WO2001068876A1 - Nouveau polypeptide, proteine humaine 16 a multiples liaisons avec la dyneine atpase beta, et polynucleotide codant pour ce polypeptide - Google Patents

Nouveau polypeptide, proteine humaine 16 a multiples liaisons avec la dyneine atpase beta, et polynucleotide codant pour ce polypeptide Download PDF

Info

Publication number
WO2001068876A1
WO2001068876A1 PCT/CN2001/000191 CN0100191W WO0168876A1 WO 2001068876 A1 WO2001068876 A1 WO 2001068876A1 CN 0100191 W CN0100191 W CN 0100191W WO 0168876 A1 WO0168876 A1 WO 0168876A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
polynucleotide
heavy chain
dyneins
human
Prior art date
Application number
PCT/CN2001/000191
Other languages
English (en)
Chinese (zh)
Inventor
Yumin Mao
Yi Xie
Original Assignee
Biowindow Gene Development Inc. Shanghai
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Biowindow Gene Development Inc. Shanghai filed Critical Biowindow Gene Development Inc. Shanghai
Priority to AU2001239122A priority Critical patent/AU2001239122A1/en
Publication of WO2001068876A1 publication Critical patent/WO2001068876A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)

Definitions

  • the present invention belongs to the field of biotechnology. Specifically, the present invention describes a new polypeptide—a human dyneins ATPase beta heavy chain protein 16, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and polypeptide. Background technique
  • Axonemal dyneins has two or three spherical heads and a common base and flexible tail. Each head / tail consists of several single heavy chain peptide units with a relative molecular weight> 400,000. This heavy chain is called a beta heavy chain.
  • the P heavy chain isolated from the sea urchin sperm flagella is immunologically consistent with embryonic cilia [0gawa, K. Et al. Cell Motil. Cytoskel. 16, 58-67 (1990)] 0 Interestingly, the P heavy chain The microtubule's in vivo transport function is retained.
  • the P heavy chain can be divided into A fragment and B fragment by proteolysis, which are 12S and 6S, respectively, and may correspond to the domains of the head and tail of the molecule.
  • Dynein ATPase is an energy transduction enzyme, which can provide energy for sliding between microtubules, which is the basis of flagella and ciliary swing of eukaryotic cells, and is also likely to be other macromolecules Exercise provides energy.
  • the 4466 amino acid residues of the beta heavy chain of axonemal dyneins in the sea urchin embryo contain a motif sequence of 5 ATP binding sites. These ATP binding sites are either located at or near the VI site.
  • the secondary structure of the entire heavy chain is an ⁇ / P pattern.
  • the longest two regions of the ⁇ turn and a continuous hydrolyzed repeat composed of 120 and 50 amino acid residues may be functional domains, but there does not appear to be an extended coil tail domain [Foltz, K. Asai, L J. Cel Motil. Cytoskel. 16, 33-46 (1990) 3 0
  • the most prominent feature of the axonemal dyneins ⁇ heavy chain sequence of the sea urchin embryo is that there are 5 copies of the nucleotide A of the nucleotide binding site, and this nucleotide binding site is (A / G) XXXXGK (T / S).
  • the main ATP-binding site may be the GPAGTGKT sequence (GKT2), located at 1852- 1859. This site is located 660 amino acids downstream of the N-terminus and is close to the VI site. Studies have shown that the proline 1853 of the dyneins ⁇ heavy chain ATP binding site may be located at the division of the VI site.
  • the sequence next to the ATP binding site is not very similar to other known cytoskeletal monomer proteins, especially the flexible glycine loop extends to the upstream region beyond the GXXXXGKT motif and is longer than most ATP binding proteins [ Gottesman, S., Clak, WP & Maurizi, MRJ biol. Chem. 265, 7886- 7893 (1990)].
  • the second GKT nucleotide binding site motif (GKT1) is located at amino acid residues 154-161, and the two GKS motifs are located at amino acid residues 2133-2140 and 2460-2467.
  • a modified GKQ motif is located at amino acid residues 2805-2812.
  • the two GKS motif sequences, GNAGXGKS form part of the nucleotide binding site and are 'conserved' in biological evolution and play an important role in the function of the dyneins P heavy chain. These functional effects may include regulation of dyneins cross-bridge activities (required for cilia and flagella swinging), inhibition of increased ATP content, and so on.
  • Dyneins ATPase ⁇ heavy chain protein may be involved in cellular activities such as muscle contraction, metamorphosis, cytokinesis, and can be used as a substrate for protein kinases and oncogene products. It also participates in biological reactions such as polysomes and protein synthesis and maintenance of cell membrane morphology .
  • the new human dyneins ATPase beta heavy chain protein 16 of the present invention has 73% identity and 88% similarity with the known sea urchin axonemal dyneins ATPase beta heavy chain protein at the protein level, both of which are dyneins ATP Member of the enzyme ⁇ heavy chain protein family and has similar physiological functions.
  • This protein may form the basis for the development of diagnostic and / or therapeutic drugs for the disease, so isolation of its coding DNA is very important. .
  • the human dyneins ATPase beta heavy chain protein 16 protein plays an important role in regulating important functions of the body such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes, so more needs to be identified in the art
  • the human dyneins ATPase beta heavy chain protein 16 protein involved in these processes, especially the amino acid sequence of this protein is identified. Isolation of the newcomer dyneins ATPase beta heavy chain protein 16 protein encoding gene also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for developing diagnostic and / or therapeutic drugs for diseases, so isolating its coding DNA is important. Disclosure of invention
  • Another object of the invention is to provide a polynucleotide encoding the polypeptide.
  • Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding a human dyneins ATPase beta heavy chain protein 16.
  • Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding a human dyneins ATPase beta heavy chain protein 16.
  • Another object of the present invention is to provide a method for producing human dyneins ATPase beta heavy chain protein 16. Law.
  • Another object of the present invention is to provide an antibody against the polypeptide of the present invention-human dyneins ATPase beta heavy chain protein 16.
  • Another object of the present invention is to provide mimic compounds, antagonists, agonists, and inhibitors against the human dyneins ATPase beta heavy chain protein 16 of the polypeptide of the present invention.
  • Another object of the present invention is to provide a method for diagnosing and treating diseases associated with abnormalities of human dyneins ATPase beta heavy chain protein 16.
  • the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
  • the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
  • sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 625-1068 in SEQ ID NO: 1; and (b) a sequence having 1-1375 in SEQ ID NO: 1 Sequence of bits.
  • the present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
  • the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
  • the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of human dyneins ATPase beta heavy chain protein 16 protein, which comprises utilizing the polypeptide of the invention.
  • the invention also relates to compounds obtained by this method. .
  • the invention also relates to a method for detecting a disease or disease susceptibility related to abnormal expression of human dyneins ATPase beta heavy chain protein 16 protein in vitro, which comprises detecting a mutation in the polypeptide or a sequence encoding a polynucleotide thereof in a biological sample, Alternatively, the amount or biological activity of a polypeptide of the invention in a biological sample is detected.
  • the invention also relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
  • the present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention in the preparation of a medicament for treating cancer, developmental disease or immune disease or other diseases caused by abnormal expression of human dyneins ATPase beta heavy chain protein 16.
  • Other aspects of the invention will be apparent to those skilled in the art from the disclosure of the techniques herein.
  • Nucleic acid sequence refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
  • amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
  • amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
  • a “variant" of a protein or polynucleotide refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it.
  • the changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence.
  • Variants can have "conservative" changes, in which the amino acid substituted has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine.
  • Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
  • “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
  • Insertion refers to an alteration in the amino acid sequence or nucleotide sequence that results in an increase in one or more amino acids or nucleotides compared to a naturally occurring molecule.
  • Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
  • Bioly active refers to a protein that has the structure, regulation or 'biochemical function of a natural molecule.
  • immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response in appropriate animals or cells and to bind to specific antibodies.
  • An "agonist” refers to a molecule that, when combined with the human dyneins ATPase be ta heavy chain protein 16, causes a change in the protein to regulate the activity of the protein.
  • An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that binds to human dyneins ATPase beta heavy chain protein 16.
  • Antagonist refers to a biological or immunological activity that can block or modulate the human dyneins ATPase beta heavy chain protein 16 when combined with human dyneins ⁇ TPase beta heavy chain protein 16.
  • Antagonists and inhibitors can include proteins, nucleic acids, carbohydrates, or any other molecule that can bind to human dyne ins ATPase beta heavy chain protein 16.
  • Regular refers to changes in the function of human dyneins ATPase beta heavy chain protein 16, including increased or decreased protein activity, changes in binding characteristics, and any other biology of human dyneins ATPase be ta heavy chain protein 16. Changes in nature, function, or immune properties.
  • substantially pure ' means substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated.
  • Those skilled in the art can purify human dyneins ATPase beta heavy chain protein 16 using standard protein purification techniques.
  • the substantially pure human dyneins ATPase beta heavy chain protein 16 produces a single main band on non-reducing polyacrylamide coagulation.
  • the purity of human dyneins ATPase beta heavy chain protein 16 polypeptide can be analyzed by amino acid sequence.
  • Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
  • sequence C-T-G-A
  • complementary sequence G-A-C-T.
  • the complementarity between two single-stranded molecules may be partial or complete.
  • the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
  • “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
  • Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. The inhibition of such hybridization can be detected by performing hybridization (Southern trail or No the trail, etc.) under conditions of reduced stringency. Substantially homologous sequences or hybridization probes can compete and inhibit the binding of fully homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that conditions with reduced stringency allow non-specific binding, because conditions with reduced stringency require that the two sequences bind to each other as either specific or selective interactions.
  • Percent identity refers to the percentage of sequences that are the same or similar in a comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALIGN program (Lase gene sof twa e package, DNASTAR, Inc., Mad Son Wis). The MEGALIGN program can compare two or more sequences according to different methods, such as the Cluste method (Higgins, DG and PM Shap (1988) Gene 73: 237-2441. The Cluste method arranges groups of sequences by checking the distance between all pairs Clustering. The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences such as the sequence ⁇ 'JA and sequence B is calculated by the following formula:
  • the assay may be Jotun Hein percent identity between nucleic acid sequences Cluste method or a method known in the art (Hein J., (1990) Methods in emzumology 183: 625-645) 0
  • Similarity refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
  • Amino acids used for conservative substitutions for example, negatively charged amino acids may include aspartic acid and glutamic acid .; positively charged amino acids may include tyrosine and arginine; have uncharged head groups Amino acids with similar hydrophilicity may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine .
  • Antisense refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence.
  • Antisense strand refers to a nucleic acid strand that is complementary to the "sense strand”.
  • Derivative refers to a chemical modification of HFP or a nucleic acid encoding it. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
  • Antibody refers to a complete antibody molecule and its fragments, such as Fa,? ( ⁇ ') 2 and? ⁇ It can specifically bind to the epitope of human dyneins ATPase beta heavy chain protein 16.
  • a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
  • isolated refers to the removal of a substance from its original environment (for example, its natural environment if it is naturally occurring).
  • a naturally-occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
  • Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not part of its natural environment, they are still isolated.
  • isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
  • polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances in the natural state .
  • isolated human dyneins ATPase beta heavy chain protein 16 refers to human dyneins
  • the ATPase beta heavy chain protein 16 is essentially free of other proteins, lipids, sugars or other substances with which it is naturally associated. Those skilled in the art can purify human dyneins ATPase beta heavy chain protein 16 using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of human dyneins ATPase beta heavy chain protein 16 peptide can be analyzed by amino acid sequence.
  • the present invention provides a new polypeptide, human dyneins ATPase beta heavy chain protein 16, which basically consists of the amino acid sequence shown in SEQ ID NO: 2.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
  • the polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques. Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
  • the invention also includes fragments, derivatives and analogs of human dyneins ATPase beta heavy chain protein 16. Thing.
  • fragment As used in the present invention, the terms “fragment”, “derivative” and “analog” refer to a polypeptide that substantially retains the same biological function or activity of the human dyneins ATPase beta heavy chain protein 16 of the present invention.
  • a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution
  • the amino acid may or may not be encoded by the genetic code; or (II) such a type in which a group on one or more amino acid residues is substituted by other groups to include a substituent; or (III) such One, in which the mature polypeptide is fused to another compound (such as a compound that extends the half-life of the polypeptide, such as polyethylene glycol); or (IV) such a polypeptide sequence in which the additional amino acid sequence is fused into the mature polypeptide ( Such as the leader sequence or secreted sequence or the sequence used to purify this polypeptide or protease sequence)
  • such fragments, derivatives and analogs are considered to be within the knowledge of those skilled in the art.
  • the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
  • the polynucleotide of the present invention is found from a CDM library of human fetal brain tissue. It contains a polynucleotide sequence of 1375 bases in length and its open reading frame 625-1068 encodes 147 amino acids.
  • this polypeptide has 73% homology with the sea urchin axonemal dyneins ATPase ⁇ heavy chain protein. It can be concluded that the human dyneins ATPase beta heavy chain protein 16 has the sea urchin axonemal dyneins ATPase ⁇ heavy chain. Similar structure and function of proteins.
  • the polynucleotide of the present invention may be in the form of DNA or RNA.
  • DNA forms include cDNA, genomic DNA, or synthetic DNA.
  • DNA can be single-stranded or double-stranded.
  • DNA can be coding or non-coding.
  • the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
  • a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 in the present invention, but which differs from the coding region sequence shown in SEQ ID NO: 1.
  • the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
  • polynucleotide encoding a polypeptide refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.
  • the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
  • Variants of this polynucleotide may be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants Body, deletion variant, and insertion variant.
  • an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
  • the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity, between the two sequences).
  • the present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions.
  • "strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60 ° C; or (2) added during hybridization Use a denaturant, such as 50 ° /.
  • the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
  • Acid fragment contains at least 0 nucleotides, preferably at least '20 -30 nucleotides, more preferably at least 50-60 nucleotides, most preferably at least 100 nucleotides Nucleic acid fragments can also be used in nucleic acid amplification techniques, such as PCR, to identify and / or isolate polynucleotides encoding human dyneins ATPase beta heavy chain protein 16.
  • polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
  • the specific polynucleotide sequence encoding the human dyneins ATPase beta heavy chain protein 16 of the present invention can be obtained by various methods.
  • polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences ⁇ 'J, and 2) antibody screening of expression libraries to detect clones with common structural characteristics Polynucleotide fragment.
  • the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.
  • genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences.
  • the standard method for isolating a cDNA of interest is to isolate niRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library. There are many mature techniques for extracting mRNA, and kits are also commercially available (Qiagene).
  • the construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989).
  • Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
  • genes can be screened from these cDNA libraries by conventional methods. These methods include (but not (Limited to): (l) DNA-DNA or DNA-RNA hybridization; (2) appearance or loss of marker gene function; (3) determination of the transcript of human dyneins ATPase beta heavy chain protein 16; (4) pass Immunological techniques or assays for biological activity to detect gene-expressed protein products. The above methods can be used singly or in combination.
  • the probe used for hybridization is homologous to any part of the polynucleotide-acid of the present invention, and has a length of at least 10 nucleotides, preferably at least 30 nucleotides, more preferably Is at least 50 nucleotides, preferably at least 100 nucleotides.
  • the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
  • the probe used here is generally a DNA sequence chemically synthesized based on the gene sequence information of the present invention.
  • the genes or fragments of the present invention can of course be used as probes.
  • DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
  • the protein product of human dyneins ATPase beta heavy chain protein 16 gene can be detected by immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA).
  • immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA).
  • a method of applying a PCR technique to amplify DNA / RNA is preferably used to obtain the gene of the present invention.
  • the RACE method RACE-Rapid Amplification of cDNA Ends
  • the primers used for PCR can be appropriately based on the polynucleotide sequence information of the invention disclosed herein. Select and synthesize using conventional methods.
  • the amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
  • the polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467).
  • the sequencing of such polynucleotides can also be performed with commercial sequencing reagents. In order to obtain the full-length cDNA sequence, the sequencing must be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
  • the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell that is genetically engineered using the vector of the present invention or directly using the human dyneins ATPase beta heavy chain protein 16 coding sequence, and the recombinant technology to produce the described Polypeptide method.
  • a polynucleotide sequence encoding a human dyneins ATPase beta heavy chain protein 16 may be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
  • vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
  • Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors expressed in bacteria (Rosenberg, et al.
  • any plasmid and vector can be used to construct a recombinant expression vector.
  • An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
  • Methods known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding human dyneins ATPase beta heavy chain protein 16 and appropriate transcription / translation regulatory elements. These methods include in vitro recombinant DNA technology, DNA synthesis technology, and in vivo recombination technology (Sambroook, et al. Molecular Cloning, a Laboratory Manual, cold Spring Harbor Laboratory. New York, 1989).
  • the DNA sequence can be operably linked to an appropriate promoter in the expression vector to guide mRNA synthesis. Representative examples of these promoters are: the lac or trp promoter of E.
  • the expression vector also includes a ribosome binding site for translation initiation and a transcription terminator. Insertion of an enhancer sequence into the vector will enhance its transcription in higher eukaryotic cells.
  • Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, tumorigenic enhancers on the late side of the origin of replication, and adenoviral enhancers.
  • the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • GFP fluorescent protein
  • tetracycline or ampicillin resistance for E. coli.
  • a polynucleotide encoding human dyneins ATPase beta heavy chain protein 16 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to form a genetically engineered host containing the polynucleotide or the recombinant vector.
  • the term "host cell” refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E.
  • coli Streptomyces
  • bacterial cells such as Salmonella typhimurium
  • fungal cells such as yeast
  • plant cells such as fly S2 or Sf9
  • animal cells such as CH0, COS or Bowes melanoma cells.
  • Transformation of a host cell with a DNA sequence according to the present invention or a recombinant vector containing the DM sequence can be performed using conventional techniques well known to those skilled in the art.
  • the host is a prokaryote such as E. coli
  • Competent cells that absorb DNA can be harvested after the exponential growth phase and treated with CaCI i using procedures well known in the art.
  • CaCI i using procedures well known in the art.
  • MgCl 2 is used.
  • transformation can also be performed by electroporation.
  • the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
  • the polynucleotide sequence of the present invention can be used to express or produce recombinant human dyneins ATPase beta heavy chain protein 16 (Science, 1984; 224: 1431). Generally speaking, there are the following steps:
  • the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
  • a suitable method such as temperature conversion or chemical induction
  • the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell.
  • recombinant proteins can be separated and purified by various separation methods using their physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
  • conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography
  • FIG. 1 is a comparison diagram of amino acid sequence homology of dyneins ATP beta beta heavy chain protein 16 and Haiyue giant axonemal dyneins ATPase beta heavy chain protein.
  • the upper sequence is human dyneins ATPase beta heavy chain protein 16, and the lower sequence is sea urchin axonemal dyneins ATPase (3 heavy chain protein.
  • the same amino acid is represented by a single character amino acid between the two sequences, and similar amino acids are represented by "+”.
  • Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of isolated human dyneins ATPase beta heavy chain protein 16.
  • 16KDa is the molecular weight of the protein.
  • the arrow's head refers to the isolated protein band. ⁇ The best way to implement the invention
  • Example 1 Cloning of human dyneins ATPase beta heavy chain protein 16
  • RNA Human fetal brain total RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform.
  • Poly (A) mRNA was isolated from total RNA using the Quik mRNA Isolation Kit (Qiegene). 2ug poly (A) mRNA is reverse transcribed to form cDNA.
  • a Smart cDNA cloning kit (purchased from C1 on tech) was used to insert the cDNA fragment into the multiple cloning site of the pBSK (+) vector (Clontech) to transform DH5 cc. The bacteria formed a cDNA library.
  • Dye terminate cycle react ion sequencing kit Perkin-Elmer
  • ABI 377 automatic sequencer Perkin-Elmer
  • the determined cDNA sequence was compared with the existing public DNA sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 0622f02 was new DNA.
  • the inserted cDNA fragment contained in this clone was determined in both directions by synthesizing a series of primers.
  • the sequence of the human dyneins ATPase beta heavy chain protein 16 and its encoded protein sequence of the present invention were sequenced using Blast and Basic (Alignment search tool) [Al tschul, SF et al. J. Mol. Biol. 1990; 215 : 403-10], perform homology search in databases such as Genbank, Swissotte, etc.
  • the gene with the highest homology to the human dyneins ATPase beta heavy chain protein 16 of the present invention is a known sea urchin axonemal dyneins ATPase beta heavy chain protein, and its encoded protein has the accession number X59603 in Genbank.
  • the results of protein homology are shown in Fig. 1. The two are highly homologous and their identity is 73%; the similarity is 88 »/».
  • Example 3 Cloning of a gene encoding human dyneins ATPase beta heavy chain protein 16 by RT-PCR
  • CDNA was synthesized using fetal brain total RNA as a template and oligo-dT as a primer for reverse transcription reaction. After purification using Qiagene's kit, the following primers were used for PCR amplification:
  • Primerl y- ACTCCAAAACGCAGTTAGAGTTGA-3 ⁇ (SEQ ID NO: 3)
  • Primer2 5 ⁇ — ATCTGCATCAGATTTATTTTTTAA -3 "(SEQ ID NO: 4)
  • Primerl is a forward sequence located at the 5th end of SEQ ID NO: 1, starting at lbp;
  • Primer2 is the 3 'end reverse sequence in SEQ ID NO: 1.
  • Amplification conditions 50 ⁇ l / L C1, 10mmol / L Tris-Cl, (pH8.5), 1.5mmol / L MgCl 2 ; 200 ⁇ mol / L dNTP, lOpmol in a reaction volume of 50 ⁇ 1 Primer, 1U Taq DNA polymerase (C 1 on tech).
  • the reaction was performed on a PE 9600 DNA thermal cycler (Perkin-Elmer) for 25 cycles under the following conditions: 94 ° C 30sec; 55 ° C 30sec; 72 ° C 2min.
  • RT-PCR set ⁇ -act in as a positive control and template blank as a negative control.
  • the amplified product was purified using a QIAGEN kit, and ligated to a pCR vector (Invitrogen product) using a TA cloning kit.
  • the DNA sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as 1-1375bp shown in SEQ ID NO: 1.
  • Example 4 Northern blot analysis of human dyneins ATPase beta heavy chain protein 16 gene expression:
  • RNA extraction in one step [Anal. Biochem 1987, 162, 156-159] 0
  • This method involves acid guanidinium thiocyanate-chloroform extraction. That is, the tissue is homogenized with 4M guanidine isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1 ) And centrifuge after mixing. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water.
  • RNA was synthesized by electrophoresis on a 1.2% agarose gel containing 20 mM 3- (N-morpholino) propanesulfonic acid (pH 7.0)-5 mM sodium acetate-1 mM EDTA-2.2M formaldehyde. It was then transferred to a nitrocellulose membrane.
  • the DNA probe used was the sequence of the coding region (625bp to 1068bp) of the human dyneins ATPase beta heavy chain protein 16 amplified by PCR as shown in FIG. 1.
  • a 32P-labeled probe (about 2 x 10 6 cpm / ml) was hybridized with a nitrocellulose membrane to which RNA was transferred at 42 ° C overnight in a solution containing 50% formamide-25mM H 2 P0 4 (pH 7.4)-5 x SSC- 5 x Denhardt's solution and 200 ⁇ g / ml salmon sperm DNA. After hybridization, the filter was washed in 1 ⁇ SSC-0.1% SDS at 55 ° C for 30 min. Then, Phosphor Imager was used for analysis and quantification.
  • Example 5 In vitro expression, isolation and purification of recombinant human dyneins ATPase beta heavy chain protein 16
  • Primer3 5'- CCCCATATGATGCTCAGTGACCTTATTTTTCTG -3 '(Seq ID No: 5)
  • Primer4 5'- CATGGATCCTTAGGGATCGCCACACACAGTCAT -3, (Seq ID No: 6)
  • the 5' ends of these two primers contain Ndel and BamHI restriction sites, respectively.
  • the coding sequences of the 5 'and 3' ends of the gene of interest are followed, respectively.
  • the Ndel and BamHI restriction sites correspond to the selectivity within the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865.3) Digestion site.
  • the 0622f02 plasmid was used as a template for the PCR reaction.
  • the PCR reaction conditions are as follows: a total volume of 50 ⁇ 1, containing 10 pg of pBS-0622f 02 plasmid, and a plasmid? ! ⁇ ! ! ⁇ -? with? ! ⁇ ! : ⁇ -Points another ⁇ !!!. ! , Advantage polymerase Mix
  • NH2-Met-Leu-Ser-Asp-Leu-Ile-Phe-Leu-Phe-Pro-Gln-Lys-Val-Leu-Lys-C00H (SEQ ID NO: 7).
  • the polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex, respectively.
  • hemocyanin and bovine serum albumin For methods, see: Avrameas, et al. Immunochemistry, 1969; 6: 43. Rabbits were immunized with 1 ⁇ 2 g of the hemocyanin-polypeptide complex plus complete Freund's adjuvant, and 15 days later the hemocyanin-polypeptide complex plus incomplete Freund's adjuvant was used to boost immunity once.
  • a titer plate coated with a 15 g / ml bovine serum albumin peptide complex was used as an ELISA to determine antibody titers in rabbit serum.
  • Total IgG was isolated from antibody-positive rabbit serum using protein A-Sepharose.
  • the immunoprecipitation method proved that the purified antibody could specifically bind to human dyneins ATPase beta heavy chain protein 16.
  • Example 7 Use of a polynucleotide fragment of the present invention as a hybridization probe
  • Selecting suitable oligonucleotide fragments from the polynucleotides of the present invention has various uses as hybridization probes, such as using the probes to hybridize to genomic or cDNA libraries of normal tissues or pathological tissues from different sources.
  • the probe may further be used to detect the polynucleotide sequence of the present invention or a homologous polynucleotide sequence thereof in normal tissue or Whether the expression in pathological tissue cells is abnormal.
  • the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method.
  • Filter hybridization methods include dot blotting, Southern imprinting, Nor thern blotting, and copying methods. They all use the same steps to fix the polynucleotide sample to be tested on the filter and then hybridize.
  • the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer to saturate the non-specific binding site of the sample on the filter with the carrier and the synthesized polymer.
  • the pre-hybridization solution is then replaced with a hybridization buffer containing labeled probes and incubated to hybridize the probes to the target nucleic acid.
  • the unhybridized probes are removed by a series of membrane washing steps.
  • This embodiment uses higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals.
  • the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
  • the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
  • the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the highest hybridization specificity and are retained.
  • oligonucleotide fragments for use as hybridization probes from the polynucleotide SEQ ID NO: 1 of the present invention should follow the following principles and several aspects to be considered:
  • the preferred range of probe size is 18-50 nucleotides
  • GC content is 30 »/. -70%, non-specific hybridization increases
  • preliminary selection probes Those that meet the above conditions can be used as preliminary selection probes, and then further analyzed by computer sequence, including the preliminary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their Complementary regions are compared for homology if the homology with non-target molecular regions is greater than 85 »/. Or if more than 15 consecutive bases are identical, the primary probe should not be used in general;
  • Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 ( 4 l Nt):
  • Probe 2 which belongs to the second type of probe, is equivalent to the replacement mutant sequence (41Nt) of the gene fragment of SEQ ID NO: 1 or its complementary fragment:
  • step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
  • NC membranes nitrocellulose membranes
  • the 32 P-Probe (the second peak is free ⁇ - 32P_dATP) is prepared.
  • Gene chip or gene micro-matrix (DNA Micro croray) is a new technology currently being developed by many national laboratories and large pharmaceutical companies. It refers to the orderly and high-density arrangement of a large number of target gene fragments.
  • the data is compared and analyzed on a carrier such as glass, silicon, and the like by fluorescence detection and computer software, so as to achieve the purpose of analyzing biological information quickly, efficiently, and with high throughput.
  • the polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research of new gene functions; finding and screening for tissue specificity New genes, especially those related to diseases such as tumors; Diagnosis of diseases, such as hereditary diseases. The specific method steps have been reported in the literature.
  • a total of 4,000 polynucleotide sequences of various full-length cDNAs are used as target DNA, including the polynucleotides of the present invention. They were amplified by PCR respectively. After purification, the concentration of the amplified product was adjusted to about 500 ng / ul, and spotted on a glass medium with a Cartesian 7500 spotting instrument (purchased from Cartesian, USA). The distance is 280 ⁇ ⁇ . The spotted slides were hydrated, dried, and cross-linked in a UV cross-linker. After elution, the slides were fixed to fix the DNA on a glass slide to prepare a chip. The specific method steps have been variously reported in the literature. The post-spot processing steps of this embodiment are:
  • Total mRNA was extracted from normal laryngeal and laryngeal cancers in one step, and mRNA was purified using Oligotex mRNA Midi Kit (purchased from QiaGen).
  • Cy3dUTP (5- Amino- propargyl-2'-deoxyur) idine 5'-tr iphate coupled to Cy3 fluorescent dye, purchased from Amersham Phamacia Biotech company) labeled mRNA of normal laryngeal tissue
  • Cy5dUTP (5- Amino- propargyl- 2'- deoxyuridine 5- -tr iphate coupled to Cy5 fluorescent Dye (purchased from Amersham Phamacia Biotech) was used to label laryngeal cancer tissue mRNA, and probes were prepared after purification.
  • probes were prepared after purification.
  • the probes from the above two tissues and the chip were respectively hybridized in a UniHyb TM Hybridization Solution (purchased from TeleChem) hybridization solution for 16 hours.
  • the washing solution (1 ⁇ SSC, 0.2% SDS) After washing, scan with a ScanArray 3000 scanner (purchased from General Scanning, USA).
  • the scanned images are analyzed by Imagene software (Biodiscovery, USA), and the Cy3 / Cy5 ratio of each point is calculated.
  • the points whose ratio is less than 0.5 and greater than 2 are considered to be genes with differential expression.
  • polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat malignant tumors, adrenal deficiency, skin diseases, various inflammations, HIV infections and immune diseases.
  • Dyne in ATP enzyme is an energy transduction enzyme, which can provide energy for sliding between microtubules, which is the basis of the ciliary swing of eukaryotic cells, and it is also likely to move for other macromolecules provide energy.
  • Dyne ins ATPase ⁇ heavy chain protein may participate in cellular activities such as muscle contraction, deformation movement, cytokinesis, and can be used as a substrate for protein kinases and oncogene products. It also participates in organisms such as polysomes and protein synthesis, and maintains cell membrane morphology reaction.
  • the polypeptide of the present invention is homologous to the known sea urchin axonemal dyneins ATPase ⁇ heavy chain protein, and contains axonemal dyneins ATPase (a characteristic sequence of the 3 heavy chain protein family, and has similar physiological functions. It participates in muscles in vivo Abnormal expression of cell activities such as contraction, deformation movement, and cytokinesis can cause the above functions to be disordered and cause related diseases.
  • human dyneins ATPase beta heavy chain protein 16 of the present invention will produce various diseases, especially muscle diseases, ciliary dyskinesia diseases, various tumors, embryonic development disorders, growth disorders, Inflammation, immune diseases, including but not limited to:
  • Muscle disorders muscular dystrophy, muscular dysplasia, muscular dystrophy
  • Ciliary dyskinesias chronic bronchitis, pneumonia, intestinal malabsorption
  • Tumors of various tissues stomach cancer, liver cancer, lung cancer, esophageal cancer, breast cancer, leukemia, lymphoma, thyroid tumor, uterine fibroids, neuroblastoma, astrocytoma, ependymoma, glioblastoma, nerve Fibroma, colon cancer, melanoma, bladder cancer, uterine cancer, endometrial cancer, colon cancer, thymic tumor, nasopharyngeal cancer, laryngeal cancer, tracheal tumor, fibroid, fibrosarcoma, lipoma, liposarcoma
  • Embryonic disorders congenital abortion, cleft palate, limb loss, limb differentiation disorder, atrial septal defect, neural tube defect, congenital hydrocephalus, congenital glaucoma or cataract, congenital deafness
  • Growth and development disorders mental retardation, brain development disorders, skin, fat, and muscular dysplasia, bone and joint dysplasia, various metabolic defects, stunting, dwarfism, Cushing's syndrome Sexual retardation.
  • Inflammation chronic active hepatitis, 'sarcoidosis, polymyositis,' chronic rhinitis, chronic gastritis, cerebrospinal multiple sclerosis, glomerulonephritis, myocarditis, cardiomyopathy, atherosclerosis, gastric ulcer, cervix Inflammation, various infectious inflammations
  • Immune diseases Systemic lupus erythematosus, rheumatoid arthritis, bronchial asthma, urticaria, specific dermatitis, post-infection myocarditis, scleroderma, myasthenia gravis, Guillain-Barre syndrome, common variable immunodeficiency disease , Primary B-lymphocyte immunodeficiency disease, Acquired immunodeficiency syndrome
  • the abnormal expression of the human dyneins ATPase beta heavy chain protein 16 of the present invention will also produce certain hereditary, hematological diseases and the like. '
  • the polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat various diseases, especially muscle diseases, ciliary dyskinesia diseases, various tumors, embryonic development disorders, Growth and developmental disorders, inflammation, immune diseases, certain hereditary, blood diseases, etc. '
  • the invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) human dyneins ATPase beta heavy chain protein 16.
  • Agonists enhance human dyneins ATPase beta heavy chain protein 16 to stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
  • a mammalian cell or a membrane preparation expressing human dyneins ATPase beta heavy chain protein 16 can be cultured with a labeled human d'yneins ATPase beta heavy chain protein 16 in the presence of a drug. The ability of the drug to increase or block this interaction is then determined.
  • Antagonists of human dyneins ATPase beta heavy chain protein 16 include antibodies, compounds, receptor deletions, and the like that have been screened.
  • An antagonist of human dyneins ATPase beta heavy chain protein 16 can bind to human dyneins ATPase beta heavy chain protein 16 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide to make the polypeptide Cannot perform biological functions.
  • human dyneins ATPase beta heavy chain protein 16 can be added to bioanalytical assays by measuring the effect of compounds on the interaction between human dyneins ATPase beta heavy chain protein 16 and its receptors. Determine if the chemical is an antagonist. Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds. Peptide molecules capable of binding to human dyneins ATPase beta heavy chain protein 16 can be screened by various possible combinations of amino acids Obtained by binding to a random peptide library composed of a solid phase. When screening, the human dyneins ATPase beta heavy chain protein 16 molecule should generally be labeled.
  • the present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies.
  • the invention also provides antibodies against the human dyneins ATPase beta heavy chain protein 16 epitope. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments generated from Fab expression libraries.
  • Polyclonal antibodies can be produced by injecting human dyneins ATPase beta heavy chain protein 16 directly into immunized animals (such as rabbits, mice, rats, etc.).
  • immunized animals such as rabbits, mice, rats, etc.
  • a variety of adjuvants can be used to enhance the immune response, including but not limited to 'S adjuvant and so on.
  • Techniques for preparing monoclonal antibodies to human dyneins ATPase beta heavy chain protein 16 include, but are not limited to, hybridoma technology (Kohler and Milstein. Nature, 1975, 256: 495-497), triple tumor technology, human beta-cell hybridoma technology , EBV-hybridoma technology, etc.
  • Chimeric antibodies combining human constant regions and non-human variable regions can be produced using existing techniques (Morrison et al, PNAS, 1985, 81: 6851). 0 Existing techniques for producing single-chain antibodies (US Pat No. .4946778) can also be used to produce single chain antibodies against human dyneins ATPase beta heavy chain protein 16.
  • Heavy chain protein 16 can be used in immunohistochemistry to detect human dyneins ATPase 'beta heavy chain protein 16 in biopsy specimens.
  • Monoclonal antibodies that bind to human dyneins ATPase beta heavy chain protein 16 can also be labeled with radioisotopes and injected into the body to track their location and distribution.
  • This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
  • Antibodies can also be used to design immunotoxins that target a particular part of the body.
  • human dyneins ATPase beta heavy chain protein 16 high affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
  • a common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
  • This hybrid antibody can be used to kill human dyneins ATPase beta heavy chain protein 16 Positive cells.
  • the antibodies of the present invention can be used to treat or prevent diseases related to the human dyneins ATPase beta heavy chain protein 16.
  • Administration of appropriate doses of antibodies can stimulate or block the production or activity of human dyneins ATPase beta heavy chain protein 16.
  • the invention also relates to a diagnostic test method for quantitative and localized detection of human dyneins ATPase beta heavy chain protein 16 levels.
  • tests are well known in the art and include FISH assays and radioimmunoassays.
  • the level of human dyneins ATPase beta heavy chain protein 16 detected in the test can be used to explain the importance of human dyneins ATPase beta heavy chain protein 16 in various diseases and to diagnose human dyneins A disease in which the ATPase beta heavy chain protein 16 functions.
  • polypeptide of the present invention can also be used for peptide mapping analysis.
  • the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
  • Polynucleotides encoding human dyneins ATPase beta heavy chain protein 16 can also be used for a variety of therapeutic purposes. Gene therapy technology can be used to treat abnormal cell proliferation, development or metabolism caused by the non-expression or abnormal / inactive expression of human dyneins ATPase beta heavy chain protein 16.
  • Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated human dyneins ATPase beta heavy chain protein 16, to inhibit endogenous human dyneins ATPase beta heavy chain protein 16 activity.
  • a mutated human dyne ins ATPase beta heavy chain protein 16 may be shortened and lack a signal transduction domain.
  • Human dyneins ATPase beta heavy chain protein 16 although it can bind to downstream substrates, but lacks a signal Conductive activity. Therefore, recombinant gene therapy vectors can be used to treat diseases caused by abnormal expression or activity of human dyneins ATPase beta heavy chain protein 16.
  • Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to transfer a polynucleotide encoding human dyneins ATPase beta heavy chain protein 16 into cells.
  • a method for constructing a recombinant viral vector carrying a polynucleotide encoding a human dyneins ATPase beta heavy chain protein 16 can be found in the existing literature (Sambrook, et al.).
  • a recombinant polynucleotide encoding human dyneins ATPase beta heavy chain protein 16 can be packaged into liposomes and transferred into cells.
  • Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
  • a vector such as a virus, phage, or plasmid
  • Oligonucleotides including antisense RNA and DNA
  • ribozymes that inhibit human dyneins ATPase beta heavy chain protein 16 mRNA are also within the scope of the present invention.
  • a ribozyme is an enzyme-like RNA molecule that can specifically decompose specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA to perform endonucleation.
  • Antisense RNA, DNA, and ribozymes can be obtained using any existing RNA or DNA synthesis technology, such as solid-phase phosphate amide chemical synthesis to synthesize oligonucleotides.
  • Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA. This DNA sequence has been integrated downstream of the vector's RNA polymerase promoter. In order to increase the stability of the nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the phosphorothioate or peptide bond instead of the phosphodiester bond is used for the ribonucleoside linkage.
  • the polynucleotide encoding the human dyneins ATPase beta heavy chain protein 16 can be used for the diagnosis of diseases related to the human dyneins ATPase beta heavy chain protein 16.
  • Encoding human dyneins ATPase beta heavy chain protein The polynucleotide of 16 can be used to detect the expression of human dyneins ATPase beta heavy chain protein 16 or the abnormal expression of human dyneins ATPase beta heavy chain protein 16 in a disease state.
  • the DM sequence encoding human dyneins ATPase beta heavy chain protein 16 can be used to hybridize biopsy specimens to determine the expression of human dyneins ATPase beta heavy chain protein 16.
  • Hybridization techniques include Southern blotting, Northern blotting, in situ hybridization, and the like. These techniques and methods are publicly available and mature, and related kits are commercially available.
  • Some or all of the polynucleotides of the present invention can be used as probes to be fixed on a microarray or a DNA chip (also referred to as a "gene chip") for analyzing differential expression analysis and gene diagnosis of genes in tissues.
  • Human dyneins ATPase beta heavy chain protein 16 specific primers for RNA-polymerase chain reaction (RT-PCR) in vitro amplification can also detect human dyneins ATPase beta heavy chain protein 16 transcription products.
  • Human dyneins ATPase beta heavy chain protein 16 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type human d'yneins ATPase beta heavy chain protein 16 DNA sequence. Mutations can be detected using existing techniques such as Southern imprinting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression. Therefore, Northern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
  • the sequences of the invention are also valuable for chromosome identification.
  • the sequence specifically targets a specific position on a human chromosome and can hybridize to it.
  • specific sites for each gene on the chromosome need to be identified.
  • only a few chromosome markers based on actual sequence data are available for marking chromosome positions.
  • an important first step is to locate these DNA sequences on a chromosome.
  • PCR primers (preferably 15-35bp) are prepared based on cDNA, and the sequences can be located on chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
  • PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
  • oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
  • Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.
  • Fluorescent in situ hybridization of cDNA clones to metaphase chromosomes allows precise chromosomal localization in one step.
  • FISH Fluorescent in situ hybridization
  • the difference in cDNA or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing diseased and diseased individuals usually involves first looking for structural changes in chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).
  • the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
  • suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
  • the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
  • the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell.
  • the polypeptides of the invention can be used in combination with other therapeutic compounds. '
  • the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
  • Human dyneins ATPase beta heavy chain protein 16 is administered in an amount effective to treat and / or prevent a specific indication.
  • the amount and range of human dyneins ATPase beta heavy chain protein 16 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Peptides Or Proteins (AREA)
  • Enzymes And Modification Thereof (AREA)

Abstract

L'invention concerne un nouveau polypeptide, une protéine humaine 16 à multiples liaisons avec la dynéine ATPase béta, et un polynucléotide codant pour ce polypeptide ainsi qu'un procédé d'obtention de ce polypeptide par des techniques recombinantes d'ADN. L'invention concerne en outre les applications de ce polypeptide dans le traitement de maladies, notamment des dystrophies musculaires, des troubles des mouvements ciliaires, des tumeurs malignes, de l'hémopathie, des troubles du développement, de l'infection par VIH, des maladies immunitaires et de diverses inflammations. L'invention concerne aussi l'antagoniste agissant contre le polypeptide et son action thérapeutique ainsi que les applications de ce polynucléotide codant pour la protéine humaine 16 à multiples liaisons avec la dynéine ATPase béta.
PCT/CN2001/000191 2000-03-02 2001-02-26 Nouveau polypeptide, proteine humaine 16 a multiples liaisons avec la dyneine atpase beta, et polynucleotide codant pour ce polypeptide WO2001068876A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU2001239122A AU2001239122A1 (en) 2000-03-02 2001-02-26 Novel polypeptide---human dyneins atpase beta heavy chain protein 16 and polynucleotide encoding it

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN 00111855 CN1311238A (zh) 2000-03-02 2000-03-02 一种新的多肽——人dyneins ATP酶beta重链蛋白16和编码这种多肽的多核苷酸
CN00111855.2 2000-03-02

Publications (1)

Publication Number Publication Date
WO2001068876A1 true WO2001068876A1 (fr) 2001-09-20

Family

ID=4581751

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2001/000191 WO2001068876A1 (fr) 2000-03-02 2001-02-26 Nouveau polypeptide, proteine humaine 16 a multiples liaisons avec la dyneine atpase beta, et polynucleotide codant pour ce polypeptide

Country Status (3)

Country Link
CN (1) CN1311238A (fr)
AU (1) AU2001239122A1 (fr)
WO (1) WO2001068876A1 (fr)

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
DATABASE GENBANK [online] 3 October 1996 (1996-10-03), VAISBERG E.A. ET AL., Database accession no. AAB09728 *

Also Published As

Publication number Publication date
AU2001239122A1 (en) 2001-09-24
CN1311238A (zh) 2001-09-05

Similar Documents

Publication Publication Date Title
WO2001064892A1 (fr) Nouveau polypeptide, threonyl-arnt synthetase humaine 14, et polynucleotide codant pour ce polypeptide
WO2001068688A1 (fr) Nouveau polypeptide, proteine kinase humaine tak1-27, et polynucleotide codant pour ce polypeptide
WO2001083538A1 (fr) Nouveau polypeptide, proteine humaine 36 du gene k-ras, et polynucleotide codant pour ce polypeptide
WO2001066730A1 (fr) Nouveau polypeptide, proteine humaine rs3 12, et polynucleotide codant pour ce polypeptide
WO2001068876A1 (fr) Nouveau polypeptide, proteine humaine 16 a multiples liaisons avec la dyneine atpase beta, et polynucleotide codant pour ce polypeptide
WO2001070965A1 (fr) Nouveau polypeptide, facteur humain de regulation de la transcription 15, et polynucleotide codant pour ce polypeptide
WO2001075023A2 (fr) Nouveau polypeptide, phosphatidylinositol-3 (ptdins 3) kinase humaine 9, et polynucleotide codant pour ce polypeptide
WO2001079423A2 (fr) Nouveau polypeptide, proteine humaine bcr 10, et polynucleotide codant pour ce polypeptide
WO2001049727A1 (fr) Nouveau polypeptide, transducteur de signal 9 a effet chemotactique de bacteries, et polynucleotide codant pour ce polypeptide
WO2001055414A1 (fr) Nouveau polypeptide, proteine rgs 17, et polynucleotide codant pour ce polypeptide
WO2001055419A1 (fr) Nouveau polypeptide, site de liaison 27 d'arn s1, et polynucleotide codant pour ce polypeptide
WO2001081537A2 (fr) Nouveau polypeptide, sous-unite 49 humaine du facteur c(a1) 37kd de replication de l'adn, et polynucleotide codant pour ce polypeptide
WO2001079437A2 (fr) Nouveau polypeptide, facteur humain de transcription de la differentiation cellulaire 14, et polynucleotide codant pour ce polypeptide
WO2001075024A2 (fr) Nouveau polypeptide, facteur humain 13 associe a nf-e2, et polynucleotide codant pour ce polypeptide
WO2001073061A1 (fr) Nouveau polypeptide, proteine humaine 22 du retinoblastome, et polynucleotide codant pour ce polypeptide
WO2001081535A2 (fr) Nouveau polypeptide, proteine pax humaine 9.9, et polynucleotide codant pour ce polypeptide
WO2001079428A2 (fr) Nouveau polypeptide, proteine humaine de reparation 8.9 du mesappariement de l'adn, et polynucleotide codant pour ce polypeptide
WO2001070782A1 (fr) Nouveau polypeptide, dihydroorotase humaine 9, et polynucleotide codant pour ce polypeptide
WO2001070791A1 (fr) Nouveau polypeptide, facteur humain lie a nf-e2, et polynucleotide codant pour ce polypeptide
WO2001075079A1 (fr) Nouveau polypeptide, dihydroorotase humaine 13, et polynucleotide codant pour ce polypeptide
WO2001090171A1 (fr) Nouveau polypeptide, proteine humaine ribosomale sii 12, et polynucleotide codant ce polypeptide
WO2001073065A1 (fr) Nouveau polypeptide, glycinamide ribonucleotide synthetase humaine 12, et polynucleotide codant pour ce polypeptide
WO2001074891A1 (fr) Nouveau polypeptide, proteine humaine de regulation de la transcription 17, et polynucleotide codant pour ce polypeptide
WO2001081536A2 (fr) Nouveau polypeptide, proteine kinase ysk1 humaine 10, et polynucleotide codant pour ce polypeptide
WO2001064893A1 (fr) Nouveau polypeptide, transcriptase inverse humaine 13, et polynucleotide codant pour ce polypeptide

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP