WO2006023210A2 - Gene gp132: techniques et compositions de traitement du cancer - Google Patents

Gene gp132: techniques et compositions de traitement du cancer Download PDF

Info

Publication number
WO2006023210A2
WO2006023210A2 PCT/US2005/026297 US2005026297W WO2006023210A2 WO 2006023210 A2 WO2006023210 A2 WO 2006023210A2 US 2005026297 W US2005026297 W US 2005026297W WO 2006023210 A2 WO2006023210 A2 WO 2006023210A2
Authority
WO
WIPO (PCT)
Prior art keywords
mammal
expression
cancer
cell
tumor
Prior art date
Application number
PCT/US2005/026297
Other languages
English (en)
Other versions
WO2006023210A3 (fr
Inventor
Ronan C. O'hagan
Karuppiah Kannan
David Bailey
Murray Robinson
Original Assignee
Aveo Pharmaceuticals, Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Aveo Pharmaceuticals, Inc. filed Critical Aveo Pharmaceuticals, Inc.
Publication of WO2006023210A2 publication Critical patent/WO2006023210A2/fr
Publication of WO2006023210A3 publication Critical patent/WO2006023210A3/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1137—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against enzymes
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00—Genetically modified animals
    • A01K2217/05—Animals comprising random inserted nucleic acids (transgenic)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/11—Antisense
    • C12N2310/111—Antisense spanning the whole gene, or a large part of it
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/14—Type of nucleic acid interfering N.A.

Definitions

  • This invention relates generally to the field of molecular biology. More particularly, this invention relates to genes involved in cancer genesis, maintenance, and progression.
  • GPl 32 is involved in hyperproliferative conditions such as cancer. Up-regulation of GP 132 contributes to tumorigenesis (i.e., initiation) and tumor development (including maintenance, progression, and/or metastasis) in a mammal (e.g., a mouse, a nonhuman primate, or a human). GP 132 encodes mitogen-activated protein kinase kinase kinase 7 (GenBank Accession No. NP_663304; UniGene ID Hs.290346), and is located at human chromosome 6ql6.1-ql5.3. An exemplary human GP 132 protein has the polypeptide sequence of SEQ ID NO: 1. As used herein, "GP 132" refers to the gene or the coding sequence or a protein product of the gene (depending on the context) of any animal species.
  • the invention relates to antibodies that specifically bind the GP 132 protein.
  • the antibodies that specifically bind the GP 132 block or inhibit the binding of the GP 132 protein to its natural ligand, thereby disrupting the tumorigenic signal transmitted by the ligand. As a result, tumorigenesis and/or tumor development in a patient is delayed or prevented.
  • This invention also includes modulators of GPl 32 activities.
  • modulators include antagonists of GP 132 activities, which antagonists prevent or inhibit tumor growth in vitro.
  • the antagonists can also prevent tumorigenesis, tumor development, tumor maintenance, tumor recurrence, tumor growth, or the growth of tumor cells in vivo.
  • the antagonists may inhibit either the biological functions or the production of the GP 132 protein in cells.
  • the antagonists include, without limitation, blocking antibodies, small molecular compounds (e.g., organic compounds, peptides, and peptide mimetics), antisense nucleic acids, ribozymes, and interfering RNAs.
  • the antagonists may reduce GP132 activity levels by at least 50% (e.g., at least 60%, 70%, 80%, or 90%).
  • This invention also provides methods of inducing apoptosis in a cell.
  • the methods include contacting the cell with an effective amount of a GP 132 antagonist.
  • compositions comprising the above modulators.
  • the compositions may comprise or be used in combination with other cancer therapeutics.
  • Exemplary cancer therapeutics include farnesyl transferase inhibitors, tamoxifen, herceptin, taxol, STI571, cisplatin, 5-fluorouracil, Cytoxan, and irradiation, some of which specifically target members of the ras tumorigenic pathway.
  • the invention also features genetically-modified mammals, such as transgenic or chimeric non-human mammals, whose genomes comprise a GP 132- coding sequence.
  • the GP132-coding sequence may be linked to a constitutive promoter or an inducible promoter to allow overexpression of the GP132 protein.
  • the GP132-coding sequence may contain one or more mutations (e.g., a dominant negative mutation or an activating mutation), to allow, e.g., extinction of expression or activity of the GP 132 protein.
  • the invention also includes mammals whose endogenous GP132 gene locus (or loci) comprises (1) a null mutation (i.e., heterozygous or homozygous knockout mammals), or (2) a regulatory or coding region mutation engineered through technologies such as knockin modifications on a somatic or germline level.
  • a null mutation i.e., heterozygous or homozygous knockout mammals
  • a regulatory or coding region mutation engineered through technologies such as knockin modifications on a somatic or germline level.
  • the invention features a genetically modified non-human mammal, such as a transgenic or chimeric nonhuman mammal, e.g. a mouse, whose genome comprises: (a) an expression construct comprising a GP 132 coding sequence operably linked to an inducible promoter, and (b) a genetic mutation that causes the genetically modified non-human mammal to have greater susceptibility to cancer than a mammal not comprising the genetic mutation, where expression of the GP132 gene leads to formation of cancer in the genetically modified non-human mammal and the cancer regresses when expression and/or activity of the GP 132 gene is reduced.
  • a genetically modified non-human mammal such as a transgenic or chimeric nonhuman mammal, e.g. a mouse
  • whose genome comprises: (a) an expression construct comprising a GP 132 coding sequence operably linked to an inducible promoter, and (b) a genetic mutation that causes the genetically modified non-human mammal
  • Mutations that render the mammal more susceptible to cancer include disabling mutations in a tumor suppressor gene (e.g., INK4a) and activating mutations in an oncogene (e.g., myc and ras).
  • a tumor suppressor gene e.g., INK4a
  • an oncogene e.g., myc and ras
  • the induction of the GPl 32 expression occurs in a tissue-specific manner, i.e., the GPl 32 transgene can be turned on or off only in a particular tissue of the mammal. This embodiment allows one to study the development (including maintenance), regression and recurrence of tumor in a selected tissue or organ of the mammal as well as the efficacy and tissue toxicity of candidate drugs that target GP 132.
  • This invention further provides methods for identifying compounds useful in treating hyperproliferative conditions such as cancer.
  • One such method involves contacting a cell comprising the GP132 encoding sequence or the GP132 protein with a candidate compound, and detecting any reduction in the expression of the gene or activity level of the protein, wherein either reduction indicates that the candidate compound is useful in treating cancer.
  • a biomarker for inhibition of GP 132 activity is first identified; and the activity of this biomarker in cells or a mammal contacted by a test compound is then determined, wherein an alteration of the biomarker activity relative to uncontacted cells or an uncontacted mammal indicates that the test compound is a potential anti-cancer drug.
  • a first molecular profile (e.g., transcriptional, proteomic or genomic) is established by, e.g., identifying a plurality of biomarkers whose patterns of expression or biological function alteration are characteristic of inhibition of GP 132 activity and/or expression in cancer cells in the absence of a test compound; a corresponding second molecular profile of biomarkers is established characteristic for a candidate compound; and then the two profiles are compared, wherein substantial similarity of the two profiles indicates that the test compound is a modulator of GP 132 expression and/or activity, and may further indicate the test compound is a potential anti-cancer drug.
  • a first molecular profile e.g., transcriptional, proteomic or genomic
  • Substantial similarity means that the Pearson correlation coefficient of biomarker expression/activity for the two molecular profiles is statistically significant, with &p value of less than 0.1 (e.g., less than 0.05, 0.02, or 0.01).
  • the non-overlapping portion between the two profiles may represent nonspecific activity of the candidate compound and allow prediction of the potential toxicity of the compound.
  • Another method employs cells containing a GP 132 transgene operably linked to an inducible promoter (e.g., cells derived from the above- described inducible mouse model).
  • an inducible promoter e.g., cells derived from the above- described inducible mouse model.
  • a first molecular profile e.g., transcriptional, proteomic or genomic
  • GP 132 activity is established by, e.g., identifying a plurality of biomarkers whose patterns of expression or biological function alteration are characteristics of switching off the GP 132 transgene expression and/or activity.
  • a second molecular profile is established for a candidate compound; and then the two profiles are compared, wherein substantial similarity of the two profiles indicates that the test compound is a modulator of GPl 32 expression and/or activity, and may further indicate the test compound is a 26297
  • the non-overlapping portion between the two profiles may be indicative of the potential toxicity of the compound.
  • This invention also provides methods of treating various hyperproliferative conditions such as cancers, psoriasis, arteriosclerosis, arthritis and diabetic retinopathy and other disorders related to uncontrolled angiogenesis and/or vasculogenesis. These methods involve administering an inhibitor or antagonist of GP132 gene expression or GP132 protein activity to amammal (e.g., a mouse, a rat, a nonhuman primate, or a human). Various stages of cancer are treated by these methods, including neoplasia and malignant tumors.
  • Cancers that can be treated by these methods include, without limitation, cancers that have failed other therapies, cancers at various stages of evolution (including recurring, resistant and minimal residual cancers), cancers whose etiology involves ras and/or other members of the ras signal transduction pathways, and cancers in which GP 132 is overexpressed.
  • This invention also features methods of diagnosing an abnormal hyperproliferative condition (e.g., cancer) in a subject. These methods involve detecting the expression level of the GP 132 gene or the activity level of the GP 132 protein, wherein an abnormally high level relative to control (e.g., at least 50%, 100%, 150%, 200%, 250%, or 300% higher) is indicative of an abnormal hyperproliferative condition.
  • an abnormally high level relative to control e.g., at least 50%, 100%, 150%, 200%, 250%, or 300% higher
  • the invention provides antagonists of GP 132 which inhibit the activity of GP 132. It also provides compositions comprising the GP 132 antagonists in a pharmaceutically acceptable carrier.
  • the invention provides host cells comprising an expression construct containing a GP132-coding nucleic acid operably linked to an inducible or constitutive promoter, hi some embodiments, such a host cell further comprises a genetic mutation that causes the cell to have greater susceptibility to becoming a cancerous cell than a cell not comprising said genetic mutation, hi some embodiments, the host cell further comprises a genetic mutation selected from the group consisting of (1) a disabling mutation in a tumor suppressor gene, (2) a disabling mutation in a DNA repair gene, and (3) an activating mutation in an oncogene.
  • This invention also provides a genetically modified non-human mammal, e.g., a mouse, at least some of whose cells contain a genome that includes: (a) a recombinant GP132-encoding nucleic acid operably linked to an expression control sequence (e.g., an inducible or a constitutive promoter), and (b) a genetic mutation that causes the mammal to have a greater susceptibility to cancer than a mammal whose cells do not contain the genetic mutation.
  • an expression control sequence e.g., an inducible or a constitutive promoter
  • the genetic mutation in the genetically-modified mammal is selected from the group consisting of (1) a disabling mutation in a tumor suppressor gene, (2) a disabling mutation in a DNA repair gene, and (3) an activating mutation in an oncogene.
  • the genetic mutation involves a tumor suppressor gene and renders the tumor suppressor gene non-functional.
  • the genetically modified nonhuman mammal can be a conventional transgenic mammal, all of whose cells contain the recombinant GP132-encoding nucleic acid operably linked to an expression control sequence, and the genetic mutation that causes the mammal to have increased susceptibility to cancer.
  • the mammal is a chimeric mammal at least some of whose, but not all of whose, somatic cells contain the recombinant GP132-encoding nucleic acid operably linked to an expression control sequence, and the genetic mutation that causes the mammal to have a increased susceptibility to cancer.
  • the percentage of somatic cells comprising a recombinant GP132-coding nucleic acid operably linked to a constitutive or inducible promoter, and a genetic mutation that causes the mammal to have a greater susceptibility to cancer is between 5% and 95%. Preferably it is between 15% and 85%. In some embodiments of such a chimeric mammal, the percentage of chimerism is at least 30%, at least 40%, or at least 50%. In some embodiments of the invention, the GP132-encoding nucleic acid is operably linked to a tissue- specific expression system.
  • the invention also provides a genetically modified non-human mammal, wherein the genetic modification reduces or eliminates expression of one or both of the mammal's endogenous GP132 alleles.
  • a genetic modification reduces or eliminates expression of one or both of the mammal's endogenous GP132 alleles.
  • Such reduction or elimination of GP 132 expression can be achieved, for example, when the genetic modification is addition of an RNAi expression construct targeting GP 132 gene expression, or when the genetic modification is a knockout of one or both of the GP132 alleles.
  • Such a genetic modification can reduce or eliminate GP 132 expression in a tissue- specific manner.
  • the genetically modified mammal is chimeric with respect to the genetic modification.
  • the invention further provides genetically-modified (e.g., chimeric or transgenic) non-human mammals (e.g., mice) comprising (a) an expression construct containing GPl 32 nucleotide sequence operably linked to an inducible or constitutive promoter; and (b) a genetic mutation that causes said genetically- modified mammal to have greater susceptibility to cancer than a mammal not comprising said genetic mutation, wherein expression of the GP132-coding nucleic acid leads to formation of cancer in said genetically-modified mammal, and wherein said cancer regresses in said genetically-modified mammal when expression or activity of said GP132-coding nucleic acid is reduced.
  • genetically-modified e.g., chimeric or transgenic
  • both somatic and germ cells of the genetically-modified mammal comprise the GP132-coding nucleic acid.
  • the invention provides a genetically-modified chimeric mammal where the percentage of chimerism is at least 30%, at least 40%, or at least 50%.
  • the genetic mutation in the genetically-modified mammal is selected from the group consisting of (1) a disabling mutation in a tumor suppressor gene, (2) a disabling mutation in a DNA repair gene, and (3) an activating mutation in an oncogene.
  • the tumor suppressor gene is INK4a.
  • the oncogene is myc or ras.
  • the GP 132- coding nucleic acid is expressed in a tissue-specific manner.
  • This invention provides a genetically-modified (e.g., transgenic or chimeric) non-human mammal comprising a disruption of the endogenous GPl 32 gene.
  • both copies of the endogenous GP 132 gene are disrupted.
  • both somatic and germ cells comprise the disrupted endogenous GP132 gene.
  • the GP132 gene is disrupted in a specific tissue.
  • the GP 132 gene is disrupted using interfering RNA molecules, m some embodiments, the expression of the interfering RNA molecules is constitutive or inducible.
  • the chimerism is at least 30%, at least 40% or at least 50%.
  • the mammal is a mouse.
  • the invention also includes a cell derived from said mammal. This invention provides a method of inhibiting expression of a
  • GP132-coding nucleic acid using RNA interference The invention also provides a genetically-modified (e.g., transgenic or chimeric) non-human mammal wherein expression of the endogenous GP 132 gene is inhibited by an interfering RNA molecule specific to GP 132.
  • This invention provides methods of identifying whether a candidate compound is an agonist or an antagonist of GPl 32.
  • the first method includes: (a) administering to a mammal the candidate compound; and (b) observing the effect of the compound on the level of GP 132 mRNA or protein expression, or activity of GP 132.
  • the second method includes: (a) obtaining a cell comprising an expression construct containing GP132-coding nucleic acid; (b) contacting the cell with the candidate compound; and (c) observing the effect of the compound on the level of GP132 mRNA or protein expression, or activity of GP132.
  • the third method includes: (a) contacting a GP132-coding nucleic acid or protein with the candidate compound; and (b) observing the effect of the compound on the level of GP 132 mRNA or protein expression, or activity of GP 132. In each method, a decrease in mRNA or protein expression or activity indicates that the compound is an antagonist, and an increase in mRNA or protein expression or activity indicates that the compound is an agonist.
  • the invention also provides a method of identifying a candidate compound useful for treating a hyperproliferative condition.
  • the method includes: (a) identifying a biomarker whose activity is indicative of or correlates with inhibition of GP 132 activity and/or expression; and (b) determining the activity of the biomarker in the presence and absence of a candidate compound.
  • An alteration of the biomarker activity in the presence of the candidate compound relative to the activity of the biomarker in the absence of the candidate compound indicates potential usefulness of the compound as a modulator of GP 132 expression and/or activity, and may further indicate the usefulness of the compound for treating the hyperproliferative condition.
  • the hyperproliferative condition associated with increased expression or activity of GP 132 may be related to uncontrolled angiogenesis or vasculogenesis, cancer, psoriasis, arteriosclerosis, arthritis, or diabetic retinopathy.
  • the invention also provides a screening method for identifying a compound useful for treating a hyperproliferative condition. The method includes: (a) identifying a biomarker whose level correlates with inhibition of GP 132 activity or expression; and (b) detecting a change in the level of the biomarker in the presence of a test compound relative to the level of the biomarker detected in the absence of the test compound.
  • a change in the level of the biomarker in the presence of a test compound relative to the level of the biomarker detected in the absence of the test compound may indicate potential usefulness of the test compound as a modulator of GP 132 expression and/or activity, and may further indicate the usefulness of the test compound for treating the hyperproliferative condition.
  • the hyperproliferative condition may be related to uncontrolled angiogenesis or vasculogenesis, cancer, psoriasis, arteriosclerosis, arthritis, or diabetic retinopathy.
  • the invention provides another method of identifying a candidate compound useful for treating a hyperproliferative condition.
  • the method includes: (a) establishing a first molecular profile indicative of inhibition of GP 132 activity and/or expression; (b) establishing a second molecular profile for the candidate compound; and (c) comparing the first and second molecular profiles.
  • a substantial similarity of the first and second profile indicates potential usefulness of the candidate compound as a modulator of GP 132 expression and/or activity, and may further indicate the usefulness of the compound for treating the hyperproliferative condition.
  • the molecular profile can be a transcriptional, proteomic or genomic profile.
  • This invention provides another method of identifying a candidate compound useful for treating a hyperproliferative condition.
  • the method includes: (a) obtaining a cell comprising an expression construct containing GP132-coding nucleic acid operably linked to an inducible or constitutive promoter; (b) identifying a first molecular profile indicative of switching off GP 132 activity and/or expression in the cell; (c) identifying a second molecular profile for a candidate compound; and (d) comparing the first and second molecular profiles.
  • a substantial similarity of the first and second profiles indicates potential usefulness of the compound as a modulator of GP 132 expression and/or activity, and may further indicate the usefulness of the compound for treating the hyperproliferative condition.
  • the hyperproliferative condition associated with increased expression of GP 132 may be related to uncontrolled angiogenesis or vasculogenesis, cancer, psoriasis, arteriosclerosis, arthritis, or diabetic retinopathy.
  • This invention also provides a first method of determining the efficacy of a candidate compound in preventing or treating a hyperproliferative condition.
  • the method includes: (a) identifying a biomarker whose activity is indicative of inhibition of GP 132 activity and/or expression; and (b) determining the activity of the biomarker in the presence and absence of a candidate compound.
  • An alteration of the biomarker activity in the presence of the candidate compound relative to the activity of the biomarker in the absence of the candidate compound indicates effectiveness of the compound as a modulator of GP 132 expression and/or activity, and may further indicate the effectiveness of the compound for treating the hyperproliferative condition.
  • This invention provides a second method of determining the efficacy of a candidate compound in preventing or treating a hyperproliferative condition.
  • the method includes: (a) administering to a mammal a candidate compound which is known to modulate GP 132 expression or activity; and (b) observing the effect of the compound on tumor development, maintenance, angiogenesis and/or progression in the mammal. Regression and/or reduction of tumor size in the presence of the compound indicates potential effectiveness of the compound as a modulator of GP 132 expression and/or activity, and may further indicate the effectiveness of the compound for treating the hyperproliferative condition.
  • the invention also provides a third method of determining the efficacy of a candidate compound in preventing or treating a hyperproliferative condition.
  • the method includes: (a) establishing a first molecular profile indicative of inhibition of GP 132 activity and/or expression; (b) establishing a second molecular profile for a candidate compound; and (c) comparing the first and second molecular profiles.
  • Substantial similarity of the first and second profile indicates potential effectiveness of the candidate compound as a modulator of GP 132 expression and/or activity, and may further indicate the effectiveness of the compound for treating the hyperproliferative condition.
  • This invention provides a fourth method of determining the efficacy of a candidate compound in preventing or treating a hyperproliferative condition.
  • the method includes: (a) producing a cell comprising an expression construct containing GP132-coding nucleic acid operably linked to an inducible or constitutive promoter; (b) identifying a first molecular profile indicative of switching off GP 132 activity and/or expression in the cell; (c) identifying a second molecular profile for a candidate compound; and (d) comparing the first and second molecular profiles.
  • Substantial similarity of the first and second profiles indicates potential effectiveness of the compound as a modulator of GP 132 expression and/or activity, and may further indicate the effectiveness of the compound for treating the hyperproliferative condition.
  • the invention also provides a screening method for identifying a compound useful in treatment of a hyperproliferative condition such as cancer.
  • the method includes: (a) providing an inhibitor of GP 132 expression or activity; (b) identifying a negative control biomarker pattern formed by a plurality of biomarkers in a cancer cell wherein the cell is not contacted with the inhibitor of GP 132 expression or activity; (c) identifying a positive control biomarker pattern formed by a plurality of biomarkers in the cancer cell wherein the cancer cell is contacted with the inhibitor of GPl 32 expression or activity; (d) identifying a test biomarker pattern formed by a plurality of biomarkers in the cancer cell wherein the cancer cell is contacted with a candidate compound but not contacted with the inhibitor of GP 132 expression or activity; and (e) comparing the negative control biomarker pattern, positive control biomarker pattern and test biomarker pattern, and detecting a greater similarity between the positive control biomarker pattern and the test biomarker pattern than between the
  • FIG. 1 is a histogram summarizing data that show inhibition of growth of human cancer cell lines in soft agar by siRNA-mediated knockdown of GP 132 expression.
  • GP 132 This invention is based in part on the discovery that a gene designated GP 132 is involved in cancer. GP 132 has been found to be necessary and sufficient for tumor maintenance. GP 132 was identified by the Mammalian Second Site Suppression ("MaSS") screening system described below and in WO 02/079419. Up-regulation of GP 132 contributes to tumorigenesis and tumor maintenance in a mammal.
  • MoSS Mammalian Second Site Suppression
  • the GP132 protein i.e., mitogen-activated protein kinase kinase kinase 7 (MAP3K7), is a member of the serine/threonine protein kinase family that mediates signal transduction induced by, e.g., TGF beta and bone morphogenetic protein (BMP).
  • GP 132 also controls a variety of cell functions including transcription regulation and apoptosis.
  • GP 132 forms a kinase complex including TRAF6, MAP3K7P1/TAB1 and MAP3K7P2/TAB2. This complex is required for the activation of nuclear factor kappa B.
  • GP132 also can activate MAPK8/JNK, MAP2K4/MKK4, and thus plays a role in the cell response to environmental stress.
  • An exemplary human GP 132 protein contains 606 amino acid residues and has the following polypeptide sequence:
  • VAELDQDEKD QQNTSRLVQE HKKLLDENKS LSTYYQQCKK QLEVIRSQQQ KRQGTS (SEQ ID NO: 1 ; GenBank No. NP_663304)
  • a coding sequence for this polypeptide is: atgtctacag cctctgccgc ctcctcctcc tcctcgtctt -cggccggtga gatgatcgaa gccccttccc aggtcctcaa ctttgaagag atcgactaca aggagatcga ggtggaagag gttgtggaa gaggagccttt tggagtggaa gaggagccttt tggagttgtttgcaaagcta agtggagagc aaaagatgtt gctattaaac aatagaaag tgaatctgag aggaaagcgt tattgtaga gcttcggcag ttatcccgtgt
  • Human GP 132 has at least twelve alternatively spliced transcript variants, altogether encoding 10 different protein iso forms.
  • Other human GP 132 polypeptide sequences include GenBank Nos. BAA25026, BAA25025, BAA25027, AAH17715, JC5955, and JC5956.
  • Other human GP132 nucleotide sequences include GenBank Nos. AB009357, AB009356, AB009358, and BC017715.
  • GP 132 orthologs in other animal species have also been identified; their sequences are GenBankNos.
  • NP_766276 (mouse), ENSRNOG00000005724 (rat), AAC14008 (Xenopus), SINFRUG00000137915 (Fugu), ENSANGG00000008399 (mosquito), NP_524080 (Drosophila), ENSDARG00000020469 (Zebrafish), F52F12.3 (C. elegans), ENSCBRGOOOOOOl 1775 (C. briggsae), NP_009411 (Saccharomyces cerevisiae), and CA1447 (Candida).
  • the GP 132 gene is expressed in a variety of tissues, including heart, kidney, liver, lung, bone, muscle, central and peripheral nervous systems (e.g., brain), skin, spleen, stomach, endocrine glands (e.g., parathyroid and pineal gland), eye (e.g., retina), gastrointestinal tract (e.g., colon), pancreas (e.g., islets), genitourinary organs (e.g., prostate, testis), germ cells, uterus, cervix, mammary gland, ovary, fetus, placenta, T and B cells, lymph node, thymus, blood vessels, and blood.
  • tissues including heart, kidney, liver, lung, bone, muscle, central and peripheral nervous systems (e.g., brain), skin, spleen, stomach, endocrine glands (e.g., parathyroid and pineal gland), eye (e.g., retina), gastrointestinal tract (e.g., colon), pancre
  • cancer tissue types e.g., brain tumors, colon cancer, lung cancer, liver cancer, lymphoma, breast cancer, and prostate cancer
  • derivative cancer cell lines e.g., cancer cell lines derived from colon cancer, leukemia, breast cancer, and prostate cancer.
  • the GP132 gene is believed to be involved in development (including maintenance, progression, angiogenesis, and/or metastasis) of various cancers, e.g., cancers of the skin (melanoma), lung, prostate, breast, colorectal, liver, pancreatic, brain, testicular, ovarian, uterine, cervical, kidney, thyroid, bladder, esophageal, and hematological tissues.
  • various cancers e.g., cancers of the skin (melanoma), lung, prostate, breast, colorectal, liver, pancreatic, brain, testicular, ovarian, uterine, cervical, kidney, thyroid, bladder, esophageal, and hematological tissues.
  • nucleic acid sequences specifically provided herein are sequences of deoxyribonucleotides. However, the given sequences are to be interpreted as would be appropriate to the polynucleotide composition. For example, if the isolated nucleic acid is PvNA, the given sequence intends ribonucleotides, with uridine substituted for thymidine, hi some embodiments, differences from naturally occurring nucleic acids, e.g., non-native bases, altered internucleoside linkages, post-synthesis modification, can be present throughout the length of the GP 132 nucleic acid or can usefully be localized to discrete portions thereof. For example, a chimeric nucleic acid can be synthesized that has discrete DNA and RNA domains and demonstrated utility for targeted gene repair. See, e.g., U.S. Pat. Nos. 5,760,012 and 5,731,181.
  • Polymorphisms such as single nucleotide polymorphisms (SNPs) occur frequently in eukaryotic genomes. Additionally, small deletions and insertions, rather than SNPs, are not uncommon in the general population, and often do not alter the function of the protein. Accordingly, this invention relates not only to isolated nucleic acids identical in sequence to those described with particularity herein, but also isolated nucleic acids that are allelic variants of those particularly described nucleic acid sequences, hi some embodiments, such sequence variations can be non-naturally occurring, i.e., can result from human intervention, as by random or directed mutagenesis.
  • SNPs single nucleotide polymorphisms
  • the invention relates to isolated nucleic acid molecules that encode the entirety or part (e.g., one or more domains or smaller fragments, e.g., at least five, seven, or nine contiguous amino acid residues) of the GP 132 protein, including allelic variants of this protein.
  • the genetic code is degenerate and codon choice for optimal expression varies from species to species.
  • the coding sequences used in this invention include degenerate variants of the sequences described herein with particularity.
  • the isolated polynucleotide may comprise a nucleotide sequence encoding SEQ ID NO: 1.
  • nucleic acids can be used, for example, to express the GP 132 protein or specific portions of the protein, either alone or as elements of a fusion protein (e.g., to express epitopic or immunogenic fragments of the GP132 protein). For example, such nucleic acids are used to produce non-human animals of the invention. These nucleic acids can also be used as probes to hybridize to GP132 nucleic acids and related nucleic acid sequences.
  • This invention also relates to nucleic acids comprising sequences coding for polypeptides containing conservative amino acid substitutions or moderately conservative amino acid substitutions from those polypeptides described with particularity herein. These amino acid substitutions can be due to, e.g., allelic variations, naturally occurring mutations, or manmade mutations.
  • This invention also relates to isolated polynucleotides that hybridize to one or more of the above-described GP132-encoding nucleic acids. These cross-hybridizing nucleic acids can be used, e.g., as hybridization probes, primers, and/or for expression of proteins that are related to GP 132 as isoforms and homologs (e.g., paralogs, and orthologs).
  • the invention relates to an isolated nucleic acid comprising a sequence that hybridizes under high stringency conditions to a probe comprising a fragment of SEQ ID
  • high stringency conditions are defined for solution phase hybridization as aqueous hybridization (i.e., free of formamide) in 6X SSC (where 2OX SSC contains 3.0 M NaCl and 0.3 M sodium citrate), 1% SDS at 65°C for 8-12 hours, followed by two washes in 0.2X SSC, 0.1% SDS at 65 0 C for 20 minutes. It will be appreciated by the skilled worker that hybridization at 65 °C will occur at different rates depending on a number of factors including the length and percent identity of the sequences which are hybridizing.
  • the hybridizing portion of a reference nucleic acid is typically at least 15 nucleotides in length, and often at least 17 , 20, 25, 30, 35, 40 or 50 nucleotides in length.
  • Cross-hybridizing nucleic acids that hybridize to a larger portion of the reference nucleic acid — for example, to a portion of at least 50, 100, 150, 200, 250, 300, 350, 400, 450, 500 or more nucleotides, up to and including the entire length of the reference nucleic acid, are also useful.
  • This invention also relates to isolated polynucleotides that are substantially identical to the above-described hybridizing polynucleotides, but include one or more mismatches with respect to the hybridizing portion of their corresponding reference nucleic acids.
  • Such mismatch polynucleotides may demonstrate a measurably or detectably lower hybridization rate under the same or substantially similar stringency conditions when compared to their counterparts lacking mismatches.
  • Mismatch polynucleotides may useful as controls for non ⁇ specific hybridization.
  • Fragments of the above-described nucleic acids also relate to this invention. They can be used as region-specific probes, as amplification primers, regulatory sequences to direct expression of a gene, and/or to direct expression of a GP132 polypeptide fragment (e.g., one or more domains of GP132 or an immunogenic fragment).
  • a GP132 polypeptide fragment e.g., one or more domains of GP132 or an immunogenic fragment.
  • the nucleic acid probes may comprise a detectable label, e.g., a radioisotope, a fluorescent compound, an enzyme, or an enzyme co-factor.
  • a detectable label e.g., a radioisotope, a fluorescent compound, an enzyme, or an enzyme co-factor.
  • Such probes can be used as a part of a diagnostic kit for identifying cells or tissues (i) that mis-express a GP132 protein (e.g., aberrant splicing, or abnormal mRNA levels), or (ii) that harbor a mutation in the GPl 32 gene, such as a deletion, an insertion, or a point mutation.
  • diagnostic kits preferably include labeled reagents and instructional inserts for their use.
  • the nucleic acid primers can be used in PCR, primer extension and the like. They are, e.g., at least 6 nucleotides (e.g., at least 7, 8, 9, or 10) in length.
  • the primers can hybridize to an exonic sequence of a GP 132 gene, for example, for amplification of a GP 132 mRNA or cDNA.
  • the primers can hybridize to an intronic sequence or an upstream or downstream regulatory sequence of a GPl 32 gene, to utilize non-transcribed, e.g., regulatory portions of the genomic structure of a GP 132 gene.
  • the nucleic acid primers can also be used, for example, to prime single base extension (SBE) for SNP detection (see, e.g., U.S. Pat. No. 6,004,744).
  • SBE single base extension
  • Isothermal amplification approaches, such as rolling circle amplification, are also now well-described. See, e.g., Schweitzer et al., Curr. Opin. Biotechnol. 12(l):21-7 (2001); U.S. Patent Nos. 5,854,033 and 5,714,320 and international patent publications WO 97/19193 and WO 00/15779.
  • Rolling circle amplification can be combined with other techniques to facilitate SNP detection. See, e.g., Lizardi et al., Nature Genet.
  • Nucleic acid fragments that encode 5 or more contiguous amino acids are useful in directing the synthesis of peptides that have utility in mapping the epitopes of the GP132 protein. See, e.g., Geysen et al, Proc. Natl. Acad. Sci. USA 81:3998-4002 (1984); and U.S. Pat. Nos. 4,708,871 and 5,595,915. Such nucleic acid fragments are also useful in directing the synthesis of peptides that have utility as immunogens for generating anti-GP132 antibodies.
  • nucleotide sequence having at least 25, 30, 35, 40, 45, 50, 100, 150, 200, 250, 300, 350, 400, 450, 500 or more nucleotides are also useful, and at times preferred, as will be appreciated by the skilled worker.
  • the invention further relates to single exon probes having portions of no more than one exon of the GP132 gene.
  • Such single exon probes have particular utility in identifying and characterizing splice variants, hi particular, these probes are useful for identifying and discriminating the expression of distinct isoforms of GP132.
  • Antisense Nucleic Acids Some embodiments of the invention relate to isolated nucleic acids that are antisense polynucleotides that specifically hybridize to GP 132 sense polynucleotides.
  • the antisense nucleic acid molecule can be complementary to the entire coding or non-coding region of GP 132, but more often is an oligonucleotide that is antisense to only a portion of the coding or non-coding region of GP 132 mRNA.
  • the antisense oligonucleotide can be complementary to the region surrounding the translation start site of GP 132 mRNA.
  • An antisense oligonucleotide can be, for example, about 5, 10, 15, 20, 25, 30, 35, 40, 45 or 50 nucleotides in length.
  • the antisense nucleic acids of this invention may, for example, form a stable duplex with its target sequence, or, in the case of an antisense nucleic acid molecule that binds to DNA duplexes, through specific interactions in the major groove of the double helix.
  • the antisense nucleic acid molecule of the invention is an ⁇ -anomeric nucleic acid molecule.
  • An ⁇ -anomeric nucleic acid molecule forms specific double-stranded hybrids with complementary RNA in which, contrary to the usual ⁇ -units, the strands run parallel to each other (Gaultier et al. Nucl. Acids Res 15: 6625-6641 (1987)).
  • An antisense target sequence is a nucleotide sequence specific to GP 132, and can be identified through use of any publicly available sequence database, and/or through use of commercially available sequence comparison programs.
  • Antisense nucleic acids of the invention can then be constructed using procedures known in the art.
  • an antisense nucleic acid e.g., an antisense oligonucleotide
  • an antisense nucleic acid can be produced biologically using an expression vector into which a nucleic acid has been inserted in an antisense orientation, i.e., RNA transcribed from the inserted nucleic acid will be of an antisense orientation to a target nucleic acid of interest.
  • the antisense nucleic acid can be chemically synthesized using naturally occurring nucleotides or variously modified nucleotides designed to increase the biological stability of the molecule or to increase the physical stability of the duplex formed between the antisense and sense nucleic acids.
  • phosphorothioate derivatives and acridine- substituted nucleotides can be used.
  • Phosphorothioate and methylphosphonate antisense oligonucleotides are contemplated for therapeutic use by the invention.
  • the antisense nucleic acid molecule can also comprise a 2'-O-methylribonucleotide (hioue et al., Nucl.
  • the antisense oligonucleotides may be further modified by adding poly-L-lysine, transferrin, polylysine, or cholesterol moieties at their 5' end.
  • the antisense nucleic acid molecules of the invention can be administered to a subject (e.g., a human) or generated in situ via an expression vector, such that they bind to cellular RNA and/or genomic DNA encoding a GP 132 protein to inhibit expression of the protein, e.g., by inhibiting transcription and/or translation. Suppression of GP 132 expression at either the transcriptional or translational level is useful to treat certain cancer conditions in patients or to generate cellular or animal models for cancer characterized by aberrant GP 132 expression.
  • an antisense molecule can be administered by direct injection at a tissue site of a subject.
  • an antisense molecule can be designed to target selected cells (e.g., cancer cells overexpressing GP132) and then administered systemically.
  • the antisense molecule may contain a peptide or antibody that specifically binds to a cell surface receptor or antigen expressed on the surface of the selected cell surface. See also discussions below on PNAs.
  • Antisense molecules may also be targeted by systemic administration, followed by tissue and/or tumor specific expression and/or activation.
  • the antisense nucleic acids can also be delivered to target cells using expression vectors encoding them.
  • the expression vectors may contain a strong pol ⁇ or pol III promoter to ensure that the antisense nucleic acids are expressed at sufficient intracellular concentrations.
  • an antisense nucleic acid of the invention is part of a GP132-specific ribozyme (or, as modified, a "nucleozyme”).
  • Ribozymes are catalytic RNA molecules with ribonuclease activity that are capable of cleaving a single-stranded nucleic acid, such as an mRNA, to which they have a complementary region.
  • ribozymes such as hammerhead, hairpin, and Group I intron ribozymes can cleave GP 132 mRNA transcripts catalytically, thereby inhibiting translation of GP 132 mRNA.
  • a ribozyme having specificity for a GP132-encoding nucleic acid can be designed based upon the nucleotide sequence of a GP132 polynucleotide described herein (e.g., SEQ ID NO: 2). See, e.g., U.S. Patent Nos. 5,116,742; 5,334,711; 5,652,094; and 6,204,027.
  • a derivative of a Tetrahymena L- 19 IVS RNA can be constructed in which the nucleotide sequence of the active site is complementary to the nucleotide sequence to be cleaved in a GP132-encoding mRNA. See, e.g., Cech et al. U.S.
  • GP132 mRNA can be used to select a catalytic RNA having a specific ribonuclease activity from a pool of RNA molecules. See, e.g., Bartel et al., Science 261:1411-1418 (1993).
  • the ribozynies and other antisense reagents of this invention may include appended groups such as peptides (e.g., for targeting host cell receptors in vivo); agents facilitating transport across the cell membrane (e.g., Letsinger et al., Proc. Natl. Acad. Sci.
  • GP 132 gene may be inhibited by targeting nucleotide sequences complementary to the regulatory region of the GP 132 gene (e.g., the GP 132 promoter and/or enhancers) to form triple helical structures that prevent transcription of the GP 132 gene in target cells.
  • nucleotide sequences complementary to the regulatory region of the GP 132 gene e.g., the GP 132 promoter and/or enhancers
  • PNA Peptide Nucleic Acids
  • PNA peptide nucleic acids
  • the phosphodiester backbone of the nucleic acid is replaced with an amide-containing backbone, in particular by repeating N-(2-aminoethyl) glycine units linked by amide bonds.
  • Nucleobases are bound directly or indirectly to aza-nitrogen atoms of the amide portion of the backbone, typically by methylene carbonyl linkages.
  • PNA oligomers can be synthesized using standard solid phase peptide synthesis protocols as described in Hyrup et al., supra; and Perry-O'Keefe et al., Proc. Natl. Acad. Sci. USA 93:14670-675 (1996).
  • PNAs of GP 132 can be used in therapeutic and diagnostic applications.
  • PNAs can be used as antisense or antigene agents for sequence-specific modulation of gene expression by, e.g., inducing transcription or translation arrest or inhibiting replication.
  • PNAs of GP132 can also be used, e.g., in the analysis of single base pair mutations in a gene by, e.g., PNA-directed PCR clamping; as artificial restriction enzymes when used in combination with other enzymes, e.g., Sl nucleases; or as probes or primers for DNA sequence and hybridization (Hyrup et al., supra; and Perry-O'Keefe, supra).
  • PNAs of GP132 are modified, e.g., to enhance their stability or cellular uptake, by attaching lipophilic or other helper groups to PNA, by the formation of PNA-DNA chimeras, or by the use of liposomes or other techniques of drug delivery known in the art.
  • PNA-DNA chimeras of GP 132 can be generated that may combine the advantageous properties of PNA and DNA.
  • Such chimeras allow DNA recognition enzymes, e.g., RNase H and DNA polymerases, to interact with the DNA portion while the PNA portion would provide high binding affinity and specificity.
  • PNA-DNA chimeras can be linked using linkers of appropriate lengths selected in terms of base stacking, number of bonds between the nucleobases, and orientation (Hyrup et al., supra).
  • the synthesis of PNA-DNA chimeras can be performed as described in Hyrup, supra and Finn et al., Nucl. Acids Res. 24:3357- 63 (1996).
  • RNAi RNA interference
  • dsRNA double-stranded RNA
  • the mediators of the degradation are 21- to 23 -nucleotide small interfering RNAs (siRNAs) generated by ribonuclease III cleavage from the longer dsRNAs.
  • siRNAs small interfering RNAs
  • Molecules of siRNA typically have 2- to 3-nucleotide 3' overhanging ends resembling the RNAse III processing products of long dsRNAs that normally initiate RNAi.
  • RNA-induced silencing complex When introduced into a cell, they assemble with an endonuclease complex (RNA-induced silencing complex), which then guides target mRNA cleavage resulting in reduced levels of the corresponding protein. Suppression of the corresponding protein product produces cells with specific phenotypes, including, e.g., reduced tumor size, metastasis, angiogenesis, and growth rates.
  • endonuclease complex RNA-induced silencing complex
  • siRNAs compared with traditional antisense molecules, prevents activation of the dsRNA-inducible interferon system present in mammalian cells. This helps avoid the nonspecific phenotypes normally produced by dsRNA larger than 30 base pairs in somatic cells.
  • SiRNA oligonucleotides can be designed with a number of software programs, e.g., the OligoEngine siRNA design tool available at http://www.oligoengine.com. Generally, siRNAs of this invention range from about 19 basepairs to about 29 basepairs in length for the double-stranded portion.
  • the siRNAs are hairpin RNAs having an about 19-29 bp stem and an about 4-34 nucleotide loop.
  • the siRNAs are highly specific for a GP 132 target region and may comprise any 19-29 bp fragment of a GP 132 niRNA that has at least 1 (e.g., at least 2 or 3) bp mismatch with a non-GP132- related sequence.
  • the preferred siRNAs do not bind to RNAs having more than 3 mismatches with the target region.
  • the target sequences of exemplary siRNAs for GP 132 are
  • the first two sequences correspond to nucleotides 72-89 and 102-120 of SEQ ID NO: 2, respectively, with short extensions.
  • SEQ ID NO: 3 has a three nucleotide extension (Ctt) and SEQ ID NO: 4 has a two nucleotide extension (tt).
  • the third sequence corresponds to non-coding sequences of the GP132 mRNA.
  • SiRNAs that target an RNA region having 10 or more nucleotide overlaps with an aforementioned exemplary target region are also useful.
  • Intracellular transcription of siRNAs can be achieved by cloning the siRNA templates into RNA polymerase III (Pol III) transcription units, which normally encode the small nuclear RNA U6 or the human RNAse P RNA Hl .
  • Poly III RNA polymerase III
  • Two approaches can be used for expressing siRNA: (1) sense and antisense strands constituting the siRNA duplex are transcribed by individual promoters; or (2) siRNAs are expressed as fold-back stem-loop structures that give rise to siRNAs after intracellular processing.
  • Inducible promoters can also be used to drive the expression of the siRNA.
  • pairs of oligonucleotides can be annealed to form double-stranded DNA and then ligated into an expression vector containing a U6 small RNA promoter. Expression of the insert will lead to expression of a shart hairbin and loop from the inserted templant. The hairpin structures will have inhibitory effects on GP 132 expression.
  • shRNAs short-hairpin RNAs
  • shRNA 1 the sense, loop, antisense and termination-EcoRI sequences are indicated in lowercase, all caps, lowercase, and all caps, respectively.
  • Other exemplary shRNA molecules are described in Example 4.
  • An interfering RNA molecule or its coding sequence can be delivered into a target cell via a variety of methods, including but not limited to, liposome fusion (transposomes), routine nucleic acid transfection methods such as electroporation, calcium phosphate precipitation, and microinjection, and infection by viral vectors.
  • liposome fusion transposomes
  • routine nucleic acid transfection methods such as electroporation, calcium phosphate precipitation, and microinjection
  • infection by viral vectors including but not limited to, liposome fusion (transposomes), routine nucleic acid transfection methods such as electroporation, calcium phosphate precipitation, and microinjection, and infection by viral vectors.
  • the above-described isolated nucleic acids can be used as hybridization probes to characterize GP132 nucleic acids in both genomic and transcript-derived nucleic acid samples.
  • the probes can be used to detect gross alterations in the GP 132 genomic locus, such as deletions, insertions, translocations, and duplications of the GP 132 genomic locus.
  • Methods of detection include fluorescence in situ hybridization (FISH) to chromosome spreads, comparative genomic hybridization (CGH), array CGH (e.g., on microarrays containing GP132-coding sequences or BAC comprising GP 132- coding sequences), and spectral karyotyping (SKY).
  • FISH fluorescence in situ hybridization
  • CGH comparative genomic hybridization
  • array CGH e.g., on microarrays containing GP132-coding sequences or BAC comprising GP 132- coding sequences
  • SKY spectral karyotyping
  • the probes can also be used to assess smaller genomic alterations using, e.g., Southern blot detection of restriction fragment length polymorphisms.
  • the nucleic acid probes can be also used to isolate genomic clones that include the nucleic acids, which thereafter can be restriction mapped and sequenced to identify deletions, insertions, amplifications, translocations, and substitutions (e.g., SNPs) at the sequence level.
  • the nucleic acid probes can also be used to isolate GP 132 nucleic acids from cDNA libraries, permitting sequence level characterization of GP 132 RNA messages, including identification of deletions, insertions, truncations, including, e.g., deletions, insertions, and truncations of exons in alternatively spliced forms, and single nucleotide polymorphisms.
  • Some of the nucleic acids can also be used as amplification primers for PCR (e.g., real time PCR) to detect the above- described genomic alterations.
  • PCR real time PCR
  • the nucleic acid probes can be used to measure the representation of GP 132 clones in a cDNA library, used as primers for quantitative real time PCR, or otherwise used to measure expression level of the GP132 gene. Measurement of GP 132 expression has particular utility in diagnostic assays for cancer-related conditions associated with abnormal GP 132 expression. Moreover, differences in the expression levels of the gene before and after a cancer event (e.g., cancer genesis, maintenance, regression, and metastasis) are useful in determining the effect of a candidate cancer drug, identifying cancer types, designing diagnostics and prognostics, and predicting likely outcome of a cancer therapy. 3. Genetic Alterations
  • the nucleic acids can also be used to introduce mutations (e.g., null mutations, dominant negative mutations, dominant acting mutations) into a GP 132 locus of an animal via homologous recombination.
  • mutations e.g., null mutations, dominant negative mutations, dominant acting mutations
  • Such animals e.g., knock out mice
  • homologous recombination can be used to replace the endogenous regulatory elements with heterologous regulatory elements, i.e., elements not natively associated with the gene in the same manner. This can alter the expression of GP 132, both for production of GP 132 protein, and for gene therapy. See, e.g., U.S. Pat. Nos. 5,981,214, 6,048,524; and 5,272,071. Fragments of the above-described polynucleotides smaller than those typically used for homologous recombination can also be used for targeted gene correction or alteration, possibly by cellular mechanisms different from those engaged during homologous recombination. See, e.g., U.S. Pat. Nos.
  • This invention relates to nucleic acid constructs containing one or more of the isolated nucleic acid molecules encoding all or part of GPl 32.
  • the vectors can be used to propagate the new nucleic acid molecules in host cells, to shuttle the molecules between host cells derived from disparate organisms, to insert the molecules into host genomes, to express sense or antisense RNA transcripts or interfering RNAs, and/or to express GP 132 polypeptides.
  • the vectors are derived from virus, plasmid, prokaryotic or eukaryotic chromosomal elements, or some combination thereof, and may optionally include at least one origin of replication, at least one site for insertion of heterologous nucleic acid, and at least one selectable marker.
  • This invention relates to transformed host cells, which can be prokaryotic (bacteria) or eukaryotic (e.g., yeast, insect, plant and animal cells).
  • a host cell strain may be chosen for its ability to carry out desired post-translational modifications of the expressed protein.
  • post-translational modifications of the polypeptide include, but are not limited to, acetylation, carboxylation, glycosylation, phosphorylation, hydroxylation, sulfation, lipidation, and acylation. Some embodiments of the invention may involve GP 132 proteins with such post- translational modifications.
  • Exemplary prokaryotic host cells are E. coli, Caulobacter crescentus, Streptomyces species, and Salmonella typhimurium cells. Any suitable vector may be used, e.g., those related to pBR322 and the pUC plasmids.
  • Exemplary yeast host cells are Saccharomyces cerevisiae,
  • Any suitable vector may be used, e.g., integrative YIp vectors, replicating episomal YEp vectors containing centromere sequences CEN and autonomously replicating sequences ARS.
  • Insect cells may be advantageous, e.g., for high efficiency protein expression.
  • Exemplary insect host cells are those from Spodoptera frugiperda (e.g., Sf9 and Sf21 cell lines, and EXPRESSFTM cells (Protein Sciences Corp., Meriden, CT, USA)), Drosophila S2 cells, and Trichoplusia ni HIGH FIVE® Cells (Invitrogen, Carlsbad, CA, USA). Where the host cells are Spodoptera frugiperda cells, the vector replicative strategy is typically based upon the baculovirus life cycle.
  • Spodoptera frugiperda e.g., Sf9 and Sf21 cell lines, and EXPRESSFTM cells (Protein Sciences Corp., Meriden, CT, USA)
  • Drosophila S2 cells Drosophila S2 cells
  • Trichoplusia ni HIGH FIVE® Cells Invitrogen, Carlsbad, CA, USA.
  • the vector replicative strategy is typically based upon the baculovirus life cycle.
  • Exemplary mammalian host cells are COSl and COS7 cells, NSO cells, Chinese hamster ovary (CHO) cells, NIH 3T3 cells, 293 cells, HEPG2 cells, HeLa cells, L cells, MDCK, HEK293, WI38, murine ES cell lines (e.g., from strains 129/SV, C57/BL6, DBA-1, 129/SVJ), K562, Jurkat cells, BW5147 and any other commercially available human cancer cell lines.
  • Cells with K-ras such as human colon cancer cell lines DLD-I and HCT-116, and revertants thereof having a null mutation in the activated K-ras gene, can also be used.
  • mammalian host cells also include those in the body of a subject (e.g., a human patient or other mammal).
  • Vectors for autonomous extrachromosomal replication in mammalian cells typically include a viral origin, such as the SV40 origin (for replication in cell lines expressing the large T-antigen, such as COSl and C0S7 cells), the papillomavirus origin, or the EBV origin for long term episomal replication (for use in, e.g., 293-EBNA cells, which constitutively express the EBV EBNA-I gene product and adenovirus ElA).
  • Vectors intended for integration, and thus replication as part of the mammalian chromosome can, but need not, include an origin of replication functional in mammalian cells, such as the SV40 origin.
  • Useful vectors also include vectors based on viruses such as lentiviruses, adenovirus, adeno-associated virus, vaccinia virus, parvoviruses, herpesviruses, poxviruses, Semliki Forest viruses, and retroviruses.
  • Plant cells can also be used for expression, with the vector replicon typically derived from a plant virus (e.g., cauliflower mosaic virus (CaMV); tobacco mosaic virus (TMV)) and selectable markers chosen for suitability in plants.
  • a plant virus e.g., cauliflower mosaic virus (CaMV); tobacco mosaic virus (TMV)
  • the invention relates to artificial chromosomes, e.g., bacterial artificial chromosomes (BACs), yeast artificial chromosomes (YACs), mammalian artificial chromosomes (MACs), and human artificial chromosomes (HACs), that contain the GP132 nucleic acid of interest.
  • BACs bacterial artificial chromosomes
  • YACs yeast artificial chromosomes
  • MACs mammalian artificial chromosomes
  • HACs human artificial chromosomes
  • Vectors will also often include elements that permit in vitro transcription of RNA from the inserted heterologous nucleic acid.
  • Such vectors typically include a phage promoter, such as that from T7, T3, or SP6, flanking the nucleic acid insert. Often two different such promoters flank the inserted nucleic acid, permitting separate in vitro production of both sense and antisense strands.
  • Expression vectors often include a variety of other genetic elements operatively linked to the protein-encoding heterologous nucleic acid insert, typically genetic elements that drive and regulate transcription, such as promoters and enhancer elements, those that facilitate RNA processing, such as transcription termination, splicing signals and/or polyadenylation signals, and those that facilitate translation, such as ribosomal consensus sequences.
  • Other transcription control sequences include, e.g., operators, silencers, and the like.
  • Use of such expression control elements including those that confer constitutive or inducible expression, and developmental or tissue-regulated expression are well-known in the art.
  • Constitutively active promoters include, without limitation, a CMV promoter, EF l ⁇ , retroviral LTRs, and SV40 early region.
  • Inducible promoters useful in this invention include, without limitation, a tetracycline-inducible promoter, a metallothionine promoter, the IPTG/lacI promoter system, the ecdysone promoter system, and the "lox stop lox" system for irreversibly deleting inhibitory sequences for translation or transcription.
  • a GP 132 gene is placed between lox sites, and upon expression of the ere enzyme, the GP 132 gene is deleted from the genome so that the GP 132 activity is permanently eliminated.
  • a GP 132 protein can also be inducibly switched on or off by fusing the GP132 protein to, e.g., an estrogen receptor polypeptide sequence, where administration of estrogen or an estrogen analog (e.g., hydroxytamoxifen) will allow the correct folding of the GP 132 polypeptide into a functional protein.
  • an estrogen receptor polypeptide sequence e.g., an estrogen receptor polypeptide sequence
  • an estrogen analog e.g., hydroxytamoxifen
  • Tissue-specific promoters that can be used in driving expression of GP 132 in animal models include, without limitation: a tyrosinase promoter or a TRP2 promoter in the case of melanoma cells and melanocytes; an MMTV or WAP promoter in the case of breast cells and/or cancers; a Villin or FABP promoter in the case of intestinal cells and/or cancers; a RIP promoter in the case of pancreatic beta cells; a Keratin promoter in the case of keratinocytes; a Probasin promoter in the case of prostatic epithelium; a Nestin or GFAP promoter in the case of CNS cells and/or cancers; a Tyrosine Hydroxylase, SlOO promoter or neurofilament promoter in the case of neurons; the pancreas-specific promoter described in Edlund et al. Science 230:912-916 (1985); a Clara cell secretory protein promoter in the case of lung
  • promoters may also be selected. They include, without limitation, the murine hox promoters (Kessel and Grass, Science 249:374-379 (1990)) and the ⁇ -fetoprotein promoter (Campes and Tilghman, Genes Dev. 3:537-546 (1989)).
  • Expression vectors can be designed to fuse the expressed polypeptide to small protein tags that facilitate purification and/or visualization. Many such tags are known and available. Expression vectors can also be designed to fuse proteins encoded by the heterologous nucleic acid insert to polypeptides larger than purification and/or identification tags. Useful protein fusions include those that permit display of the encoded protein on the surface of a phage or cell, fusions to intrinsically fluorescent proteins, such as luciferase or those that have a green fluorescent protein (GFP)-like chromophore, and fusions for use in two hybrid selection systems.
  • GFP green fluorescent protein
  • vectors For secretion of expressed proteins, a wide variety of vectors are available which include appropriate sequences that encode secretion signals, such as leader peptides.
  • Vectors designed for phage display, yeast display, and mammalian display for example, target recombinant proteins using an N-terminal cell surface targeting signal and a C-terminal transmembrane anchoring domain.
  • the invention relates to fragments of an isolated GP132 polypeptide (SEQ ID NO: 1 or a degenerate variant), optionally having one or more conservative amino acid substitutions, particularly fragments having at least 5, 6, 8, or 15 amino acids of SEQ ID NO:1. Larger fragments of at least 20, 25, 30, 35, 50, 75, 100, 150 or more amino acids are also useful, and at times, preferred.
  • the GP132 fragments maybe continuous portions of the native GP132 protein.
  • knowledge of the GP 132 gene and protein sequences permits recombining of various domains that are not contiguous in the native GP132 protein.
  • the invention relates to a GP132 polypeptide in which one or more of the domains is modified or absent. Table 1 lists certain GP132 domains and other regions, according to amino acid residue number, based on SEQ ID NO: 1.
  • This invention also relates to fusions of GP 132 polypeptides to heterologous polypeptides.
  • Fusion means that the GP 132 polypeptide is linearly contiguous to the heterologous polypeptide in a peptide-bonded polymer of amino acids or amino acid analogues.
  • the heterologous polypeptide maybe located at its N- and/or C-terminus, or within the GP132 polypeptide, or any suitable combination thereof.
  • heterologous polypeptide is here intended a polypeptide that does not naturally occur in contiguity with the GP 132 fusion partner.
  • the fusion can consist entirely of a plurality of fragments of the GP 132 protein in altered arrangement; in such a case, any of the GP132 fragments can be considered heterologous to the other GP 132 fragments in the fusion protein.
  • the heterologous polypeptide included within the fusion protein is at least 6 amino acids in length, often at least 8 amino acids in length, and preferably, at least 15, 20, and 25 amino acids in length.
  • the heterologous sequences can target the GP 132 polypeptide to a selected cell by binding to a cell surface receptor, prolong the serum life of the GP132 polypeptide (e.g., an IgG Fc region), make the GP132 polypeptide detectable (e.g., a luciferase or a green fluorescent protein), facilitate purification (e.g., His tag, FLAG, etc.), facilitate secretion of recombinantly expressed proteins (e.g., into the periplasmic space or extracellular milieu for prokaryotic hosts, into the culture medium for eukaryotic cells, through incorporation of secretion signals and/or leader sequences).
  • a cell surface receptor e.g., an IgG Fc region
  • make the GP132 polypeptide detectable e.g., a luciferase or a green fluorescent protein
  • facilitate purification e.g., His tag, FLAG, etc.
  • secretion signals and/or leader sequences e
  • proteins and protein fragments can also usefully be fused to protein toxins, such as Pseudomonas exotoxin A, diphtheria toxin, shiga toxin A, anthrax toxin lethal factor, ricin, or other biologically deleterious moieties in order to effect specific ablation of cells that bind or take up the proteins.
  • protein toxins such as Pseudomonas exotoxin A, diphtheria toxin, shiga toxin A, anthrax toxin lethal factor, ricin, or other biologically deleterious moieties in order to effect specific ablation of cells that bind or take up the proteins.
  • polypeptides can be composed of natural amino acids linked by native peptide bonds, or can contain any or all of nonnatural amino acid analogues, normative bonds, and post-synthetic (post-translational) modifications, either throughout the length of the polypeptide or localized to one or more portions thereof.
  • non-natural amino acid analogues such as glutamate, glutamate, glutamate, glutamate, glutamate, glut
  • D-enantiomers of natural amino acids can readily be incorporated during chemical peptide synthesis: peptides assembled from D-amino acids are more resistant to proteolytic attack; incorporation of D-enantiomers can also be used to confer specific three dimensional conformations on the peptide.
  • amino acid analogues commonly added during chemical synthesis include ornithine, norleucine, phosphorylated amino acids (typically phosphoserine, phosphothreonine, phosphotyrosine), L-malonyltyrosine, a non-hydrolyzable analog of phosphotyrosine (KoIe et al, Biochem. Biophys. Res. Com. 209:817-821 (1995)), and various halogenated phenylalanine derivatives.
  • the isolated GP 132 polypeptides can also include non-native inter- residue bonds, including bonds that lead to circular and branched forms.
  • the isolated GP 132 polypeptides can also include post-translational and post-synthetic modifications, either throughout the length of the protein or localized to one or more portions thereof.
  • the isolated polypeptide when produced by recombinant expression in eukaryotic cells, can include N-linked and/or O-linked glycosylation, the pattern of which will reflect both the availability of glycosylation sites on the protein sequence and the identity of the host cell. Further modification of glycosylation pattern can be performed enzymatically.
  • recombinant polypeptides may also include an initial modified methionine residue, in some cases resulting from host-mediated processes.
  • Amino acid analogues having detectable labels are also usefully incorporated during synthesis to provide a labeled polypeptide (e.g., biotin, various chromophores, or fluorophores).
  • the GP 132 polypeptides can also usefully be conjugated to polyethylene glycol (PEG). PEGylation increases the serum half life of proteins administered intravenously for replacement therapy.
  • Production of isolated polypeptides can optionally be followed by purification from the producing cells.
  • Producing cells include, without limitation, recombinant cells overexpressing the polypeptides, naturally occurring cells (e.g., cancer cells) overexpressing the polypeptides, or established cancer cell lines overexpressing the polypeptides.
  • purification tags have been fused through use of an expression vector that appends such tags, purification can be effected, at least in part, by means appropriate to the tags, such as use of immobilized metal affinity chromatography for polyhistidine tags.
  • Other techniques common in the art include ammonium sulfate fractionation, immunoprecipitation, fast protein liquid chromatography (FPLC), high performance liquid chromatography (HPLC), and preparative gel electrophoresis. Purification of chemically synthesized peptides can readily be effected, e.g., by HPLC.
  • the isolated GP 132 proteins may be in pure or substantially pure form.
  • a purified protein is an isolated protein, as above described, that is present at a concentration of at least 95%, as measured on a mass basis (w/w) with respect to total protein in a composition. Such purities can often be obtained during chemical synthesis without further purification, as, e.g., by HPLC.
  • Purified proteins can be present at a concentration (measured on a mass basis with respect to total protein in a composition) of 96%, 97%, 98%, and even 99%. The proteins can even be present at levels of 99.5%, 99.6%, and even 99.7%, 99.8%, or even 99.9% following purification, as by HPLC.
  • the isolated proteins are also useful at lower purity.
  • partially purified proteins can be used as immunogens to raise antibodies in laboratory animals.
  • the isolated proteins are generally used in substantially purified form.
  • a "substantially purified protein” is an isolated protein, as above described, present at a concentration of at least 70%, measured on a mass basis with respect to total protein in a composition.
  • the substantially purified protein is present at a concentration, measured on a mass basis with respect to total protein in a composition, of at least 75%, 80%, or even at least 85%, 90%, 91%, 92%, 93%, 94%, 94.5% or even at least 94.9%.
  • the purified and substantially purified proteins are in compositions that lack detectable ampholytes, acrylamide monomers, bis-acrylamide monomers, and polyacrylamide.
  • Certain fragments of at least 8, 9, 10 or 12 contiguous amino acids are also useful as competitive inhibitors of binding of the entire protein, or a portion thereof, to its ligand. Thus, such fragments can be used as anti-cancer agents to reduce the activity of GP132.
  • Fragments of at least six contiguous amino acids are useful in
  • Fragments of at least eight contiguous amino acids, often at least fifteen contiguous amino acids, have utility as immunogens for raising antibodies 15 that recognize GP 132 proteins or as vaccines for GP132-mediated diseases such as cancers.
  • the GP 132 proteins, fragments, and fusions also can usefully be attached to a substrate (supra). So bound, the new polypeptides can be used to detect, purify and quantify antibodies, e.g., in serum, that bind specifically to the 20 immobilized protein.
  • the invention relates to antibodies that bind specifically to the new GP 132 polypeptides.
  • the antibodies can be specific for linear epitopes, ⁇ 25 discontinuous epitopes, or conformational epitopes of such polypeptides, either as present on the polypeptide in its native conformation or, in some cases, as present on the polypeptides as denatured, as, e.g., by solubilization in SDS.
  • the antibodies, both polyclonal and monoclonal bind specifically to a polypeptide having an amino acid sequence presented in SEQ ID NO:1.
  • an "antibody” refers to a full antibody, e.g., an antibody comprising two heavy chains and two light chains, or to an antigen- binding fragment of a full antibody.
  • Such fragments include, but are not limited to, those produced by digestion with various proteases, those produced by chemical cleavage and/or chemical dissociation, and those produced recombinantly, so long as the fragment remains capable of specific binding to an antigen.
  • fragments are Fab, Fab', F(ab') 2 and single chain Fv (scFv) fragments.
  • An antibody can be a murine or hamster antibody or a homolog thereof, or a fully human antibody.
  • An antibody can also be a humanized antibody, a chimeric antibody, an antibody fusion, an diabody, an intrabody, or a single-chained antibody.
  • An antibody can be of any isotype and subtype, for example, IgA (e.g., IgAl and IgA2), IgG (e.g., IgGl, IgG2, IgG3 and IgG4), IgE, IgD, IgM, wherein the light chains of the immunoglobulin may be of type kappa or lambda. While the useful antibodies are generally monoclonal, polyclonal antibodies from mice, rabbits, turkeys, or sheep may also be used.
  • the affinity or avidity of an antibody (or antibody multimer, as in the case of an IgM pentamer) used in the present invention will be at least about 1 x 10 "6 molar (M), typically at least about 5 x 10 "7 M, usefully at least about 1 x 10 "7 M, with affinities and avidities of at least 1 x 10 ⁇ 8 M, 5 x 10 "9 M, and 1 x 10 "10 M proving especially useful.
  • the antibodies are useful in a variety of in vitro immunoassays, such as Western blotting and ELISA, in isolating and purifying GP 132 proteins (e.g., by immunoprecipitation, immunoaffmity chromatography, or magnetic bead- mediated purification).
  • the antibodies are also useful as modulators (i.e., antagonists or agonists) of a GP 132 protein in vivo to modulate the protein's interaction with its natural ligand.
  • the antibodies can also be used to conjugate to cytotoxic reagents for site-specific delivery.
  • the antibodies can be variously associated with moieties appropriate for their uses.
  • the moieties can be an enzyme that catalyzes production and local deposition of a detectable product.
  • Exemplary enzymes are alkaline phosphatase, ⁇ -galactosidase, glucose oxidase, horseradish peroxidase (HRP), and urease.
  • the antibodies can also be labeled using colloidal gold. When the antibodies are used, e.g., for flow cytometric detection and scanning laser cytometric detection, they can be labeled with fluorophores.
  • the antibodies can usefully be labeled with biotin.
  • biotin When the antibodies are used, e.g., for Western blotting, they can usefully be labeled with radioisotopes.
  • radioisotopes When the antibodies are to be used for in vivo diagnoses, they can be rendered detectable by conjugation to MRI contrast agents, such as radioisotopic labeling or gadolinium diethylenetriaminepentaacetic acid (DTPA).
  • DTPA gadolinium diethylenetriaminepentaacetic acid
  • the antibodies can also be conjugated to biologically deleterious agents so as to direct the agents to a tumor site.
  • the antibody can be conjugated to Pseudomonas exotoxin A, diphtheria toxin, shiga toxin A, anthrax toxin lethal factor, or ricin. See, e.g., Hall (ed.), Immunotoxin Methods and Protocols (Methods in Molecular Biology, VoI 166), Humana Press (2000) (ISBN:0896037754); and Frankel et al. (eds.), Clinical Applications of Immunotoxins, Springer- Verlag New York, Incorporated (1998) (ISBN:3540640975). Small molecule toxins such as calicheamycin or chemotherapeutic agents can also be delivered via chemical conjugation to the antibodies.
  • the antibodies may also be used to deliver DNA to the tumor site as gene therapy to inhibit or otherwise modify the behavior of the tumor (e.g., to deliver an antisense reagent to the GP 132 oncogene).
  • the antibodies can be bound to a substrate via a linker moiety.
  • the antibodies can usefully be conjugated to filtration media, such as NHS-activated Sepharose or CNBr-activated Sepharose for immunoaffinity chromatography.
  • the antibodies can also be attached to paramagnetic microspheres, by, e.g., biotin-streptavidin interaction, which microsphere can then be used for isolation of cells that express or display the above-described proteins.
  • the antibodies can also be attached to the surface of a microtiter plate, either directly or via a secondary antibody, for ELISA.
  • GP 132 is a suitable therapeutic target for treating neoplasia, hyperplasia, malignant cancers, or any other hyperproliferative conditions.
  • the GP132 gene can be a target in cancers of the skin (e.g., melanoma), lung, prostate, breast, colorectal, liver, pancreatic, brain, testicular, ovarian, uterine, cervical, kidney, thyroid, bladder, esophageal, and hematological tissues.
  • the invention accordingly relates to pharmaceutical compositions comprising the above-described nucleic acids, proteins, and antibodies, as well as mimetics, agonists, antagonists, or modulators of GP 132 activity, and methods of using them to prevent or treat (i.e., ameliorate, mitigate, alleviate, slow, or inhibit) tumor growth, angiogenesis, metastasis or otherwise inappropriate cell proliferation or to induce these conditions, e.g., in an experimental animal.
  • Inhibitors of GP 132 can also be used in combination with a second or additional therapeutic agents for improved cancer treatment.
  • Such second or additional therapeutic agents may include an anti-angiogenic agent, an anti- metastatic agent, an agent that induces hypoxia or is used to create a hypoxic environment, agent that induces apoptosis, or an agent that inhibits cell survival signals, hi some embodiments, inhibitors of GP132 can be used in conjunction with other chemotherapeutic agents including, but not limited to, folate antagonists, pyrimidine and purine antimetabolites, alkylating agents, platinum antitumor compounds, DNA interchelators, other agents that induce DNA damage, microtubule targeting products, small molecule inhibitors of protein kinases and biological inhibitors of growth factor receptors.
  • the GP 132 inhibitor and additional therapeutic agent(s) may be used concurrently or sequentially.
  • the subject is pre-treated with one or more agents, followed by treatment with a GP 132 inhibitor.
  • angiogenesis inhibitors e.g. angiostatin, endostatin, avastin or Regeneron's VEGF trap technology
  • GP 132 inhibitors can be used in combination with GP 132 inhibitors as an effective anti-cancer therapy.
  • Such a combination can be expected to have a synergistic effect. This may also allow the use of a lower dose of GP 132 inhibitor or anti-angiogenic agent or both in chemotherapy, which is desirable because it is likely to cause less toxicity in patients. In addition, the use of combinations of therapeutic agents may circumvent drug resistance problems .
  • GP 132 inhibitors can also be used in combination with agents that create a hypoxic environment to enhance the effect of GP 132 inhibitor.
  • Hypoxia i.e., lack of oxygen
  • mammalian cells activate and express multiple genes. Tumor cells may respond to hypoxia by diminishing their proliferative rates leaving the cells viable but nonproliferating. Some transformed cell lines can also undergo apoptosis in extreme hypoxia and an acidic environment. Similar to inhibitors of angiogenesis, other agents that induce a hypoxic environment may sensitize tumor cells to inhibition of GP132 and use of hypoxia inducing agents in combination with inhibiting GP 132 is therefore another promising therapeutic strategy.
  • TRAIL Tumor necrosis factor-related apoptosis-inducing ligand
  • Survival signals that has recently been shown to modulate apoptotic signaling include the focal adhesion kinase (FAK), the phosphatidylinositol 3 ' kinase (PI3 'K), and protein kinase B (PKB, also known as Akt).
  • FAK focal adhesion kinase
  • PI3 'K phosphatidylinositol 3 ' kinase
  • PBB protein kinase B
  • the above-described compositions typically contain from about 0.1 to 90% by weight (such as 1 to 20% or 1 to 10%) of a therapeutic agent in a pharmaceutically acceptable carrier.
  • Solid formulations of the compositions for oral administration can contain suitable carriers or excipients, such as corn starch, gelatin, lactose, acacia, sucrose, microcrystalline cellulose, kaolin, mannitol, dicalcium phosphate, calcium carbonate, sodium chloride, or alginic acid.
  • Disintegrators that can be used include, without limitation, microcrystalline cellulose, corn starch, sodium starch glycolate, and alginic acid.
  • Tablet binders that can be used include acacia, methylcellulose, sodium carboxymethylcellulose, polyvinylpyrrolidone (PovidoneTM), hydroxypropyl methylcellulose, sucrose, starch, and ethylcellulose.
  • Lubricants that can be used include magnesium stearates, stearic acid, silicone fluid, talc, waxes, oils, and colloidal silica.
  • Liquid formulations of the compositions for oral administration prepared in water or other aqueous vehicles can contain various suspending agents such as methylcellulose, alginates, tragacanth, pectin, kelgin, carrageenan, acacia, polyvinylpyrrolidone, and polyvinyl alcohol.
  • the liquid formulations can also include solutions, emulsions, syrups and elixirs containing, together with the active compound(s), wetting agents, sweeteners, and coloring and flavoring agents.
  • Various liquid and powder formulations can be prepared by conventional methods for inhalation into the lungs of the mammal to be treated.
  • Injectable formulations of the compositions can contain various carriers such as vegetable oils, dimethylacetamide, dimethylformamide, ethyl lactate, ethyl carbonate, isopropyl myristate, ethanol, polyols (glycerol, propylene glycol, liquid polyethylene glycol, and the like).
  • Physiologically acceptable excipients can include, for example, 5% dextrose, 0.9% saline, Ringer's solution or other suitable excipients.
  • Intramuscular preparations e.g., a sterile formulation of a suitable soluble salt form of the compounds, can be dissolved and administered in a pharmaceutical excipient such as Water-for-Injection, 0.9% saline, or 5% glucose solution.
  • a suitable insoluble form of the compound can be prepared and administered as a suspension in an aqueous base or a pharmaceutically acceptable oil base, such as an ester of a long chain fatty acid (e.g., ethyl oleate).
  • a topical semi-solid ointment formulation typically contains a concentration of the active ingredient from about 1 to 20%, e.g., 5 to 10%, in a carrier such as a pharmaceutical cream base.
  • Various formulations for topical use include drops, tinctures, lotions, creams, solutions, and ointments containing the active ingredient and various supports and vehicles.
  • the optimal percentage of the therapeutic agent in each pharmaceutical formulation varies according to the formulation itself and the therapeutic effect desired in the specific pathologies and correlated therapeutic regimens.
  • the pharmaceutical formulation typically will be administered by applying to the skin of the patient a transdermal patch containing the pharmaceutical formulation, and leaving the patch in contact with the patient's skin (generally for 1 to 5 hours per patch).
  • Other transdermal routes of administration e.g., through use of a topically applied cream, ointment, or the like
  • the pharmaceutical formulation(s) can also be administered via other conventional routes (e.g., parenteral, subcutaneous, intrapulmonary, transmucosal, intraperitoneal, intrauterine, sublingual, intrathecal, or intramuscular routes) by using standard methods.
  • the pharmaceutical formulations can be administered to the patient via injectable depot routes of administration such as by using 1-, 3-, or 6- month depot injectable or biodegradable materials and methods.
  • the therapeutic protein or antibody agent typically is administered at a daily dosage of 0.01 mg to 30 mg/kg of body weight of the patient (e.g., lmg/kg to 5 mg/kg).
  • the pharmaceutical formulation can be administered in multiple doses per day, if desired, to achieve the total desired daily dose.
  • the effectiveness of the method of treatment can be assessed by monitoring the patient for known signs or symptoms of a disorder.
  • compositions may be included in a container, package or dispenser alone or as part of a kit with labels and instructions for administration. These compositions can also be used in combination with other cancer therapies involving, e.g., radiation, photosensitizing compounds, anti ⁇ neoplastic agents and immunotoxics.
  • This invention provides genetically modified non-human mammals at least some of whose somatic and germ cells contain one of the above-described GP132-coding nucleic acids (including both heterozygotes and homozygotes). Such mammals can be used to study the effect of the GP132 gene on tumorigenicity and tumor development, to study the role of GP 132 on normal tissue development and differentiation, to identify via array CGH regions of the genome whose amplification and deletion is correlated with GP 132 status, and to screen for and establish toxicity profiles of anti-cancer drugs.
  • This invention also provides genetically modified non-human mammals with targeted disruption of one or both copies of the endogenous GP 132 gene. Animal models according to the invention can be conventional germline transgenic animals or chimeric animals.
  • this invention provides an inducible cancer model to study tumor biology and to screen for anti-cancer drugs.
  • a genetically modified non-human mammal such as a transgenic or chimeric animal has a genome comprising: (a) an expression construct comprising a GP 132 gene linked operably to an inducible or constitutive promoter, and (b) a genetic mutation that causes said genetically modified non-human mammal to have greater susceptibility to cancer than an animal not comprising said genetic mutation, wherein expression of said GP 132 gene leads to formation of cancer in said genetically modified non-human mammal, and wherein said cancer regresses in said genetically modified non-human mammal when expression of said GP 132 gene is reduced.
  • Mutations that render the animal more susceptible to cancer include disabling mutations in a tumor suppressor gene (e.g., INK4a), disabling mutations in a DNA repair gene (e.g., MSH2), and activating mutations in an oncogene (e.g., myc and ras).
  • a tumor suppressor gene e.g., INK4a
  • a DNA repair gene e.g., MSH2
  • activating mutations in an oncogene e.g., myc and ras.
  • an oncogene e.g., myc and ras.
  • the animal's genome comprises (i) a first expression construct containing a gene encoding a reverse tetracycline transactivator operably linked to a promoter, such as any tissue or cell type-specific promoter or any general promoter, and (ii) a second expression construct containing the GPl 32 gene operably linked to a promoter that is regulated by the reverse tetracycline transactivator and tetracycline (or a tetracycline analogue, for example, doxycycline).
  • a promoter such as any tissue or cell type-specific promoter or any general promoter
  • a second expression construct containing the GPl 32 gene operably linked to a promoter that is regulated by the reverse tetracycline transactivator and tetracycline (or a tetracycline analogue, for example, doxycycline).
  • the animal can then be observed in the presence and absence of the tetracycline (or analog thereof) for the development, maintenance, or progression of a tumor that is affected by the presence or absence of the tetracycline (or analog thereof).
  • This animal model can be used to determine the efficacy of a candidate compound in preventing or treating cancer. This method involves administering to the animal a candidate compound and observing the effect of the compound on tumor development, maintenance, angiogenesis and/or progression in the animal. Regression and/or reduction of tumor size in the presence of the compound is indicative of the effectiveness of the compound.
  • the effect of a candidate compound on the level of GP 132 mRNA, protein, or activity in the animal or cell lines derived thereof (or cell lines transfected with the gene) can be used to identify the candidate as an agonist or antagonist.
  • the ability to compare the effect of a test compound to that of genetically switching off the inducible oncogene in this system allows the identification of surrogate markers that are predictive of the clinical response to the compound.
  • the inducible model can be used to determine whether a compound can eradicate minimal residual tumor. Normally in the inducible model, a tumor regresses when the GP132 gene is switched from "on" to "off via the inducible promoter.
  • the animal model can also be used to identify other cancer-related elements.
  • a detailed expression profile of gene expression in tumors undergoing regression or regrowth due to the inactivation or activation of the GP 132 transgene is established.
  • Techniques used to establish the profile include the use of suppression subtraction (in cell culture), differential display, proteomic analysis, serial analysis of gene expression (SAGE), and expression/transcription profiling using cDNA and/or oligonucleotide microarrays. Then, comparisons of expression profiles at different stages of cancer development can be performed to identify genes whose expression patterns are altered.
  • This animal model can also be used to identify molecular surrogates of GP 132 in another manner. To do this, the expression of GP132 gene is eliminated by null mutation, and another round of MaSS screening is performed using retroviral integration, cDNA complementation, or the genetic suppressor elements (GSE) method. Genes whose activation results in transformation of the cells are likely to be in a tumorigenic pathway related to GP132.
  • the animal model can also be used to identify surrogate biomarkers for diagnosis or for following disease progression in patients. The biomarkers can be identified based on the differences between the expression profiles of the "on" and "off states in the animal model.
  • Blood or urine samples from the animal can be tested with ELISAs or other assays to determine which biomarkers are released from the tumor into circulation during tumor genesis, maintenance, or regression (when GP132 is turned off). These biomarkers are particularly useful clinically in following disease progression post anti-GP132 therapy.
  • GP 132 activity is up-regulated in tumor cells
  • nucleic acid probes or antibodies are used to quantify the expression level of GP132 in a tissue sample, wherein an increase in that level relative to control is indicative of cancerous, neoplastic, or hyperplastic pathology of the tissue sample.
  • Routine techniques include RT-PCR, ribonuclease protection assays, in situ hybridization, Northern blot analysis, FISH, CGH, array CGH, SKY, and immunohistochemistry.
  • a GP132 protein or fragments thereof may be found to be elevated in a tissue sample (e.g., blood or urine) of cancer patients relative to that of normal individuals. This elevation can be detected by, e.g., specific ELISAs, radioimmunoassays, or protein chip assays. Such tests may not only be useful for diagnosis of GP132-related diseases such as cancers, but also for monitoring the progress of therapy using GP132 inhibitors.
  • Example 1 MaSS Screening Identification of the Gene This example describes the procedures for identifying the GP 132 gene by MaSS screening. a. Retroviral Infection of Tumor Cells
  • Mo-MuLV producer cell line TMJ (NIH3T3 based cell line) was plated to the required number of plates (100 mm). These cells were cultured and maintained in RPMI media with 10% FBS. For viral production, TMJ cells were fed with 4-5 ml of fresh culture media, and culture supernatant was harvested 8-12 hours later. The supernatant was filtered through a 0.45 ⁇ M filter.
  • doxycycline-dependent, RAS-induced melanoma cells such as R545 cells were maintained in RPMI media with 10% fetal calf serum in the presence of doxycycline (2 /ig/ml). At approximately 18-24 hrs after plating or when the plates were 70-80% confluent, the R545 cells were infected with the filtered viral supernatant in the presence of polybrene (6-8 ⁇ g/ml). From this point on, the R545 cells were maintained in the absence of doxycycline.
  • infected R545 cells Eighteen hours after infection, infected R545 cells were trypsinized, rinsed and resuspended in Hanks' Balanced Salt Solution. Cell suspensions were kept on ice and the handling time after trypsinization was kept to a minimum. About I X lO 6 cells were injected onto the flank of SCID mice fed with water without doxycycline. The animals were observed for tumor development. Control animals were similarly injected with I X lO 6 uninfected R545 cells. Tumors typically developed after approximately 21 days. Tumors were harvested and tumor tissues were immediately snap-frozen in liquid nitrogen. b. Inverted Polymerase Chain Reaction
  • DNA was isolated from tumor tissues using the PUREGENE DNA isolation kit. 10 ⁇ g of genomic DNA was digested to completion with either BamHI or SacII and the reaction was terminated by incubation at 65 0 C for 20 minutes. The digested samples were self-ligated in a diluted 600 ⁇ l reaction volume using 4000 U of high concentration T4 Ligase (NEB, Cat. # M0202M). The ligation was performed overnight to 24 hrs at 16 0 C. The ligated DNA was precipitated with ethanol and dissolved in 40 ⁇ l of sterile water. The ligated DNA was then serially diluted to 1:10 and 1:100 ratios and subj ected to inverted polymerase chain reaction (IPCR).
  • IPCR inverted polymerase chain reaction
  • the PCR reaction mix had a total volume of 50 ⁇ l and contained l ⁇ l of the ligated DNA, 25 nmol of each dNTP, 10 pmol each of the forward and reverse primers, 1 X Buffer 2, and 2.5 U of Enzyme Mix in the EXPAND Long Template PCR System (Roche).
  • Amplification was performed as follows: 92 0 C for 2 min, then 10 cycles of (92 0 C for 10 sec, 63° for 30 sec, 68 0 C for 15 min), then 20 cycles of (92 0 C for 10 sec, 63 0 C for 30 sec, 68 0 C for 15 min, and a 20 sec auto extension), and a final extension step at 68 0 C for 30 min (TETRAD Thermocycler, MJ Research).
  • the primer sets used in IPCR (all of them targeting the retroviral LTRs were:
  • S5'1F GAGGCCACCTCCACTTCTGAGAT (SEQ ID NO: 7); S5'1R: CTCTGTCGCCATCTCCGTCAGA (SEQ ID NO: 8);
  • S5'2F CAUCAUCAUCAUCCTGCCCCCTCTCCCATAGTGT (SEQ ID NO: 9);
  • S5'2R CUACUACUACUAGGCGTTACTGCAGTTAGCTGGCT (SEQ ID NO: 10);
  • S3 'IF GGCTGCCATGCACGATGACCTT (SEQ ID NO: 11);
  • S3 'IR CGGCCAGTACTGCAACTGACCAT (SEQ ID NO: 12);
  • S3'2F CUACUACUACUAGGGAGGGTCTCCTCAGAGTGATT (SEQ ID NO: 13);
  • S3 '2R CAUCAUCAUCAUGGAAAGCCCGAGAGGTGGT (SEQ ID NO: 14);
  • B3'1R CGGGAAGGTGGTCGTCGGTCT (SEQ ID NO: 15);
  • B3'2R CAUCAUCAUCAUGGGGCCCCGAGTCTGTAATTT (SEQ ID NO: 16).
  • BamHI 5 ' cloning primary PCR was done using S5 ' IF and
  • S5'1R followed by nested PCR using S5'2F and S5'2R.
  • BamHI 3' cloning primary PCR was done by using S3 ' IF and B3 ' IR followed by nested PCR using S3'2F and B3'2R.
  • SacII 5' cloning primary PCR was done using S5' IF and S5'1R followed by nested PCR using S5'2F and S5'2R.
  • SacII 3' cloning primary PCR was done using S3 ' IF and S3 ' IR followed by nested PCR using S3'2F and S3'2R.
  • Retroviral leader sequences were trimmed from the raw sequences of IPCR products, and homology searches for the trimmed sequences were performed in the NCBI MGSCV3 database by using the BLAST software program.
  • BLAST hits were analyzed and recurrent sites of integration in multiple mouse tumors were identified. Recurrence was defined as 2 or more integrations within a 10 kb region.
  • NCBI Map View was used to identify the site of each recurrent retroviral integration onto the mouse genome. Genes immediately neighboring the site were identified by using the MGSCV3 Gene map. These genes were defined as candidate cancer-related genes because in the vast majority of cases, MuLV integration affects the most proximal genes. When the integration occurred within a gene, that gene was deemed the best candidate as the target for the effects of retroviral integration.
  • This example describes the protocols used to determine GP 132 expression levels in tumors in which Moloney murine leukemia virus (MuLV) was integrated next to the GP 132 gene. Normal tissues or tumors that did not contain an MuLV integration next to the GP 132 gene were used as control. a. Design and generation of primer sets for mouse and human genes:
  • Quantitative and real time reverse transcription PCR was used to quantify the expression levels of candidate mouse genes and their human homologues.
  • Primers for the PCR were designed using the TaqMan Probe and Primer design function of the Primer Express program from ABI. The following criteria were applied:
  • Oligonucleotides were obtained from Operon and resuspended in sterile water. Their sequences were: 5'-TGCCCAAACTCCAAAGAATC-S' (forward primer; SEQ ID NO: 17) and 5'-TTTGCTGGTCCTTTTCATCC-S' (reverse primer; SEQ ID NO: 18).
  • RNA from each mouse tumor and from R545 cells maintained with or without doxycycline was reverse transcribed using MuLV SUPERSCRIPT (Life Technologies).
  • 1 ⁇ l of 1 :20 diluted single-stranded cDNA resulting from this reverse transcription reaction was used as template for PCR.
  • the PCR primers (20 ng/ ⁇ l each), the buffer and the polymerase were added into the PCR SUPERMIX from Invitrogen, and the PCR was performed for 30 cycles. PCR products were fractionated on 1% agarose TBE gel for lhr at 100V, and individual bands visualized by ethidium bromide staining. Quantification was performed by comparison to R545 cells maintained with or without doxycycline.
  • This example describes the protocols for expressing the candidate gene identified above in human cancer cells.
  • Primer pairs for each human gene were designed as described for the mouse gene. Expression of each candidate gene was assessed in a panel of 31 human cancer cell lines and 47 human primary tumors by using real-time reverse transcription PCR.
  • the forward and reverse primers are 5'- TGCCCAAACTCCAAAGAATC-3' (SEQ ID NO: 19) and 5'- TTTGCTGGTCCTTTTCATCC-3' (SEQ ID NO: 20), respectively.
  • RNA was prepared from the cells using QIAGEN RNEASY mini-prep kits and QIAGEN
  • RNA preparations were treated with DNase during column purification according to manufacturer's instructions. Expression of each gene was determined in triplicate for all tumors and cell lines using SYBR green- based real-time PCR. To do this, 2X SYBR green PCR master mix (ABI) was mixed with the MULTISCRIBE reverse transcriptase (ABI) and RNase inhibitor (ABI). Forward and reverse primers were added at ratios previously optimized for each gene using control human reference RNA (Stratagene). 50 ng of RNA template was used per reaction, and the reactions were performed in a total volume of 20 ⁇ l. Real-time quantification was performed using the ABI 7900HT and SDS2.0 software. RNA loading was normalized for ⁇ -actin and 18S rRNA. RNA quantity was determined relative to human universal reference RNA (Stratagene) to permit run-to-run comparisons.
  • RNA interference RNA interference
  • Double-stranded siRNA oligonucleotides were designed using the OligoEngine siRNA design tool (http://www.oligoengine.com). HPLC purified siRNA oligonucleotides were incubated at 95 0 C for 1 min, 37 0 C for 1 hr, and room temperature for 30 min. siRNAs were stored at -2O 0 C prior to use. b. Transfection of Cell Lines with siRNA
  • GP-132-2 5'-GGAGAUCGAGGUGGAAGAGW-S' (SEQ ID NO: 22).
  • GP-132-3 5'-GGCAAAAGAACAUGAUUGAtt 3' (SEQ ID NO: 23).
  • MAP3K7_354-378rc is SEQ ID NO: 24
  • MAP3K7_110- 134rc is SEQ ID NO: 25
  • MAP3K7_1008-1032rc is SEQ ID NO: 26;
  • MAP3K7_1076-1100rc is SEQ ID NO: 27; MAP3K7_138-162rc is SEQ ID NO: 28; MAP3K7_956-980rc is SEQ ID NO: 29; MAP3K7_957-981rc is SEQ ID NO: 30; and MAP3K7_674-698rc is SEQ ID NO: 31.
  • This example describes the protocols for using the candidate gene to transform mouse embryonic fibroblasts.
  • a GP 132 cDNA was purchased from GeneCopeia. MEFs were isolated from 100 individual 13.5-day-old embryos. The isolated MEFs were pooled and grown in DMEM supplemented with 10% FBS, penicillin and streptomycin. Pooled early-passage (passages 4 to 6) pl6 Ink4a /pl9 Arf -/- mouse embryonic fibroblasts were transfected with (1) pKO-Myc; (2) pKO-Myc and pT24-RasV12; (3) pKO-Myc and GP132 cDNA; or (4) pKO-Myc, pT24-RasV12, and GP 132 cDNA. All transfections were done in duplicate cultures (8 X 10 5 cells) using Lipofectamine Plus in Optimem (Gibco) without serum or antibiotics. Cultures were split 1:3 a day after transfection. Foci were counted on day 12.
  • Human cancer cell lines were infected with a retrovirus driving constitutive expression of luciferase. Stable cell lines expressing high levels of luciferase were selected using antibiotic resistance markers in the integrated retrovirus. These cell line were then transfected with siRNA using the Oligofectamine reagent from Invitrogen. Transfected cells were allowed to grow for at least 24 hours. The cells were then trypsinized and resuspended in Hank's Buffered Salt Solution. One million cells were injected subcutaneously into the flanks of BaIbC nude mice. Mice were imaged daily to determine the size of each tumor based upon the level of luciferase detected, an indicator of the number of tumor cells present.
  • Human cancer cell lines expressing high levels of the candidate, or cell lines established from the inducible mouse cancer model described above, are transfected with a vector encoding a short hairpin RNA homologous to the candidate cancer-related gene. Expression of the RNA is placed under the control of an inducible U6 promoter. Stable cell lines are established. 5 X 10 5 cells are injected subcutaneously into the flank of 6 week old female inbred SCID mice. Tumor formation is observed visually. For cell lines derived from the inducible mouse model, tumor formation is induced by doxycycline. Expression of the RNAi is induced once tumors were visually identified. In the case of mouse model-derived tumor cells, the mice are fed with doxycycline. Tumor regression is followed using calipers to measure the shrinking tumor diameter.
  • Tumor cells derived from the tumor suppressor null (INK4/arf -/-) doxycycline-inducible oncogene mouse model are infected with retrovirus encoding the candidate gene under the control of an IPTG-mducible promoter. Stable cell lines are established. 10 6 cell are injected subcutaneously into the flank of 6 week old female inbred SCID mice. Mice are fed with doxycycline for 7-12 days. 24 hours prior to doxycycline withdrawal, mice are fed IPTG. IPTG feeding is maintained after withdrawal of doxycycline and tumor regression is monitored using calipers.
  • INK4/arf -/- tumor suppressor null
  • Example 9 Compound Treatment of Spontaneously Arising Tumors in a Mouse Model of Melanoma
  • mice When melanomas reach a size of 5 mm x 5 mm (anterior- posterior diameter of tumor by dorsal- ventral diameter of tumor), mice are treated with vehicle or 100 mg/kg, 200 mg/kg or 300 mg/kg of 5Z-7-oxozeanol, an inhibitor of GP132 activity (Ninomiya et al., J. Biol. Chem. 278:18485-18490 (2003)). Tumor regression is monitored using sliding calipers to measure changes in the diameters of the tumors.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Organic Chemistry (AREA)
  • Chemical & Material Sciences (AREA)
  • Biotechnology (AREA)
  • Molecular Biology (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Virology (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Physics & Mathematics (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

La présente invention concerne des techniques et des compositions permettant de traiter des états hyperprolifératifs tels qu'un cancer au moyen de réactifs associés au gène GP 132.
PCT/US2005/026297 2004-07-23 2005-07-22 Gene gp132: techniques et compositions de traitement du cancer WO2006023210A2 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US59079104P 2004-07-23 2004-07-23
US60/590,791 2004-07-23

Publications (2)

Publication Number Publication Date
WO2006023210A2 true WO2006023210A2 (fr) 2006-03-02
WO2006023210A3 WO2006023210A3 (fr) 2006-09-14

Family

ID=35968040

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2005/026297 WO2006023210A2 (fr) 2004-07-23 2005-07-22 Gene gp132: techniques et compositions de traitement du cancer

Country Status (1)

Country Link
WO (1) WO2006023210A2 (fr)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2008007072A2 (fr) * 2006-07-10 2008-01-17 Astrazeneca Ab Procédé d'inhibition cellulaire
WO2008018517A1 (fr) * 2006-08-09 2008-02-14 Zeria Pharmaceutical Co., Ltd. Agent thérapeutique et/ou préventif pour une maladie s'accompagnant d'une croissance cellulaire exagérée, et polynucléotide utile en tant que principe actif

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001068688A1 (fr) * 2000-03-02 2001-09-20 Biowindow Gene Development Inc. Shanghai Nouveau polypeptide, proteine kinase humaine tak1-27, et polynucleotide codant pour ce polypeptide
WO2003037255A2 (fr) * 2001-10-31 2003-05-08 Millennium Pharmaceuticals, Inc. Procedes et compositions de diagnostic et de traitement de troubles hematologiques au moyen de 16319

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001068688A1 (fr) * 2000-03-02 2001-09-20 Biowindow Gene Development Inc. Shanghai Nouveau polypeptide, proteine kinase humaine tak1-27, et polynucleotide codant pour ce polypeptide
WO2003037255A2 (fr) * 2001-10-31 2003-05-08 Millennium Pharmaceuticals, Inc. Procedes et compositions de diagnostic et de traitement de troubles hematologiques au moyen de 16319

Non-Patent Citations (7)

* Cited by examiner, † Cited by third party
Title
EDLUND S. ET AL.: "Transforming Growth Factor-beta1 (TGF-beta)-induced apoptosis of prostate cancer cells involves Smad7-dependent activation of p38 by TGF-beta-activated Kinase 1 and Mitogen-activated Protein Kinase Kinase 3" MOLECULAR BIOLOGY OF THE CELL, vol. 14, February 2003 (2003-02), pages 529-544, XP002387982 *
KIMURA N. ET AL.: "BMP2-induced apoptosis is mediated by activation of the TAK1-p38 Kinase pathway that is negatively regulated by SMAD6" THE JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 275, no. 23, 9 June 2000 (2000-06-09), pages 17647-17652, XP002387983 *
SAKURAI H. ET AL.: "Tumor necrosis factor-alpha-induced IKK phosphorylation of NF-kappaB p65 on serine 536 is mediated through the TRAF2, TRAF5, and TAK1 signaling pathway" THE JOURNAL OF BIOLOGICAL CHEMISTRY, AMERICAN SOCIETY OF BIOLOCHEMICAL BIOLOGISTS, BIRMINGHAM,, US, vol. 278, no. 38, 19 September 2003 (2003-09-19), pages 36916-36923, XP002274489 ISSN: 0021-9258 *
SUN L. ET AL.: "The TRAF6 Ubiquitin Ligase and TAK1 Kinase mediate IKK activation by BCL10 and MALT1 in T lymphocytes" MOLECULAR CELL, vol. 14, 7 May 2004 (2004-05-07), pages 289-301, XP002387981 *
TAKAESU G. ET AL.: "TAK1 is critical for IkB Kinase-mediated activation of the NF-kB pathway" JOURNAL OF MOLECULAR BIOLOGY, vol. 326, 2003, pages 105-115, XP004450020 *
THIEFES A. ET AL.: "A kinase-negative mutant of the MAPK kinase TAK1 inhibits stress signalling and sensitizes NIH3T3 cells to TNF-alpha induced apoptosis" NAUNYN-SCHMIEDEBERG'S ARCHIVES OF PHARMACOLOGY, vol. 365, no. Suppl.1, March 2002 (2002-03), page R57, XP002387984 *
ZHANG D. ET AL.: "TAK1 is activated in the myocardium after pressure overload and is sufficient to provoke heart failure in transgenic mice" NATURE MEDICINE, vol. 6, no. 5, May 2000 (2000-05), pages 556-563, XP002387985 *

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2008007072A2 (fr) * 2006-07-10 2008-01-17 Astrazeneca Ab Procédé d'inhibition cellulaire
WO2008007072A3 (fr) * 2006-07-10 2008-05-08 Astrazeneca Ab Procédé d'inhibition cellulaire
WO2008018517A1 (fr) * 2006-08-09 2008-02-14 Zeria Pharmaceutical Co., Ltd. Agent thérapeutique et/ou préventif pour une maladie s'accompagnant d'une croissance cellulaire exagérée, et polynucléotide utile en tant que principe actif

Also Published As

Publication number Publication date
WO2006023210A3 (fr) 2006-09-14

Similar Documents

Publication Publication Date Title
CA2665489C (fr) Compositions associees a prrg4 et procedes d'utilisation de celles-ci dans des procedes de diagnostic de tumeur
JP2017018141A (ja) 未分化リンパ腫キナーゼ（ａｌｋ）キナーゼ阻害剤に耐性である癌の診断および治療のための方法および組成物
JPH08510391A (ja) Ｍｔｓ遺伝子における生殖系統の変異およびｍｔｓ遺伝子における癌の素因の検出方法
US20090023645A1 (en) AIB1, a novel steroid receptor co-activator
JPH10513359A (ja) サイクリン依存性キナーゼＣＤＫ４およびＣＤＫ６のインヒビター、ＩｎＫ４ｃ−ｐ１８およびＩｎＫ４ｄ−ｐ１９、ならびにそれらの使用
US7273927B2 (en) Mdm2 splice variants
JPWO2005097204A1 (ja) 癌の予防・治療剤
KR100740974B1 (ko) Ｒｎａ 앱타머 및 그의 용도
WO2004050834A2 (fr) Gpc99 et gpc99a: compositions et methodes de traitement du cancer
WO2006023210A2 (fr) Gene gp132: techniques et compositions de traitement du cancer
US20150166991A1 (en) Methods for treating mds1-evi1 mediated cancer
WO2005063987A1 (fr) Gp153 : methodes et compositions de traitement du cancer
US20070042980A1 (en) Gp131: methods and compositions for treating cancer
WO2004043408A2 (fr) Gpc15 : methodes et compositions pour le traitement du cancer
WO2005021724A2 (fr) Gp115: methodes et compositions permettant de traiter le cancer
WO2006053125A2 (fr) Gp201: procedes et compositions de traitement du cancer
KR20080056185A (ko) 신규한 치료 단백질 및 표적인 칼시뉴린의 보존된 막활성인자 (ｃｍａｃ)
WO2006053155A2 (fr) Gp202: procedes et compositions destines au traitement du cancer
JP4530631B2 (ja) 新規タンパク質および癌の予防・治療剤
JPWO2005061704A1 (ja) 癌の予防・治療剤
CA2538461A1 (fr) Utilisation de genes eucaryotes affectant la formation du fuseau ou la fonction des microtubules pendant la division cellulaire pour le diagnostic et le traitement de maladies proliferatives
Huning Transcriptional Activation of Eukaryotic Promoters via Zinc Finger Protein 143
US20050028227A1 (en) BSEP polypeptide variants and uses thereof
JP5099534B2 (ja) Ｋａｎｋ３遺伝子の癌治療及び癌検出並びに創薬への利用
JP5114765B2 (ja) Ｋａｎｋ２遺伝子の癌治療及び癌検出並びに創薬への利用

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KM KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NA NG NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SM SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GM KE LS MW MZ NA SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LT LU LV MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

NENP Non-entry into the national phase in:

Ref country code: DE

121 Ep: the epo has been informed by wipo that ep was designated in this application
122 Ep: pct application non-entry in european phase