul. Cartesian 7500 spotting instrument (purchased from Cartesian Company, USA) was spotted on the glass medium, between the spots. The distance is 280 ⁇ . The spotted slides were hydrated, dried, and cross-linked in a UV cross-linker. After elution, the slides were fixed to D to fix the slides to prepare chips. The specific method steps have been reported in the literature. The sample post-processing steps in this embodiment are:
  • Total mRM was extracted from human mixed tissues and specific tissues (or stimulated cell lines) in one step, and mRM was purified with Oligotex mRNA Midi Kit (purchased from QiaGen), and the fluorescent reagents were separately reverse-transcribed.
  • Cy3dUTP (5-Amino- propargyl-2'- deoxyuridine 5--triphate coupled to Cy3 f luorescent dye, purchased from Amersham Phamacia Biotech) was used to label mRNA of human mixed tissue, and the fluorescent reagent Cy5dUTP (5-Amino-propargyl-2, -deoxyuridine 5'-triphate coupled to Cy5 fluorescent dye, Shelley! / Amersham Phamacia Biotech company labeled the body's specific tissue (or stimulated cell line) mRNA, and purified the probe to prepare a probe.
  • Oligotex mRNA Midi Kit purchased from QiaGen
  • the probes from the two types of tissues were hybridized with the chip in a UniHyb TM Hybridizat ion Solution (purchased from TeleChem) hybridization solution for 16 hours, and washed with a washing solution (1 x SSC, 0.2% SDS) at room temperature. Scanning was then performed with a ScanArray 3000 scanner (purchased from General Scanning, USA). The scanned images were analyzed and processed with Imagene software (Biodiscovery, USA) to calculate the Cy3 / Cy5 ratio of each point.
  • the above specific tissues are fetal brain, bladder mucosa, PMA + Ecv304 cell line, LPS + Ecv304 cell line thymus, normal fibroblasts 1024NC, Fibroblas t, growth factor stimulation, 10 2 4NT, Scar into fc growth factor stimulation, 1013HT, Scar into fc without growth factor stimulation, 1013H (:, Bladder cancer construct cell EJ, Bladder cancer side, Bladder cancer, Liver cancer, Liver cancer cell line, Placenta, Spleen, Prostate cancer, The jejunal adenocarcinoma and cardia cancer. Based on these 18 Cy3 / Cy5 ratios, a bar graph is drawn ( Figure 1). The figure shows the human hydroxyindole-0-methyltransferase 12.43 and human hydroxyindole according to the present invention. Indole-0-methyltransferase expression profiles are very similar.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

L'invention concerne un nouveau polypeptide, une hydroxyindole-O-méthyl transférase humaine 12.43, et un polynucléotide codant ce polypeptide ainsi qu'un procédé d'obtention de ce polypeptide par des techniques recombinantes d'ADN. L'invention concerne en outre les applications de ce polypeptide dans le traitement de maladies, notamment de dysfonctionnements immunitaires, de tumeurs, de la maladie d'Alzheimer et d'insomnies. L'invention concerne aussi l'antagoniste agissant contre le polypeptide et son action thérapeutique ainsi que les applications de ce polynucléotide codant l'hydroxyindole-O-méthyl transférase humaine 12.43.
PCT/CN2001/001111 2000-06-30 2001-06-29 Nouveau polypeptide, hydroxyindole-o-methyl transferase humaine 12.43, et polynucleotide codant ce polypeptide WO2002006337A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU2002210335A AU2002210335A1 (en) 2000-06-30 2001-06-29 A novel polypeptide - human hydroxyindole-o-methyl-transferase 12.43 and polynucleotide encoding the same

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN00116947.5 2000-06-30
CN 00116947 CN1331320A (zh) 2000-06-30 2000-06-30 一种新的多肽——人羟基吲哚－o－甲基转移酶12.43和编码这种多肽的多核苷酸

Publications (1)

Publication Number Publication Date
WO2002006337A1 true WO2002006337A1 (fr) 2002-01-24

Family

ID=4586346

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2001/001111 WO2002006337A1 (fr) 2000-06-30 2001-06-29 Nouveau polypeptide, hydroxyindole-o-methyl transferase humaine 12.43, et polynucleotide codant ce polypeptide

Country Status (3)

Country Link
CN (1) CN1331320A (fr)
AU (1) AU2002210335A1 (fr)
WO (1) WO2002006337A1 (fr)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20140134689A1 (en) * 2011-03-28 2014-05-15 The Regents Of The University Of California Host Cells and Methods for Oxidizing Aromatic Amino Acids
WO2017202897A1 (fr) 2016-05-24 2017-11-30 Danmarks Tekniske Universitet Variants de l'acétylsérotonine o-méthyltransférase et leurs utilisations

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
DNA CELL. BIOL., vol. 12, no. 8, 1993, pages 715 - 727 *
J. BIOL. CHEM., vol. 269, no. 50, 1994, pages 31969 - 31977 *

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20140134689A1 (en) * 2011-03-28 2014-05-15 The Regents Of The University Of California Host Cells and Methods for Oxidizing Aromatic Amino Acids
US10597685B2 (en) * 2011-03-28 2020-03-24 The Regents Of The University Of California Host cells and methods for oxidizing aromatic amino acids
WO2017202897A1 (fr) 2016-05-24 2017-11-30 Danmarks Tekniske Universitet Variants de l'acétylsérotonine o-méthyltransférase et leurs utilisations
US10883127B2 (en) 2016-05-24 2021-01-05 Danmarks Tekniske Universitet Variants of acetylserotonin O-methyltransferase and uses thereof
US11332767B2 (en) 2016-05-24 2022-05-17 Danmarks Tekniske Universitet Nucleic acids and recombinant host cells expressing acetylserotonin O-methyltransferase (ASMT) variants and their use in producing melatonin

Also Published As

Publication number Publication date
CN1331320A (zh) 2002-01-16
AU2002210335A1 (en) 2002-01-30

Similar Documents

Publication Publication Date Title
WO2002006337A1 (fr) Nouveau polypeptide, hydroxyindole-o-methyl transferase humaine 12.43, et polynucleotide codant ce polypeptide
WO2001092514A1 (fr) Nouveau polypeptide, interleukine humaine 13 (il-13), et polynucleotide codant ce polypeptide
WO2001094406A1 (fr) Nouveau polypeptide, dihydropyridine-acide dicarboxylique deshydrogenase 21, et polynucleotide codant ce polypeptide
WO2002012487A1 (fr) Nouveau polypeptide, proteine 10.23 associee au recepteur t1/st2, et polynucleotide codant ce polypeptide
WO2001088084A2 (fr) Nouveau polypeptide, superoxyde dismutase 11, et polynucleotide codant pour ce polypeptide
WO2001090133A1 (fr) Nouveau polypeptide, uracil desoxyribonucleotide glycosylase humaine 22, et polynucleotide codant ce polypeptide
WO2001092515A1 (fr) Nouveau polypeptide, facteur humain de transcription 29.26, et polynucleotide codant ce polypeptide
WO2002006471A1 (fr) Nouveau polypeptide, nucleophosmine 9.68, et polynucleotide codant ce polypeptide
WO2001090352A1 (fr) Nouveau polypeptide, proteine 110.12 de liaison avec le centrosome nek-2, et polynucleotide codant ce polypeptide
WO2001090177A1 (fr) Nouveau polypeptide, activateur humain de la mort naturelle des cellules b13.64, et polynucleotide codant ce polypeptide
WO2001071003A1 (fr) Nouveau polypeptide, serine protease humaine 8, et polynucleotide codant pour ce polypeptide
WO2001075023A2 (fr) Nouveau polypeptide, phosphatidylinositol-3 (ptdins 3) kinase humaine 9, et polynucleotide codant pour ce polypeptide
WO2001094401A1 (fr) Nouveau polypeptide, proteine npat humaine 15, et polynucleotide codant pour ce polypeptide
WO2001092518A1 (fr) Nouveau polypeptide, proteine humaine 9.5 associee a la ccr4, et polynucleotide codant ce polypeptide
WO2001068873A1 (fr) Nouveau polypeptide, molecule humaine d'adhesion intercellulaire 12, et polynucleotide codant pour ce polypeptide
WO2001094407A1 (fr) Nouveau polypeptide, enzyme de conjugaison de l'ubiquitine humaine 10.01, et polynucleotide codant ce polypeptide
WO2001090131A1 (fr) Nouveau polypeptide, proteine humaine 10.56 du gene cancerigene tre, et polynucleotide codant ce polypeptide
WO2001094535A2 (fr) Nouveau polypeptide, uracil desoxyribonucleotide glycosylase humaine 9.9, et polynucleotide codant ce polypeptide
WO2001094538A2 (fr) Nouveau polypeptide, adn ligase 21, et polynucleotide codant ce polypeptide
WO2001090172A1 (fr) Nouveau polypeptide, proteine ribosomale l39 13, et polynucleotide codant ce polypeptide
WO2001090379A1 (fr) Nouveau polypeptide, nucleoproteine basophile humaine 22.55, et polynucleotide codant ce polypeptide
WO2001090351A1 (fr) Nouveau polypeptide, facteur humain 13.31 de liaison d'interleukine, et polynucleotide codant ce polypeptide
WO2002026952A1 (fr) Nouveau polypeptide, serine/threonine proteine kinase humaine 11.22, et polynucleotide codant ce polypeptide
WO2002020775A1 (fr) Nouveau polypeptide, proteine kinase cycline-dependante cdk411, et polynucleotide codant ce polypeptide
WO2001068872A1 (fr) Nouveau polypeptide, sous-unite c humaine de la pompe a proton vacuolaire atpase 22, et polynucleotide codant pour ce polypeptide

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP