WO2005021724A2 - Gp115: methodes et compositions permettant de traiter le cancer - Google Patents

Gp115: methodes et compositions permettant de traiter le cancer Download PDF

Info

Publication number
WO2005021724A2
WO2005021724A2 PCT/US2004/027968 US2004027968W WO2005021724A2 WO 2005021724 A2 WO2005021724 A2 WO 2005021724A2 US 2004027968 W US2004027968 W US 2004027968W WO 2005021724 A2 WO2005021724 A2 WO 2005021724A2
Authority
WO
WIPO (PCT)
Prior art keywords
mammal
gpl
expression
cancer
cell
Prior art date
Application number
PCT/US2004/027968
Other languages
English (en)
Other versions
WO2005021724A3 (fr
Inventor
Ronan C. O'hagan
Karuppiah Kannan
David Bailey
Original Assignee
Genpath Pharmaceuticals, Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Genpath Pharmaceuticals, Inc. filed Critical Genpath Pharmaceuticals, Inc.
Publication of WO2005021724A2 publication Critical patent/WO2005021724A2/fr
Publication of WO2005021724A3 publication Critical patent/WO2005021724A3/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/82—Translation products from oncogenes

Definitions

  • This invention relates generally to the field of molecular biology. More particularly, this invention relates to genes involved in cancer genesis, maintenance, and progression. Background of the Invention Despite the long history of clinical and research efforts directed towards understanding cancer, surprisingly little is known about the genetic lesions responsible for its genesis, progression, and clinical behavior. For example, in the case of melanoma, although many genes have been implicated in the genesis of this disease, only the INK4a, RAS and BRAF genes have been shown to be true etiologic lesions in a formal genetic sense (Chin et al, Genes Devel. 11:2822-34 (1997); Davies et al, Nature 417:949-54 (2002)).
  • advanced malignancy represents the phenotypic endpoint of many successive genetic lesions that affect many oncogene and tumor suppressor gene pathways. Lesions that lead to such a condition may therefore differ from those required to maintain it. Both types of lesions represent rational therapeutic targets in the treatment of cancer.
  • GP115 functionally complements the RAS oncogene in an inducible, spontaneous, in vivo cancer model (mouse). It has also been discovered that interfering RNAs that target GP115 expression inhibit the growth of certain tumor cells in vitro. Based on these discoveries, the invention provides GP115 antagonists that inhibit GP115 gene expression or GP115 protein activity. Antagonists that inhibit GP115 gene expression include an interfering RNA that inhibits the expression of GP115, a GP115 antisense nucleic acid, and an anti-GP115 ribozyme.
  • Exemplary interfering RNAs of the invention include those that target the sequence of SEQ ID NO: 3, SEQ LO NO: 4, or SEQ ID NO: 5.
  • Antagonists that inhibit GP115 protein activity include blocking antibodies that bind to that portion of the GP115 protein that is exposed on the surface of a GP115-expressing cell.
  • GP115 antagonists of the invention inhibit tumorigenesis, tumor development, tumor maintenance, tumor recurrence, tumor growth, or the growth of tumor cells in vitro.
  • the invention also provides methods of inducing apoptosis in a cell. The methods include contacting the cell with an effective amount of a GP115 antagonist.
  • the invention also provides methods of treating a hyperproliferative condition in a mammal, e.g., a human patient.
  • the method includes administering to the mammal an effective amount of a GP115 antagonist.
  • Cancer is an example of such a hyperproliferative condition.
  • Other examples of hyperproliferative conditions are uncontrolled angiogenesis, psoriasis, arteriosclerosis, arthritis and diabetic retinopathy.
  • the method of treating a hyperproliferative condition includes administering a second therapeutic agent.
  • the second therapeutic agent can be, for example, an anti-angiogenic agent, anti-metastatic agent, agent that induces hypoxia, agent that induces apoptosis, or an agent that inhibits cell survival signals.
  • cancer therapeutics include farnesyl transferase inhibitors, tamoxifen, herceptin, taxol, STI571, cisplatin, 5-fluorocil, cytoxan, and ionizing radiation.
  • the invention also provides a host cell containing a recombinant DNA construct that includes a GPl 15-encoding sequence operably linked to an expression control sequence, and a genetic mutation that causes the host cell to have a greater likelihood of becoming a cancer cell than a cell not comprising the genetic mutation.
  • a mutation can be, e.g., a mutation that deletes or inactivates a tumor suppressor gene, or a mutation that activates an oncogene.
  • tumor suppressor genes include IN 4a, P53, Rb, PTEN, LATS, Apafl, Caspase 8, APC, DPC4, KLF6, GSTP1, ELAC2/HPC2 and NKX3.1.
  • oncogenes include K-RAS, H-RAS, N-RAS, EGFR, MDM2, TGF-/3, RhoC, AKT family members, myc, 3-catenin, PGDF, C-MET, PI3K-CA, CDK4, cyclin Bl, cyclin Dl, estrogen receptor gene, progesterone receptor gene, HER2 (also known as neu or ErbB2), ErbBl, ErbB3, ErbB4, TGF ⁇ , ras-GAP, She, Nek, Src, Yes, Fyn, Wnt, and Bcl2.
  • the invention also provides a genetically modified non-human mammal, e.g., a mouse, at least some of whose cells contain a genome that includes: (a) a recombinant GPl 15-encoding nucleic acid operably linked to an expression control sequence, and (b) a genetic mutation that causes the mammal to have a greater susceptibility to cancer than a mammal whose cells do not contain the genetic mutation.
  • the genetic mutation involves a tumor suppressor gene and renders the tumor suppressor gene non-functional.
  • the genetically modified nonhuman mammal can be a conventional transgenic mammal, all of whose cells contain the recombinant GPl 15-encoding nucleic acid operably linked to an expression control sequence, and the genetic mutation that causes the mammal to have increased susceptibility to cancer.
  • the mammal is a chimeric mammal at least some of whose, but not all of whose, somatic cells contain the recombinant GPl 15-encoding nucleic acid operably linked to an expression control sequence, and the genetic mutation that causes the mammal to have a increased susceptibility to cancer, h such a chimeric mammal, the percentage of somatic cells containing the recombinant GPl 15-encoding nucleic acid operably linked to an expression control sequence, and a genetic mutation that causes the mammal to have a greater susceptibility to cancer is between 5% and 95%. Preferably it is between 15% and 85%.
  • the GPl 15-encoding nucleic acid is operably linked to a tissue-specific expression system.
  • the invention also provides a genetically modified nonhuman mammal, wherein the genetic modification reduces or eliminates expression of one or both of the mammal's endogenous GPl 15 alleles. Such reduction or elimination of GPl 15 expression can be achieved, for example, when the genetic modification is addition of an RNAi expression construct targeting GPl 15 gene expression, or when the genetic modification is a knockout of one or both of the GPl 15 alleles. Such a genetic modification can reduce or eliminate GPl 15 expression in a tissue- specific manner.
  • the genetically modified mammal is chimeric with respect to the genetic modification.
  • the invention also provides a screening method for identifying a compound useful for treating a hyperproliferative condition such as cancer.
  • the method includes: (a) identifying a biomarker whose level correlates with inhibition of GPl 15 activity; and (b) detecting a change in the level of the biomarker in the presence of a test compound relative to the level of the biomarker detected in the absence of the test compound.
  • the invention also provides a screening method for identifiying a compound useful in treatment of a hyperproliferative condition such as cancer.
  • the method includes : (a) providing an inhibitor of GP 115 expression or activity; (b) identifying a negative control biomarker pattern formed by a plurality of biomarkers in a cancer cell wherein the cell is not contacted with the inhibitor of GPl 15 expression or activity; (c) identifying a positive control biomarker pattern formed by a plurality of biomarkers in the cancer cell wherein the cancer cell is contacted with the inhibitor of GPl 15 expression or activity; (d) identifying a test biomarker pattern formed by a plurality of biomarkers in the cancer cell wherein the cancer cell is contacted with a candidate compound but not contracted with the inhibitor of GPl 15 expression or activity; and (e) comparing the negative control biomarker pattern, positive control biomarker pattern and test biomarker pattern, and detecting a greater similarity between the positive control biomarker pattern and the test biomarker pattern than between the negative control biomarker pattern and the test biomarker pattern.
  • the invention also provides methods of diagnosing an abnormal hyperproliferative condition, e.g., cancer, in a subject. These methods involve detecting the expression level of a GPl 15 gene or the activity level of a GPl 15 protein.
  • An abnormally high level relative to control e.g., at least about 50%, 100%, 150%, 200%, 250%, or 300% higher, indicatives an abnormal hyperproliferative condition.
  • all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the invention pertains. In case of conflict, the present specification, including definitions, will control. All publications, patents and other references mentioned herein are incorporated by reference in their entirety.
  • FIG. 1 is a histogram summarizing data on the inhibition of growth of human cancer cell lines HCT-116 (colon), HCT-15 (colon) NCI-H460 (lung) and MiaPaCa2 (pancreas) in soft agar by siRNA-mediated knockdown of GP 115 expression.
  • Treated cells were transfected with siRNA (SEQ LD NO: 2) targeted against GPl 15.
  • Negative controls were transfected with siRNA targeted against luciferase.
  • White bars represent GPl 15 expression level relative to a GPl 15 expression in negative controls.
  • Black bars represent the number of colonies detectable in the agar after 10 days relative to the number of colonies in the negative controls.
  • GPl 15 Up-regulation of GPl 15 contributes to tumorigenesis and tumor maintenance.
  • GPl 15 was identified as a cancer therapeutic target using the Mammalian Second Site Supression ("MaSS") screening system described below and in WO 02/079419.
  • the GPl 15 gene encodes Chromosome 17 open reading frame 26 ("C17or£26"; GenBank Accession No. NM 39177; UniGene TD Hs.3402), and is located at human cliromosome 17q25.1.
  • “GPl 15' means the gene or a protein product of the gene (depending on the context) of any animal species.
  • the GP 115 protein has significant homology with known zinc transporter proteins.
  • An exemplary human GPl 15 protein contains 335 amino acid residues and has the following polypeptide sequence:
  • NM_139177 The open reading frame of the above sequence is nucleotides 78- 1085.
  • Other human GP 115 coding sequences include Genbank accession numbers AF331643.1, NM_139177.1, and BC035631.1.
  • GPl 15 orthologs in other animal species have also been identified. They include GenBank accession numbers NM_027216 (M. musculus), XM_213529 (R. norvegicus), and NM_059213 (C elegans).
  • the GPl 15 gene is expressed in a variety of tissues, including colon, kidney, lung, heart, myeloid cells, stomach, cervix, uterus, endometrium, B- cells, liver, spleen, melanocyte, marrow, placenta, blood, brain, testis, leukocyte, islets of Langerhans, ascites, osteoarthritic cartilage and breast.
  • cancer tissue types e.g., retinoblastoma, hypemephroma, ovarian tumor, squamous cell carcinomas, melanotic melanoma, chronic lymphotic leukemia, head and neck cancer, leiomyosarcoma, anaplastic oligodendroglioma and metastatic chondrosarcoma
  • cancer cell lines e.g., adenocarcinoma cell line, high MDR cell line, epidermoid carcinoma cell line, cervical carcinoma cell line, lymphoma cell line, hepatocellular carcinoma cell line, ductal carcinoma cell line, human chondrosarcoma cell line, HCT-116, DLD-1, SK-MEL28, A549, MiaPaCa2, LNCaP.FGC, 22Rvl, DU145, MCF-7, PC-3, SW620, HCT-15, and KATO III).
  • cancer cell lines e.g., adenocarcinoma cell line, high MDR
  • the GPl 15 gene was found to be involved in development (including maintenance, progression, angiogenesis, and/or metastasis) of cancers, e.g., cancers found in skin (e.g., melanoma), lung, prostate, breast, colorectal, liver, pancreatic, brain, testicular, ovarian, uterine, cervical, kidney, thyroid, bladder, esophageal, and hematological tissues.
  • skin e.g., melanoma
  • lung e.g., prostate, breast, colorectal, liver, pancreatic, brain, testicular, ovarian, uterine, cervical, kidney, thyroid, bladder, esophageal, and hematological tissues.
  • RNA interference RNA interference
  • nucleic acid sequences specifically provided herein are sequences of deoxyribonucleotides. However, the given sequences are to be interpreted as would be appropriate to the polynucleotide composition. For example, if the isolated nucleic acid is RNA, the given sequence intends ribonucleotides, with uridine substituted for thymidine. h some embodiments, differences from naturally occurring nucleic acids, e.g., non-native bases, altered internucleoside linkages, and post-synthesis modification, can be present throughout the length of the GPl 15 nucleic acid or can be usefully localized to discrete portions thereof.
  • a chimeric nucleic acid can be synthesized with discrete DNA and RNA domains and demonstrated utility for targeted gene repair. See, e.g., U.S. Pat. Nos. 5,760,012 and 5,731,181.
  • Polymorphisms such as single nucleotide polymorphisms (SNPs) occur frequently in eukaryotic genomes. Additionally, small deletions and insertions, rather than SNPs, are not uncommon in the general population, and often do not alter the function of the protein. Accordingly, this invention provides not only isolated nucleic acids identical in sequence to those described with particularity herein, but also isolated nucleic acids that are allelic variants of those particularly described nucleic acid sequences.
  • sequence variations result from human intervention, e.g., by random or directed mutagenesis.
  • the invention provides isolated nucleic acid molecules that encode the entirety or part (e.g., at least five, seven, or nine contiguous amino acid residues) of the GPl 15 protein, including allelic variants of this protein.
  • the genetic code is degenerate and codon choice for optimal expression varies from species to species.
  • the coding sequences of this invention include degenerate variants of the sequences described herein with particularity.
  • the isolated polynucleotide comprises a nucleotide sequence encoding SEQ LD NO: 1.
  • nucleic acids can be used, for example, to express the GPl 15 protein or specific portions of the protein, either alone or as elements of a fusion protein, e.g., to express epitopic or immunogenic fragments of the GPl 15 protein.
  • nucleic acids are used to produce non-human mammals of the invention.
  • nucleic acids also can be used also as probes to hybridize to GPl 15 nucleic acids and related nucleic acid sequences.
  • This invention also relates to nucleic acids comprising sequences coding for polypeptides containing conservative amino acid substitutions or moderately conservative amino acid substitutions from those polypeptides described with particularity herein.
  • This invention also relates to isolated polynucleotides that hybridize to one or more of the above-described GPl 15 nucleic acids. These cross- hybridizing nucleic acids can be used, e.g., as hybridization probes, primers, and/or for expression of proteins that are related to GPl 15 as isoforms and homologs, e.g., paralogs, and orthologs.
  • the invention relates to an isolated nucleic acid comprising a sequence that hybridizes under high stringency conditions to a probe comprising a fragment of SEQ ID NO: 2 having at least 15, 16, 18, 20, 24, or 25 nucleotides.
  • high stringency conditions are defined for solution phase hybridization as aqueous hybridization (i.e., free of formamide) in 6X SSC (where 20X SSC contains 3.0 M NaCl and 0.3 M sodium citrate), 1% SDS at 65°C for 8-12 hours, followed by two washes in 0.2X SSC, 0.1% SDS at 65°C for 20 minutes.
  • hybridizing portion of a reference nucleic acid is typically at least 15 nucleotides in length, and often at least 17 , 20, 25, 30, 35, 40 or 50 nucleotides in length.
  • Cross-hybridizing nucleic acids that hybridize to a larger portion of the reference nucleic acid - for example, to a portion of at least 50, 100, 150, 200, 250, 300, 350, 400, 450, 500 or more nucleotides, up to and including the entire length of the reference nucleic acid, are also useful.
  • Nucleic Acid Fragments Fragments of the above-described nucleic acids are also relate to this invention. They can be used as region-specific probes, as amplification primers, regulatory sequences to direct expression of a gene, and/or to direct expression of a GPl 15 polypeptide fragment, e.g., immunogenic fragment.
  • the nucleic acid probes may comprise a detectable label, e.g., a radioisotope, a fluorescent compound, an enzyme, or an enzyme co-factor.
  • Such probes can be used as a part of a diagnostic kit for identifying cells or tissues that (i): incorrectly express a GPl 15 protein, e.g., aberrant splicing, or abnormal mRNA levels, or (ii) harbor a mutation in the GPl 15 gene, such as a deletion, an insertion, or a point mutation.
  • diagnostic kits preferably include labeled reagents and instructional inserts for their use.
  • the nucleic acid primers can be used in PCR, primer extension and the like. They can be, e.g., at least 6 nucleotides (e.g., at least 7, 8, 9, or 10) in length.
  • the primers can hybridize to an exon sequence of a GPl 15 gene, e.g., for amplification of a GPl 15 mRNA or cDNA.
  • the primers can hybridize to an intron sequence or an upstream or downstream regulatory sequence of a GPl 15 gene, to utilize non-transcribed, e.g., regulatory, portions of the genomic structure of a GPl 15 gene.
  • the nucleic acid primers also can be used, e.g., to prime single base extension (SBE) for SNP detection (see, e.g., U.S. Pat. No. 6,004,744). Isothermal amplification approaches, such as rolling circle amplification, are also now well-described.
  • Rolling circle amplification can be combined with other techniques to facilitate SNP detection. See, e.g., Lizardi et al., Nature Genet. 19(3):225-32 (1998).
  • Nucleic acid fragments that encode 5 or more contiguous amino acids are useful in directing the synthesis of peptides that have utility in mapping the epitopes of the GPl 15 protein. See, e.g., Geysen et al., Proc. Natl. Acad. Sci. USA 81:3998-4002 (1984); and U.S. Pat. Nos. 4,708,871 and 5,595,915. Such nucleic acid fragments are also useful in directing the synthesis of peptides that have utility as immunogens.
  • the invention further relates to single exon probes having portions of no more than one exon of the GPl 15 gene. Such single exon probes have particular utility in identifying and characterizing splice variants.
  • Antisense Nucleic Acids Some embodiments of the invention relate to isolated nucleic acids that are antisense polynucleotides that specifically hybridize to GPl 15 sense polynucleotides.
  • the antisense nucleic acid molecule can be complementary to the entire coding or non-coding region of GPl 15, but more often is antisense to only a portion of the coding or non-coding region of GPl 15 mRNA.
  • the antisense oligonucleotide can be complementary to the region surrounding the translation start site of GPl 15 mRNA.
  • An antisense oligonucleotide can be, for example, about 5, 10, 15, 20, 25, 30, 35, 40, 45 or 50 nucleotides in length.
  • the antisense nucleic acids of this invention may, for example, form a stable duplex with its target sequence, or, in the case of an antisense nucleic acid molecule that binds to DNA duplexes, through specific interactions in the major groove of the double helix, h yet other embodiments, the antisense nucleic acid molecule of the invention is an -anomeric nucleic acid molecule.
  • An ⁇ - anomeric nucleic acid molecule forms specific double-stranded hybrids with complementary RNA in which, contrary to the usual ⁇ -units, the strands run parallel to each other (Gaultier et al. Nucl. Acids Res 15: 6625-6641 (1987)).
  • An antisense target sequence is a nucleotide sequence specific to GP 115 , and can be designed through use of a publicly available sequence database, and/or through use of commercially available sequence comparison programs. Antisense nucleic acids of the invention can then be constructed using procedures known in the art.
  • an antisense nucleic acid e.g., an antisense oligonucleotide
  • an expression vector into which a nucleic acid has been inserted in an antisense orientation i.e., RNA transcribed from the inserted nucleic acid will be of an antisense orientation to a target nucleic acid of interest.
  • the antisense nucleic acid can be chemically synthesized using naturally occurring nucleotides or variously modified nucleotides designed to increase the biological stability of the molecule or to increase the physical stability of the duplex formed between the antisense and sense nucleic acids.
  • phosphorothioate derivatives and acridine substituted nucleotides can be used.
  • Phosphorothioate and methylphosphonate antisense oligonucleotides are useful in practicing the invention.
  • the antisense nucleic acid molecule can also comprise a 2'-O-methylribonucleotide (Inoue et al, Nucl. Acids Res 15: 6131-6148 (1987)) or a chimeric RNA -DNA analogue (Inoue et al. FEBS Lett 215: 327-330 (1987)).
  • antisense oligonucleotides maybe further modified by adding poly-L-lysine, transferrin, polylysine, or cholesterol moieties at their 5' end.
  • antisense molecules can be administered to a subject, e.g., a mouse or human, or generated in situ via an expression vector, such that they bind to cellular RNA and/or genomic DNA encoding a GPl 15 protein thereby inhibiting GPl 15 expression by inhibiting transcription and/or translation. Suppression of GPl 15 expression at either the transcriptional or translational level is useful to treat certain cancer conditions in patients or to generate cellular or animal models for cancer characterized by aberrant GPl 15 expression.
  • an antisense molecule can be administered by direct injection at a tissue site of a subject. Alternatively, an antisense molecule can be designed to target selected cells, e.g., cancer cells overexpressing GPl 15, and then administered systemically.
  • an antisense nucleic acid of the invention is part of a GPl 15-specific ribozyme (or, as modified, a "nucleozyme"). Ribozymes are catalytic RNA molecules with ribonuclease activity capable of cleaving a single-stranded nucleic acid, such as an mRNA, to which they have a complementary region.
  • ribozymes such as hammerhead, hairpin, and Group I intron ribozymes can cleave GPl 15 mRNA transcripts catalytically, thereby inhibiting translation of GP 115 mRNA.
  • a ribozyme having specificity for a GPl 15-encoding nucleic acid can be designed based upon the nucleotide sequence of a GP115 polynucleotide disclosed herein (SEQ ID NO: 2). See, e.g., U.S. Patent Nos. 5,116,742; 5,334,711; 5,652,094; and 6,204,027.
  • a derivative of a Tetrahymena L-19 IVS RNA can be constructed in which the nucleotide sequence of the active site is complementary to the nucleotide sequence to be cleaved in a GPl 15-encoding mRNA.
  • GPl 15 mRNA can be used to select a catalytic RNA having a specific ribonuclease activity from a pool of RNA molecules. See, e.g., Bartel et al., Science 261:1411-1418 (1993).
  • the ribozymes and other antisense reagents of this invention include appended groups such as peptides. This is useful for targeting host cell receptors in vivo, facilitating transport across the cell membrane (Letsinger et al., Proc. Natl. Acad. Sci. USA 86:6553-6556 (1989); Lemaitre et al., Proc. Natl. Acad. Sci. USA 84:648-652 (1987); WO 88/09810) facilitating transport across the blood-brain barrier (WO 89/10134).
  • GP 115 gene can be inhibited by targeting nucleotide sequences complementary to the regulatory region of the GPl 15, e.g., the GPl 15 promoter and/or enhancers, to form triple helical structures that prevent transcription of the GPl 15 gene in target cells.
  • nucleotide sequences complementary to the regulatory region of the GPl 15, e.g., the GPl 15 promoter and/or enhancers to form triple helical structures that prevent transcription of the GPl 15 gene in target cells.
  • PNA Peptide Nucleic Acids
  • PNA compounds the phosphodiester backbone of the nucleic acid is replaced with an amide-containing backbone, in particular by repeating N-(2-aminoethyl) glycine units linked by amide bonds.
  • Nucleobases are bound directly or indirectly to aza-nitrogen atoms of the amide portion of the backbone, typically by methylene carbonyl linkages.
  • the synthesis of PNA oligomers can be performed using conventional solid phase peptide synthesis as described in Hyrup et al., supra; and Perry-O'Keefe et al., Proc. Natl.
  • GPl 15-based PNAs can be used in therapeutic and diagnostic applications.
  • PNAs can be used as antisense or antigene agents for sequence-specific modulation of gene expression by, e.g., inducing transcription or translation arrest or inhibiting replication.
  • GPl 15-based PNAs also can be used in the analysis of single base pair mutations in a gene. This can be done by PNA directed PCR clamping; as artificial restriction enzymes when used in combination with other enzymes, e.g., SI nucleases, or as probes or primers for DNA sequence and hybridization (Hyrup et al., supra; Perry-O'Keefe, supra).
  • PNAs of GPl 15 are modified, e.g., to enhance their stability or cellular uptake, by attaching lipophilic or other helper groups to PNA, by the formation of PNA-DNA chimeras, or by the use of liposomes or other techniques of drug delivery known in the art.
  • PNA-DNA chimeras of GPl 15 can be generated that may combine the advantageous properties of PNA and DNA.
  • Such chimeras allow DNA recognition enzymes, e.g., RNase H and DNA polymerases, to interact with the DNA portion while the PNA portion would provide high binding affinity and specificity.
  • RNA Interference The invention provides RNA interference (RNAi) for use in silencing the expression of the GPl 15 gene.
  • RNAi is a sequence-specific posttranscriptional gene silencing mechanism triggered by double-stranded RNA (dsRNA) and causes degradation of mRNAs homologous in sequence to the dsRNA.
  • the mediators of the degradation are 21- to 23 -nucleotide small interfering RNAs (siRNAs) generated by ribonuclease III cleavage from the longer dsRNAs.
  • Molecules of siRNA typically have 2- to 3-nucleotide 3' overhanging ends resembling the RNAse III processing products of long dsRNAs that normally initiate RNAi.
  • RNA-induced silencing complex an endonuclease complex
  • siRNAs avoids activation of the dsRNA-inducible interferon system in mammalian cells. This helps avoid the nonspecific phenotypes normally produced by dsRNA larger than 30 base pairs in somatic cells.
  • Elbashir et al. Methods 26:199-213 (2002); McManus and Sharp, Nature Reviews 3:737-747 (2002); Harmon, Nature 418:244-251 (2002); Tuschl, Nature Biotechnology 20:446-448 (2002); and Tuschl U.S. Application US2002/0086356 Al.
  • SiRNA oligonucleotides can be designed with commercially available software programs, e.g., the OligoEngine siRNA design tool available at http://www.oligoengine.com.
  • Preferred siRNAs of this invention range about 19- 29 basepairs in length for the double-stranded portion.
  • the siRNAs are hairpin RNAs having an about 19-29 bp stem and an about 4-34 nucleotide loop.
  • siRNAs are highly specific for a GPl 15 target region and may comprise any 19-29 bp fragment of a GPl 15 mRNA that has at least 1 (e.g., at least 2 or 3) bp mismatch with a nonGPl 15-related sequence.
  • the GPl 15 siRNAs do not bind to RNAs having more than 3 mismatches.
  • the target sequences of exemplary siRNAs for GPl 15 are: 5'- cttcggctctacgttgatg -3'(SEQ ID NO: 3); 5'- tggtgaggcatatcagaga -3' (SEQ LO NO: 4); and 5'- gcctactccttctttacata-3' (SEQ ID NO: 5). These three sequences correspond to nucleotides 422-440, 521-539 and 2239-2257 of SEQ ID NO: 2, respetively.
  • SiRNAs that target an RNA region having 10 or more nucleotide overlaps with an aforementioned exemplary target region are also useful.
  • Intracellular transcription of siRNAs can be achieved by cloning the siRNA templates into RNA polymerase III (Pol III) transcription units, which normally encode the small nuclear RNA U6 or the human RNAse P RNA HI .
  • Poly III RNA polymerase III
  • Two approaches can be used for expressing siRNA: (1) sense and antisense strands constituting the siRNA duplex are transcribed by individual promoters; or (2) siRNAs are expressed as fold-back stem-loop structures that give rise to siRNAs after intracellular processing.
  • Inducible promoters can also be used to drive the expression of the siRNA.
  • the following oligonucleotides can be used with a primer specific to the U6 small RNA promoter to form double-stranded DNA in a polymerase chain reaction, using a vector containing this U6 promoter as a template.
  • the PCR product can then be ligated into a vector. Expression of the insert leads to expression of a short hairpin RNA.
  • the hairpin structure displays inhibitory effects on GPl 15 expression.
  • GPl 15 target nucleotides 1-29 (in boldface) ggaattcaaaaagcccccactaccactctcccgccgactccccaaggagccggcg agagagtggcagcgggggctagtatatgtgctgccgaagc ( SEQ ID NO: 6)
  • GPl 15 target nucleotides 2664-92 (in boldface) ggaattcaaaagatattaatcacagtcatgagatcctgccccaagacaagacct cataactgtgattaatatctagtatatgtgctgccgaagc (SEQ IDNO: 7)
  • GP 115 target nucleotides 862-90 (in boldface) ggaattcaaaaagaccccagccagaggctccaccataccacccaagcggcatggt ggagcccctggccggggtctagtatatgtgctgccgaagc (SEQ ID NO: 8)
  • siRNA oligonucleotide or its coding sequence can be delivered into a target cell via a variety of methods, including but not limited to, liposome fusion (transposomes), routine nucleic acid transfection methods such as electroporation, calcium phosphate precipitation, and micromjection, and infection by viral vectors.
  • liposome fusion transposomes
  • routine nucleic acid transfection methods such as electroporation, calcium phosphate precipitation, and micromjection, and infection by viral vectors.
  • Exemplary Uses of GPl 15 Nucleic Acids 1. Characterization of Genetic Mutations
  • the above-described isolated nucleic acids can be used as hybridization probes to characterize GPl 15 nucleic acids in both genomic and transcript-derived nucleic acid samples.
  • the probes can be used to detect gross alterations in the GPl 15 genomic locus, such as deletions, insertions, translocations, and duplications of the GPl 15 genomic locus.
  • Methods of detection include fluorescence in situ hybridization (FISH) to chromosome spreads, comparative genomic hybridization (CGH), array CGH (e.g., on microarrays containing GP115-coding sequences or BAC comprising GP115- coding sequences), and spectral karyotyping (SKY).
  • FISH fluorescence in situ hybridization
  • CGH comparative genomic hybridization
  • array CGH e.g., on microarrays containing GP115-coding sequences or BAC comprising GP115- coding sequences
  • SKY spectral karyotyping
  • the nucleic acid probes can be also used to isolate genomic clones that include the nucleic acids of the present invention, which thereafter can be restriction mapped and sequenced to identify deletions, insertions, amplifications, translocations, and substitutions (e.g., SNPs) at the sequence level.
  • the nucleic acid probes can also be used to isolate GPl 15 nucleic acids from cDNA libraries, permitting sequence level characterization of GPl 15 RNA messages, including identification of deletions, insertions, truncations — including deletions, insertions, and truncations of exons in alternatively spliced forms — and single nucleotide polymorphisms.
  • nucleic acids also can be used as amplification primers for real time PCR to detect the above-described genomic alterations.
  • genomic alterations of the GPl 15 gene often play a role in tumor genesis, maintenance and development, and thus can be used as markers for diagnosis and prognosis of GP115-mediated cancers.
  • the nucleic acid probes can be used to measure the representation of GPl 15 clones in a cDNA library, used as primers for quantitative real time PCR, or otherwise used to measure expression level of the GPl 15 gene. Measurement of GPl 15 expression has particular utility in diagnostic assays for cancer-related conditions associated with abnormal GPl 15 expression.
  • nucleic acids also can be used to introduce mutations (e.g., null mutations, dominant negative mutations, dominant acting mutations) into a GPl 15 locus of an animal via homologous recombination. Such animals (e.g., knock out mice) are useful in delineating the role of GPl 15 in tumor genesis and development and in facilitating cancer drug development.
  • homologous recombination can be used to replace the endogenous regulatory elements with heterologous regulatory elements, i.e., elements not natively associated with the gene in the same manner. This can alter the expression of GPl 15, both for production of GPl 15 protein, and for gene therapy. See, e.g., U.S. Pat. Nos. 5,981,214, 6,048,524; and 5,272,071. Fragments of the above-described polynucleotides smaller than those typically used for homologous recombination can also be used for targeted gene correction or alteration, possibly by cellular mechanisms different from those engaged during homologous recombination. See, e.g., U.S. Pat. Nos.
  • the vectors can be used to propagate the new nucleic acid molecules in host cells, to shuttle the molecules between host cells derived from disparate organisms, to insert the molecules into host genomes, to express sense or antisense RNA transcripts or interfering RNAs, and to express GPl 15 polypeptides.
  • the vectors are derived from virus, plasmid, prokaryotic or eukaryotic chromosomal elements, or some combination thereof, and may optionally include at least one origin of replication, at least one site for insertion of heterologous nucleic acid, and at least one selectable marker.
  • This invention relates to host cells, which can be prokaryotic (bacteria) or eukaryotic (e.g., yeast, insect, plant and animal cells).
  • a host cell strain may be chosen for its ability to process the expressed protein in the desired fashion.
  • post-translational modifications of the polypeptide include, but are not limited to, acetylation, carboxylation, glycosylation, phosphorylation, hydroxylation, sulfation, lipidation, and acylation.
  • Some embodiments of the invention may involve GPl 15 proteins with such post-translational modifications.
  • Exemplary prokaryotic host cells are E. coli, Caulobacter crescentus, Streptomyces species, and Salmonella typhimurium cells. Vectors useable in these cells include, without limitation, those related to pBR322 and the pUC plasmids.
  • Exemplary yeast host cells are Saccharomyces cerevisiae, Schizosaccharomyces pombe, Pichiapastoris, ⁇ cad Pichia methanolica. Any suitable vector may be used, e.g., integrative Yip vectors, replicating episomal YEp vectors containing centromere sequences CEN and autonomously replicating sequences ARS. Insect cells may be advantagseous, e.g., for high efficiency protein expression.
  • Exemplary insect host cells are those from Spodoptera frugiperda (e.g., Sf9 and Sf21 cell lines, and EXPRESSFTM cells (Protein Sciences Corp., Meriden, CT, USA)), Drosophila S2 cells, and Trichoplusia ni HIGH FrV ⁇ ® Cells (Invitrogen, Carlsbad, CA, USA). Where the host cells are Spodoptera frugiperda cells, the vector replicative strategy is typically based upon the baculovirus life cycle.
  • Exemplary mammalian host cells are COS1 and COS7 cells, NSO cells, Chinese hamster ovary (CHO) cells, NIH 3T3 cells, 293 cells, HEPG2 cells, HeLa cells, L cells, MDCK, HEK293, WI38, murine ES cell lines (e.g., from strains 129/SV, C57/BL6, DBA-1, 129/SVJ), K562, Jurkat cells, BW5147 and commercially available human cancer cell lines.
  • Cells with K-ras Gl3O such as human colon cancer cell lines DLD-1 and HCT-116, and revertants thereof having a null mutation in the activated K-ras gene, can also be used.
  • mammalian host cells includes those in the body of a subject, e.g., a human patient or other mammal.
  • Vectors intended for autonomous extrachromosomal replication in mammalian cells typically include a viral origin, such as the SV40 origin (for replication in cell lines expressing the large T-antigen, such as COS1 and COS7 cells), the papillomavirus origin, or the EBV origin for long term episomal replication (for use in, e.g., 293-EBNA cells, which constitutively express the EBV EBNA-1 gene product and adenovirus El A).
  • Vectors intended for integration, and thus replication as part of the mammalian cliromosome optionally include an origin of replication functional in mammalian cells, e.g., the SV40 origin.
  • Useful vectors also include vectors based on viruses such as lentiviruses, adenovirus, adeno- associated virus, vaccinia virus, parvoviruses, herpesviruses, poxviruses, Semliki Forest viruses, and retroviruses.
  • Plant cells also can be used for expression, with the vector replicon typically derived from a plant virus (e.g., cauliflower mosaic virus (CaMV); tobacco mosaic virus (TMV)) and selectable markers chosen for suitability in plants.
  • a plant virus e.g., cauliflower mosaic virus (CaMV); tobacco mosaic virus (TMV)
  • the invention relates to artificial chromosomes, e.g., bacterial artificial chromosomes (BACs), yeast artificial chromosomes (YACs), mammalian artificial chromosomes (MACs), and human artificial chromosomes (HACs), that contain the GPl 15 nucleic acid of interest.
  • Vectors often include elements that permit in vitro transcription of
  • RNA from the inserted heterologous nucleic acid typically include a phage promoter, such as that from T7, T3, or SP6, flanking the nucleic acid insert. Often two different such promoters flank the inserted nucleic acid, permitting separate in vitro production of both sense and antisense strands.
  • a phage promoter such as that from T7, T3, or SP6, flanking the nucleic acid insert. Often two different such promoters flank the inserted nucleic acid, permitting separate in vitro production of both sense and antisense strands.
  • B. Transcription Regulators for Expression Vectors often include a variety of other genetic elements operatively linked to the protein-encoding heterologous nucleic acid insert. Examples of other such genetic elements are promoters and enhancer elements. Other elements are those that facilitate RNA processing, e.g., transcription termination signals, splicing signals and polyadenylation signals.
  • Constitutively active promoters include, without limitation, a CMV promoter, EFl ⁇ , retro viral LTRs, and SV40 early region.
  • Inducible promoters useful in this invention include, without limitation, a tetracycline-inducible promoter, a metallothionine promoter, the LPTG/lacI promoter system, the ecdysone promoter system, and the "lox stop lox" system for irreversibly deleting inhibitory sequences for translation or transcription.
  • a GPl 15 gene is placed between lox sites. Upon expression of the ere enzyme, the GPl 15 gene is deleted from the genome so that the GPl 15 activity is permanently eliminated.
  • a GP 115 protein also can be inducibly switched on or off by fusing the GPl 15 protein to, e.g., an estrogen receptor polypeptide sequence, where administration of estrogen or an estrogen analog (e.g., hydroxytamoxifen) will allow the correct folding of the GPl 15 polypeptide into a functional protein.
  • an estrogen receptor polypeptide sequence e.g., an estrogen receptor polypeptide sequence
  • an estrogen analog e.g., hydroxytamoxifen
  • Tissue-specific promoters that can be used in driving expression of GPl 15 in animal models include, without limitation: a tyrosinase promoter or a TRP2 promoter in the case of melanoma cells and melanocytes; an MMTV or WAP promoter in the case of breast cells and/or cancers; a Villin or FABP promoter in the case of intestinal cells and/or cancers; a RTP promoter in the case of pancreatic beta cells; a Keratin promoter in the case of keratinocytes; a Probasin promoter in the case of prostatic epithelium; a Nestin or GFAP promoter in the case of CNS cells and/or cancers; a Tyrosine Hydroxylase, SI 00 promoter or neurofilament promoter in the case of neurons; the pancreas-specific promoter described in Edlund et al.
  • Expression vectors can also be designed to fuse proteins encoded by the heterologous nucleic acid insert to polypeptides larger than purification and/or identification tags.
  • Useful protein fusions include those that permit display of the encoded protein on the surface of a phage or cell, fusions to intrinsically fluorescent proteins, such as luciferase or those that have a green fluorescent protein (GFP)-like chromophore, and fusions for use in two hybrid selection systems.
  • GFP green fluorescent protein
  • Vectors designed for phage display, yeast display, and mammalian display for example, target recombinant proteins using an N-terminal cell surface targeting signal and a C-te ⁇ ninal transmembrane anchoring domain.
  • a wide variety of vectors now exist that fuse proteins encoded by heterologous nucleic acids to the chromophore of the substrate-independent, intrinsically fluorescent green fluorescent protein from Aequorea victoria ("GFP") and its many color-shifted and/or stabilized variants.
  • GFP Aequorea victoria
  • Stable expression is readily achieved by integration into the host cell genome of vectors (preferably having selectable markers), followed by selection for integrants.
  • the present invention relates to GPl 15 proteins and various GP 115 fragments suitable for use as, e.g., as antigens, as biomarkers for diseases, and in therapeutic compositions.
  • the invention also relates to fusions of GPl 15 polypeptides to heterologous polypeptides or other moieties.
  • A. GPl 15 Polypeptides of Particular Sequences The invention relates to an isolated GPl 15 polypeptide (SEQ ID NO: 1), optionally containing one or more conservative amino acid substitutions.
  • the invention also relates to fragments of the GPl 15 polypeptide, particularly fragments having at least 5, 6, 8, or 15 amino acids of SEQ LD NO: 1.
  • the GPl 15 fragments of the invention may be continuous portions of the native GPl 15 protein. However, it will be appreciated that knowledge of the GPl 15 gene and protein sequences permits recombining of various domains that are not contiguous in the native GPl 15 protein.
  • This invention also relates to fusions of GPl 15 polypeptides to heterologous polypeptides. As used herein, "fusion" means that the GPl 15 polypeptide is linearly contiguous to the heterologous polypeptide in a peptide- bonded polymer of amino acids or amino acid analogues.
  • heterologous polypeptide means a polypeptide that does not naturally occur in contiguity with the GPl 15 fusion partner.
  • the fusion polypeptide can consist entirely of a plurality of fragments of the GP 115 protein in altered arrangement, such a case, any of the GPl 15 fragments can be considered heterologous to the other GPl 15 fragments in the fusion protein.
  • the heterologous polypeptide included within the fusion protein is at least 6 amino acids in length, often at least 8 amino acids in length, and preferably, at least 15, 20, and 25 amino acids in length.
  • the heterologous sequences can target the GPl 15 polypeptide to a selected cell by binding to a cell surface receptor, prolong the serum life of the GPl 15 polypeptide (e.g., an IgG Fc region), make the GPl 15 polypeptide detectable (e.g., a luciferase or a green fluorescent protein), facilitate purification (e.g., His tag, FLAG, etc.), facilitate secretion of recombinantly expressed proteins (e.g., into the periplasmic space or extracellular milieu for prokaryotic hosts, into the culture medium for eukaryotic cells, through incorporation of secretion signals and/or leader sequences).
  • a cell surface receptor e.g., an IgG Fc region
  • the GPl 15 polypeptide detectable e.g., a luciferase or a green fluorescent protein
  • facilitate purification e.g., His tag, FLAG, etc.
  • secretion signals and/or leader sequences
  • GPl 15 proteins and protein fragments also can be fused to protein toxins, such as Pseudomonas exotoxin A, diphtheria toxin, shiga toxin A, anthrax toxin lethal factor, ricin, or other toxic moieties in order to effect specific ablation of cells that bind or take up the proteins.
  • protein toxins such as Pseudomonas exotoxin A, diphtheria toxin, shiga toxin A, anthrax toxin lethal factor, ricin, or other toxic moieties in order to effect specific ablation of cells that bind or take up the proteins.
  • the polypeptides can be composed of natural amino acids linked by native peptide bonds, or can contain any or all of nonnatural amino acid analogues, nonnative bonds, and post-synthetic (post-translational) modifications, either throughout the length of the polypeptide or localized to one or more portions thereof.
  • nonnatural amino acid analogues nonnative bonds
  • post-synthetic (post-translational) modifications either throughout the length of the polypeptide or localized to one or more portions thereof.
  • the range of such nonnatural analogues, nonnative inter-residue bonds, or post-synthesis modifications will be limited to those that do not interfere with the biological function of the polypeptide. Techniques for incorporating non-natural amino acids during solid phase chemical synthesis or by recombinant methods are well established in the art.
  • D-enantiomers of natural amino acids can readily be incorporated during chemical peptide synthesis: peptides assembled from D-amino acids are more resistant to proteolytic attack; incorporation of D-enantiomers can also be used to confer specific three dimensional conformations on the peptide.
  • Other amino acid analogues commonly added during chemical synthesis include ornithine, norleucine, phosphorylated amino acids (typically phosphoserine, phosphothreonine, phosphotyrosine), L-malonyltyrosine, a non-hydrolyzable analog of phosphotyrosine (Kole et al., Biochem. Biophys. Res. Com.
  • the isolated GPl 15 polypeptides can also include non-native inter- residue bonds, including bonds that lead to circular and branched forms.
  • the isolated GPl 15 polypeptides can also include post-translational and post-synthetic modifications, either throughout the length of the protein or localized to one or more portions thereof.
  • the isolated polypeptide when produced by recombinant expression in eukaryotic cells, can include N-linked and/or O-linked glycosylation, the pattern of which will reflect both the availability of glycosylation sites on the protein sequence and the identity of the host cell. Further modification of glycosylation pattern can be performed enzymatically.
  • recombinant polypeptides of the invention may also include an initial modified methionine residue, in some cases resulting from host-mediated processes.
  • Ammo acid analogues having detectable labels are also usefully incorporated during synthesis to provide a labeled polypeptide (e.g., biotin, various chromophores, or fluorophores).
  • the GPl 15 polypeptides of this invention can also usefully be conjugated to polyethylene glycol (PEG). PEGylation increases the serum half life of proteins administered intravenously for replacement therapy.
  • PEG polyethylene glycol
  • Producing cells include, without limitation, recombinant cells overexpressing the polypeptides, naturally occurring cells (e.g., cancer cells) overxpression the polypeptides, or established cancer cell lines overexpressing the polypeptides.
  • purification tags have been fused through use of an expression vector that appends such tags, purification can be effected, at least in part, by means appropriate to the tags, such as use of immobilized metal affinity chromatography for polyhistidine tags.
  • Other techniques common in the art include ammonium sulfate fractionation, immuno-precipitation, fast protein liquid chromatography (FPLC), high performance liquid chromatography (HPLC), and preparative gel electrophoresis.
  • the isolated GPl 15 proteins may be in pure or substantially pure form.
  • a purified protein is an isolated protein that is present at a concentration of at least 95%, as measured on a mass basis (w/w) with respect to total protein in a composition. Such purities can often be obtained during chemical synthesis without further purification, as, e.g., by HPLC.
  • Purified proteins can be present at a concentration (measured on a mass basis with respect to total protein in a composition) of 96%, 97%, 98%, and even 99%.
  • the proteins of the present invention can even be present at levels of 99.5%, 99.6%, and even 99.7%, 99.8%, or even 99.9% following purification. Although high levels of purity are preferred when the isolated proteins are used as therapeutic agents, the isolated proteins are also useful at lower purity.
  • partially purified proteins can be used as immunogens to raise antibodies in laboratory animals.
  • the isolated proteins are generally used in substantially purified form.
  • substantially purified protein means a protein present at a concentration of at least 70%, measured on a mass basis with respect to total protein in a composition.
  • the substantially purified protein is present at a concentration, measured on a mass basis with respect to total protein in a composition, of at least 75%, 80%, or even at least 85%, 90%, 91%, 92%, 93%, 94%, 94.5% or even at least 94.9%.
  • the purified and substantially purified proteins are in compositions that lack detectable ampholytes, acrylamide monomers, bis-acrylamide monomers, and polyacrylamide.
  • GPl 15 Polypeptides 1.
  • Therapeutic Use Certain fragments of at least 8, 9, 10 or 12 contiguous amino acids are also useful as competitive inhibitors of binding of the entire protein, or a portion thereof, to its ligand.
  • fragments can be used as anti-cancer agents to reduce the activity of GPl 15.
  • Epitope Mapping Fragments of at least six contiguous amino acids are useful in mapping B cell and T cell epitopes of the reference protein. See, e.g., Geysen et al., "Use of peptide synthesis to probe viral antigens for epitopes to a resolution of a single amino acid," Proc. Natl. Acad. Sci. USA 81:3998-4002 (1984) and U.S. Pat. Nos. 4,708,871 and 5,595,915.
  • the fragment need not itself be immunogenic, part of an immunodominant epitope, nor even recognized by native antibody, to be useful in such epitope mapping, all fragments of at least six amino acids of the proteins of the present invention have utility in such a study. 3. Immunogens Fragments of at least eight contiguous amino acids, often at least fifteen contiguous amino acids, have utility as immunogens for raising antibodies that recognize GPl 15 proteins or as vaccines for GPl 15-mediated diseases such as cancers.
  • the GPl 15 proteins, fragments, and fusions of the present invention can usefully be attached to a substrate. When bound to a substrate, the polypeptides can be used to detect and quantify antibodies, e.g., in serum, that bind specifically to the immobilized protein.
  • the invention relates to antibodies that bind specifically to the GPl 15 polypeptides.
  • the antibodies can be specific for linear epitopes, discontinuous epitopes, or conformational epitopes of such polypeptides, either as present on the polypeptide in its native conformation or as present on the polypeptides when denatured, e.g., by solubilization in SDS.
  • the antibodies both polyclonal and monoclonal, bind specifically to a polypeptide having an amino acid sequence presented in SEQ ID NO: 1.
  • antibody means a full antibody, e.g., an antibody comprising two heavy chains and two light chains, or to an antigen-binding fragment of a full antibody.
  • fragments include, but are not limited to, those produced by digestion with various proteases, those produced by chemical cleavage and/or chemical dissociation, and those produced recombinantly, so long as the fragment remains capable of specific binding to an antigen.
  • fragments include Fab, Fab', F(ab') 2 and single chain Fv (scFv) fragments.
  • An antibody can be a murine or hamster antibody or a homolog thereof, or a fully human antibody.
  • An antibody also can be a humanized antibody, a chimeric antibody, an antibody fusion, an diabody, an intrabody, or a single-chained antibody.
  • An antibody can be of any isotype and subtype, for example, IgA (e.g., IgAl and IgA2), IgG (e.g., IgGl, IgG2, IgG3 and IgG4), IgE, IgD, IgM, wherein the light chains of the immunoglobulin may be of type kappa or lambda. While the useful antibodies are generally monoclonal, polyclonal antibodies from mice, rabbits, turkeys, or sheep may also be used.
  • the affinity or avidity of an antibody will be at least about 1 x 10 "6 molar (M), typically at least about 5 x 10 "7 M, usefully at least about 1 x 10 "7 M, with affinities and avidities of at least 1 x 10 "8 M, 5 x 10 "9 M, and 1 x 10 "10 M proving especially useful.
  • the antibodies are useful in a variety of in vitro immunoassays, such as Western blotting and ELISA, in isolating and purifying GPl 15 proteins (e.g., by immunoprecipitation, immunoaffmity chromatography, or magnetic bead- mediated purification).
  • the antibodies are also useful as modulators (i.e., antagonists or agonists) of a GPl 15 protein in vivo to modulate the protein's interaction with its natural ligand.
  • the antibodies can also be used to conjugate to cytotoxic reagents for site-specific delivery.
  • the new antibodies can be variously associated with moieties appropriate for their uses.
  • the moieties can be an enzyme that catalyzes production and local deposition of a detectable product.
  • exemplary enzymes are alkaline phosphatase, 3-galactosidase, glucose oxidase, horseradish peroxidase (HRP), and urease.
  • the antibodies also can be labeled using colloidal gold.
  • the antibodies are used for flow cytometric detection and scanning laser cytometric detection, they can be labeled with fluorophores.
  • the antibodies of the present invention can usefully be labeled with biotin.
  • the antibodies of the present invention When the antibodies of the present invention are used, e.g., for western blotting, they can usefully be labeled with radioisotopes. When the antibodies are to be used for in vivo diagnoses, they can be rendered detectable by conjugation to MRI contrast agents, such as radioisotopic labeling or gadolinium diethylenetriaminepentaacetic acid (DTP A).
  • MRI contrast agents such as radioisotopic labeling or gadolinium diethylenetriaminepentaacetic acid (DTP A).
  • DTP A gadolinium diethylenetriaminepentaacetic acid
  • the antibodies also can be conjugated to toxic agents so as to direct the agents to a tumor site.
  • the antibody is conjugated to Pseudomonas exotoxin A, diphtheria toxin, shiga toxin A, anthrax toxin lethal factor, or ricin.
  • the antibodies can be bound to a substrate via a linker moiety.
  • the antibodies can be conjugated to filtration media, such as NHS-activated Sepharose or CNBr-activated Sepharose for immunoaffinity chromatography.
  • the antibodies also can be attached to paramagnetic microspheres, by, e.g., biotin-streptavidin interaction. The microsphere then can be used for isolation of cells that express or display the above-described proteins.
  • the antibodies also can be attached to the surface of a microtiter plate for ELIS A.
  • GPl 15 is a suitable therapeutic target for treating neoplasia, hyperplasia, malignant cancers, or any other hyperproliferative conditions.
  • the GPl 15 gene can be a target in cancers of the skin, lung, prostate, breast, colorectal tissue, liver, pancreas, brain, testis, ovary, uterus, cervix, kidney, thyroid, bladder, esophagus, and blood.
  • the invention relates to pharmaceutical compositions comprising GPl 15 nucleic acids, proteins, and antibodies, as well as mimetics, agonists, antagonists, or modulators of GPl 15 activity, and methods of using them to prevent or treat (i.e., ameliorate, mitigate, alleviate, slow, or inhibit) tumor growth, angiogenesis, metastasis or any other inappropriate cell proliferation.
  • Such compositions also can be used to induce these conditions in an experimental animal, e.g., a mouse model of cancer.
  • Inhibitors of GPl 15 also can be administered in combination with one or more other therapeutic agents, for improved cancer treatment.
  • GPl 15 inhibitors suitable for co-administration with a GPl 15 inhibitor include, for example, an anti-angiogenic agent, an anti-metastatic agent, or an agent that creates a h poxic environment.
  • Chemotherapeutic agents that can be co- administered with inhibitors of GP 115 include folate antagonists, pyrimidine and purine antimetabolites, alkylating agents, platinum antitumor compounds, DNA interchelators, other agents that induce DNA damage, microtubule targeting products, small molecule inhibitors of protein kinases and biological inhibitors of growth factor receptors.
  • the GPl 15 inhibitor and additional therapeutic agent(s) may be used concurrently or sequentially.
  • the subject is pre-treated with one or more agents, followed by treatment with a GP 115 inhibitor.
  • a GP 115 inhibitor The ability of tumor cells to detach from the primary site and produce metastases in a distant organ is due to the survival and growth of a unique subpopulation of cells with metastatic properties. Tumor growth and metastasis are angiogenesis-dependent. Inhibition of angiogenesis will generate a hypoxic environment in the tumor, forcing tumor cells to become more dependent upon the glycolytic pathway for energy generation. Accordingly, preventing angiogenesis in combination with inhibiting GPl 15 is a promising therapeutic strategy.
  • Angiogenesis inhibitors e.g.
  • angiostatin, endostatin, avastin or Regeneron's VEGF trap technology can be used in combination with GPl 15 inhibitors as an effective anti-cancer therapy. Such a combination can be expected to have a synergistic effect. This may also allow the use of a lower dose of GP115 inhibitor or anti- angiogenic agent or both in chemotherapy. This is desirable because it is likely to cause less toxicity in patients, addition, the use of combinations of therapeutic agents may circumvent drug resistance problems.
  • GP 115 inhibitors can also be used in combination with agents that create a hypoxic environment to enhance the effect of GPl 15 inhibitor. Hypoxia, i.e., lack of oxygen, plays a fundamental role in many pathologic processes.
  • mammalian cells In response to hypoxia, mammalian cells activate and express multiple genes. Tumor cells may respond to hypoxia by diminishing their proliferative rates, thereby leaving the cells viable but nonproliferating. Some transformed cell lines can also undergo apoptosis in extreme hypoxia and an acidic environment. Similar to inhibitors of angiogenesis, other agents that induce a hypoxic environment may sensitize tumor cells to inhibition of GPl 15 and use of hypoxia inducing agents in combination with inhibiting GPl 15 is therefore another promising therapeutic strategy. An increase in apoptosis (programmed cell death) has been associated with a decrease in tumor proliferation.
  • Tumor necrosis factor-related apoptosis- inducing ligand induces apoptosis in several human tumors.
  • a number of cell regulatory pathways such as Rb/E2F pathway, the c-Myc transcription factor, and the Ras signaling molecule have also been shown to control not only cell proliferation but also pathways leading to apoptosis.
  • a combination of GPl 15 inhibitor with reagents that activate additional apoptotic signals, or inhibit survival signals can also be used for cancer therapy.
  • a composition of the invention typically contains from about 0.1 to
  • compositions for oral administration can contain suitable carriers or excipients, such as corn starch, gelatin, lactose, acacia, sucrose, microcrystalline cellulose, kaolin, mannitol, dicalcium phosphate, calcium carbonate, sodium chloride, or alginic acid.
  • suitable carriers or excipients such as corn starch, gelatin, lactose, acacia, sucrose, microcrystalline cellulose, kaolin, mannitol, dicalcium phosphate, calcium carbonate, sodium chloride, or alginic acid.
  • Disintegrators that can be used include, without limitation, microcrystalline cellulose, corn starch, sodium starch glycolate, and alginic acid.
  • Tablet binders that can be used include acacia, methylcellulose, sodium carboxymethylcellulose, polyvinylpyrrolidone(PovidoneTM), hydroxypropyl methylcellulose, sucrose, starch, and ethylcellulose.
  • Lubricants that can be used include magnesium stearates, stearic acid, silicone fluid, talc, waxes, oils, and colloidal silica.
  • Liquid formulations of the compositions for oral administration prepared in water or other aqueous vehicles can contain various suspending agents such as methylcellulose, alginates, tragacanth, pectin, kelgin, carrageenan, acacia, polyvinylpyrrolidone, and polyvinyl alcohol.
  • the liquid formulations can also include solutions, emulsions, syrups and elixirs containing, together with the active compound(s), wetting agents, sweeteners, and coloring and flavoring agents.
  • Various liquid and powder formulations can be prepared by conventional methods for inhalation into the lungs of the mammal to be treated.
  • Injectable formulations of the compositions can contain various carriers such as vegetable oils, dimethylacetamide, dimethylformamide, ethyl lactate, ethyl carbonate, isopropyl myristate, ethanol, polyols (glycerol, propylene glycol, liquid polyethylene glycol, and the like).
  • Physiologically acceptable excipients can include, for example, 5% dextrose, 0.9% saline, Ringer's solution or other suitable excipients.
  • Intramuscular preparations e.g., a sterile formulation of a suitable soluble salt form of the compounds, can be dissolved and administered in a pharmaceutical excipient such as Water-for-Injection, 0.9% saline, or 5% glucose solution.
  • a suitable insoluble form of the compound can be prepared and administered as a suspension in an aqueous base or a pharmaceutically acceptable oil base, such as an ester of a long chain fatty acid (e.g., ethyl oleate).
  • a topical semi-solid ointment formulation typically contains a concentration of the active ingredient from about 1 to 20%, e.g., 5 to 10%, in a carrier such as a pharmaceutical cream base.
  • a carrier such as a pharmaceutical cream base.
  • formulations for topical use include drops, tinctures, lotions, creams, solutions, and ointments containing the active ingredient and various supports and vehicles.
  • the optimal percentage of the therapeutic agent in each pharmaceutical formulation varies according to the formulation itself and the therapeutic effect desired in the specific pathologies and correlated therapeutic regimens.
  • the pharmaceutical formulation(s) can be administered to the patient by applying to the skin of the patient a transdermal patch containing the pharmaceutical formulation, and leaving the patch in contact with the patient's skin (generally for 1 to 5 hours per patch).
  • Other transdermal routes of administration e.g., through use of a topically applied cream, ointment, or the like
  • the pharmaceutical formulation(s) can also be administered via other conventional routes (e.g., parenteral, subcutaneous, intrapulmonary, transmucosal, intraperitoneal, intrauterine, sublingual, intrathecal, or intramuscular routes) by using standard methods.
  • the pharmaceutical formulations can be administered to the patient via injectable depot routes of administration such as by using 1-, 3-, or 6-month depot injectable or biodegradable materials and methods.
  • the therapeutic protein or antibody agent typically is administered at a daily dosage of 0.01 mg to 30 mg/kg of body weight of the patient (e.g., Img/kg to 5 mg/kg).
  • the pharmaceutical formulation can be administered in multiple doses per day, if desired, to achieve the total desired daily dose.
  • the effectiveness of the method of treatment can be assessed by monitoring the patient for known signs or symptoms of a disorder.
  • the pharmaceutical compositions of the invention may be included in a container, package or dispenser alone or as part of a kit with labels and instructions for administration. These compositions can also be used in combination with other cancer therapies involving, e.g., radiation, photosensitizing compounds, anti-neoplastic agents and immunotoxics.
  • This invention provides genetically modified nonhuman mammals at least some of whose somatic and germ cells contain one of the above-described GPl 15 -coding nucleic acids (including both heterozygotes and homozygotes). Such mammals can be used to study the effect of the GPl 15 gene on tumorigenicity and tumor development, to study the role of GP 115 on normal tissue development and differentiation, to identify via array CGH regions of the genome whose amplification or deletion is correlated with GPl 15 status, and to screen for and establish toxicity profiles of anti-cancer drags.
  • This invention also provides genetically modified nonhuman mammals with targeted disruption of one or both copies of the endogenous GPl 15 gene. Also included are chimeric mammals.
  • the inducible cancer model is a mouse whose genome has been modified to include: (a) an expression construct comprising a GPl 15 gene linked operably to an inducible promoter, and (b) a genetic mutation that causes said the mouse to have greater susceptibility to cancer than a mouse not comprising said genetic mutation. Expression of the GPl 15 gene leads to formation of cancer in the mouse. The cancer regresses when expression of the GPl 15 gene is reduced.
  • Mutations that render the mammalmore susceptible to cancer include disabling mutations in a tumor suppressor gene (e.g., DSfK4a), disabling mutations in a DNA repair gene (e.g., MSH2), and activating mutations in an oncogene (e.g., myc and ras).
  • a tumor suppressor gene e.g., DSfK4a
  • a DNA repair gene e.g., MSH2
  • activating mutations in an oncogene e.g., myc and ras.
  • an oncogene e.g., myc and ras
  • the mammal's genome comprises (i) a first expression construct containing a gene encoding a reverse tetracycline transactivator operably linked to a promoter, such as any tissue or cell type-specific promoter or any general promoter, and (ii) a second expression construct containing the GP 115 gene operably linked to a promoter that is regulated by the reverse tetracycline transactivator and tetracycline (or a tetracycline analogue, for example, doxycycline).
  • a promoter such as any tissue or cell type-specific promoter or any general promoter
  • This animal model can be used to determine the efficacy of a candidate compound in preventing or treating cancer.
  • This method involves administering to the mammal a candidate compound and observing the effect of the compound on tumor development, maintenance, angiogenesis and/or progression in the mammal. Regression and/or reduction of tumor size in the presence of the compound indicates effectiveness of the compound.
  • the effect of a candidate compound on the level of GPl 15 mRNA, protein, or activity in the mammal or cell lines derived from the mammal (or cell lines transfected with the gene) can be used to identify the candidate as an agonist or antagonist.
  • the ability to compare the effect of a test compound to that of genetically switching off the inducible oncogene in this system allows the identification of surrogate markers that are predictive of the clinical response to the compound.
  • the inducible model can be used to determine whether a compound can eradicate minimal residual tumor. Normally in the inducible model, a tumor regresses when the GPl 15 gene is switched from “on” to "off via the inducible promoter. But if a compound can eradicate minimal residual tumor, switching the gene back on after administration of the compound will not bring back the tumor.
  • the animal model also can be used to identify other cancer-related elements.
  • a detailed expression profile of gene expression in tumors undergoing regression or regrowth due to the inactivation or activation of the GPl 15 trans gene is established.
  • Techniques used to establish the profile include the use of suppression subtraction (in cell culture), differential display, proteomic analysis, serial analysis of gene expression (SAGE), and expression transcription profiling using cDNA and/or oligonucleotide microarrays. Then, comparisons of expression profiles at different stages of cancer development can be performed to identify genes whose expression patterns are altered. This animal model can also be used to identify molecular surrogates of GP 115 in another manner.
  • GP 115 gene is eliminated by null mutation, and another round of MaSS screening is performed using retroviral integration, cDNA complementation, or the genetic supressor elements (GSE) method. Genes whose activation results in transformation of the cells are likely to be in a tumorigenic pathway related to GP 115.
  • the animal model also can be used to identify surrogate biomarkers for diagnosis or for following disease progression in patients. The biomarkers can be identified based on the differences between the expression profiles of the "on" and "off states in the animal model. Blood or urine samples from the animal can be tested with ELISAs or other assays to determine which biomarkers are released from the tumor into circulation during tumor genesis, maintenance, or regression (when GPl 15 is turned off). These biomarkers are particularly useful clinically in following disease progression post anti-GP115 therapy.
  • GPl 15 activity is up-regulated in tumor cells, one can use GPl 15 as a marker in diagnosing cancer or any other abnormal hyperplasia conditions.
  • the above-described nucleic acid probes or antibodies are used to quantify the expression level of GP 115 in a tissue sample. An increase in that level relative to control indicates cancerous, neoplastic, or hyperplastic pathology of the tissue sample.
  • This type of test can be performed using conventional techniques such as RT-PCR, ribonuclease protection assays, in situ hybridization, Northern blot analysis, FISH, CGH, array CGH, SKY, and immunohistochemistry.
  • a GPl 15 protein or GPl 15 protein fragments may be found to be elevated in a tissue sample (e.g., blood or urine) of cancer patients relative to that of normal individuals. This elevation can be detected by, e.g., specific ELISAs, radioimmunoassays, or protein chip assays. Such tests may not only be useful for diagnosis of GP115-related diseases such as cancers, but also for monitoring the progress of therapy using GPl 15 inhibitors. VIII. EXAMPLES The invention is further illustrated by the following examples. These examples are provided for illustrative purposes only, and are not to be construed as limiting the scope or content of the invention in any way.
  • Example 1 MaSS Screening Identification of the Gene This example describes the procedures for identifying the GPl 15 gene by MaSS screening.
  • TMJ Tumor Cells
  • FBS FBS-free bovine serum
  • doxycycline-dependent, RAS-induced melanoma cells such as R545 cells were maintained in RPMI media with 10% fetal calf serum in the presence of doxycycline (2 ⁇ g/ml).
  • the R545 cells were infected with the filtered viral supernatant in the presence of polybrene (6-8 ⁇ g/ml). From this point on, the R545 cells were maintained in the absence of doxycycline. Eighteen hours after infection, infected R545 cells were trypsinized, rinsed and resuspended in Hanks' Balanced Salt Solution.
  • the digested samples were self-ligated in a diluted 600 ⁇ l reaction volume using 4000 U of high concentration T4 Ligase (NEB, Cat. # M0202M). The ligation was performed overnight to 24 hrs at 16°C. The ligated DNA was precipitated with ethanol and dissolved in 40 ⁇ l of sterile water. The ligated DNA was then serially diluted to 1 : 10 and 1:100 ratios and subj ected to inverted polymerase chain reaction (IPCR).
  • IPCR inverted polymerase chain reaction
  • the PCR reaction mix had a total volume of 50 ⁇ l and contained l ⁇ l of the ligated DNA, 25 nmol of each dNTP, 10 pmol each of the forward and reverse primers, 1 X Buffer 2, and 2.5 U of Enzyme Mix in the EXPAND Long Template PCR System (Roche).
  • Amplification was performed as follows: 92°C for 2 min, then 10 cycles of (92°C for 10 sec, 63° for 30 sec, 68°C for 15 min), then 20 cycles of (92°C for 10 sec, 63°C for 30 sec, 68°C for 15 min, and a 20 sec auto extension), and a final extension step at 68°C for 30 min (TETRAD Thermocycler, MJ Research).
  • the primer sets used in IPCR were: S5' IF: GAGGCCACCTCCACTTCTGAGAT (SEQ LO NO: 10); S5'1R: CTCTGTCGCCATCTCCGTCAGA (SEQ LD NO: 11); S5'2F: CAUCAUCAUCAUCCTGCCCCCTCTCCCATAGTGT (SEQ LD NO: 12); S5'2R: CUACUACUACUAGGCGTTACTGCAGTTAGCTGGCT (SEQ ID NO: 13); S3 'IF: GGCTGCCATGCACGATGACCTT (SEQ LD NO: 14); S3'1R: CGGCCAGTACTGCAACTGACCAT (SEQ ID NO: 15); S3'2F: CUACUACUACUAGGGAGGGTCTCCTCAGAGTGATT (SEQ lD NO: 16); S3 '2R: CAUCAUCAUCAUGGAAAGCCCGAGAGGTGGT (SEQ ID NO: 10); S5'1R: CTCTGTCGCCAT
  • B3'1R CGGGAAGGTGGTCGTCGGTCT (SEQ ID NO: 18); and B3'2R: CAUCAUCAUCAUGGGGCCCCGAGTCTGTAATTT (SEQ ID NO: 19).
  • BamHI 5 ' cloning primary PCR was done by using S5 ' IF and
  • NCBI Map View was used to identify the site of each recurrent retroviral integration onto the mouse genome. Genes immediately neighboring the site were identified by using the MGSCV3 Gene map. These genes were defined as candidate cancer-related genes because in the vast majority of cases, MuLV integration affects the most proximal genes. When the integration occurred within a gene, that gene was deemed the best candidate as the target for the effects of retroviral integration.
  • Example 2 Expression in Human Tumors and Tumor Cell Lines This example describes the protocols for expressing the candidate gene identified above in human cancer cells. Primer pairs for each human gene were designed as described for the mouse gene. Expression of each candidate gene was assessed in a panel of 31 human cancer cell lines and 47 human primary tumors by using real-time reverse transcription PCR. The forward and reverse primers were 5'-ggcagcttcctattggtctc- 3' (SEQ ID NO: 20) and 5'-caacgtagagccgaagttca-3' (SEQ ID NO: 21), respectively. RNA was prepared from the cells using QIAGEN RNEASY mini- prep kits and QIAGEN RNEASY maxi-prep columns.
  • RNA preparations were treated with DNase during column purification according to manufacturer's instructions. Expression of each gene was determined in triplicate for all tumors and cell lines using SYBR green-based real-time PCR. To do this, 2X SYBR green PCR master mix (ABI) was mixed with the MULTISCRJBE reverse transcriptase (ABI) and RNase inhibitor (ABI). Forward and reverse primers were added at ratios previously optimized for each gene using control human reference RNA (Stratagene). 50 ng of RNA template was used per reaction, and the reactions were performed in a total volume of 20 ⁇ l. Real-time quantification was performed using the ABI 7900HT and SDS2.0 software. RNA loading was normalized for ⁇ -actin and 18S rR A. RNA quantity was determined relative to human universal reference RNA (Stratagene) to permit ran-to-run comparisons.
  • RNAi RNA interference
  • a. Generation of siRNA Short interfering double stranded RNA molecules were designed and chemically synthesized to inhibit expression of endogenous GPl 15 in cultured human cancer cell lines. HPLC-purified siRNA oligonucleotides were stored at - 20°C prior to use.
  • Human cancer cell lines were transfected with siRNA using the Oligofectamine reagent from Invitrogen according to manufacturer's instructions. Twenty- four hours after transfection cells were trypsinzed, counted and reseeded for growth curve analysis or growth in soft agar. At the same time cell were collected, and RNA extracted for analysis of gene expression levels. c. Growth Curves To create growth curves, early passage cell lines were seeded in 12-well plates, at a population density of 2 x 10 4 cells per well.
  • the bottom agar was made of 0.7% agarose (SeaKem GTG agarose) and IX DME plus 10% fetal bovine serum. The next day, cells were seeded into each well by adding 1.5 ml of a mixture containing 3 X 10 3 cells in 0.32%) agarose and 1 X DME plus 10% FBS. The cell mixture was allowed to solidify at room temperature for 30 min. The plates were then incubated at 37°C in a 5%> CO 2 atmosphere for 1 to 14 days. Colony formation was analyzed, counted and photographs were taken at various time points. e. Sequence of siRNAs for Target Genes The sense sequence of three independent siRNAs that inhibit expression of GPl 15 are shone below.
  • Short hairpin RNA The following DNA sequences were used to encode short hairpins RNAs that act through RNA interference mechanisms to knockdown expression of GPl 15.
  • the sense and antisense sequences are joined by a loop of sequence gcttcctgtcac and are terminated with the following termination sequence containin an EcoRI restriction site: tttttgaattcc.
  • These sequences are combined and expressed under the control of a regulatable U6 promoter to encode the short-hairpin RNA that knocks down or silences expression of the specific target gene.
  • Stable cell lines were generated that express a tetracycline regulated transactivator and a U6 promoter under the control of the tetracycline response element driving expression of the shRNA. Addition of tetracycline or doxycycline to the cells in vivo or in vitro promotes expression of the shRNA and knock-down of expression of the GPl 15 gene.
  • Example 4 MEF Transformation This example describes a protocol for using the candidate gene to transform mouse embryonic fibroblasts.
  • MEFs are isolated from 100 individual 13.5-day-old embryos. The isolated MEFs are pooled and grown in DMEM supplemented with 10% FBS, penicillin and streptomycin. Pooled early-passage (passages 4 to 6) pl6 Ink4a /pl9 Ar -/- mouse embryonic fibroblasts are transfected with (1) pKO-Myc; (2) pKO-Myc and pT24-RasV12; (3) pKO-Myc and GPl 15 cDNA; or (4) pKO-Myc, pT24- RasV12, and GPl 15 cDNA. All transfections are done in duplicate cultures (8 X 10 5 cells) using Lipofectamine Plus in Optimem (Gibco) without serum or antibiotics. Cultures are split 1:3 a day after transfection. Foci are counted on day 12.
  • RNAi on Human or Mouse model Cancer Cell Lines in SCIDs Human cancer cell lines expressing high levels of the candidate, or cell lines established from the inducible mouse cancer model described above, are transfected with a vector encoding a short hairpin RNA homologous to the candidate cancer-related gene. Expression of the RNA is placed under the control of an inducible U6 promoter. Stable cell lines are established. 5 X 10 5 cells are injected subcutaneously into the flank of 6 week old female inbred SCID mice. Tumor formation is observed visually. For cell lines derived from the inducible mouse model, tumor formation is induced by doxycycline. Expression of the RNAi is induced once tumors were visually identified.
  • mice are fed with doxycycline. Tumor regression is followed using calipers to measure the shrinking tumor diameter.
  • Example 6 Tumor Formation in SCIDs
  • Tumor cells derived from the tumor suppressor null (INK4/arf -/-) doxycycline-inducible oncogene mouse model are infected with retrovirus encoding the candidate gene under the control of an IPTG-inducible promoter. Stable cell lines are established. 10 6 cell are injected subcutaneously into the flank of 6 week old female inbred SCID mice. Mice are fed with doxycycline for 7-12 days. 24 hours prior to doxycycline withdrawal, mice are fed LPTG. IPTG feeding is maintained after withdrawal of doxycycline and tumor regression is monitored using calipers.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Biophysics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Biochemistry (AREA)
  • Gastroenterology & Hepatology (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Oncology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

L'invention concerne l'utilisation de molécules concernant le gène GP115 (C17orf26) pour traiter le cancer et d'autres états hyperprolifératifs. L'invention concerne également des mammifères non humains hébergeant une modification génétique concernant le gène GP115 et leur utilisation comme modèles expérimentaux du cancer.
PCT/US2004/027968 2003-08-27 2004-08-27 Gp115: methodes et compositions permettant de traiter le cancer WO2005021724A2 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US49839303P 2003-08-27 2003-08-27
US60/498,393 2003-08-27

Publications (2)

Publication Number Publication Date
WO2005021724A2 true WO2005021724A2 (fr) 2005-03-10
WO2005021724A3 WO2005021724A3 (fr) 2005-05-12

Family

ID=34272666

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2004/027968 WO2005021724A2 (fr) 2003-08-27 2004-08-27 Gp115: methodes et compositions permettant de traiter le cancer

Country Status (1)

Country Link
WO (1) WO2005021724A2 (fr)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN112394168A (zh) * 2019-08-15 2021-02-23 中山大学附属第六医院 IgA2检测试剂在制备KRAS突变型结直肠癌诊断剂方面的应用

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001012662A2 (fr) * 1999-08-17 2001-02-22 Incyte Genomics, Inc. Proteines associees a la membrane
WO2003039443A2 (fr) * 2001-11-05 2003-05-15 Deutsches Krebsforschungszentrum Nouveaux marqueurs genetiques pour leucemies

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001012662A2 (fr) * 1999-08-17 2001-02-22 Incyte Genomics, Inc. Proteines associees a la membrane
WO2003039443A2 (fr) * 2001-11-05 2003-05-15 Deutsches Krebsforschungszentrum Nouveaux marqueurs genetiques pour leucemies

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
BAGHERI-FAM STEFAN ET AL: "Comparative genomics of the SOX9 region in human and Fugu rubripes: Conservation of short regulatory sequence elements within large intergenic regions" GENOMICS, vol. 78, no. 1-2, November 2001 (2001-11), pages 73-82, XP002312982 ISSN: 0888-7543 *
FRASER A G ET AL: "Functional genomic analysis of C. Elegans chromosome I by systematic RNA interference" NATURE, MACMILLAN JOURNALS LTD. LONDON, GB, vol. 408, 16 November 2000 (2000-11-16), pages 325-330, XP002953443 ISSN: 0028-0836 *
MCMANUS M T ET AL: "Gene silencing in mammals by small interfering RNAs" NATURE REVIEWS GENETICS, MACMILLAN MAGAZINES, GB, vol. 3, October 2002 (2002-10), pages 737-747, XP002973403 *
WALHOUT ALBERTHA J M ET AL: "Integrating interactome, phenome, and transcriptome mapping data for the C. elegans germline." CURRENT BIOLOGY : CB. 19 NOV 2002, vol. 12, no. 22, 19 November 2002 (2002-11-19), pages 1952-1958, XP002312983 ISSN: 0960-9822 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN112394168A (zh) * 2019-08-15 2021-02-23 中山大学附属第六医院 IgA2检测试剂在制备KRAS突变型结直肠癌诊断剂方面的应用

Also Published As

Publication number Publication date
WO2005021724A3 (fr) 2005-05-12

Similar Documents

Publication Publication Date Title
JP6223822B2 (ja) 未分化リンパ腫キナーゼ（ａｌｋ）キナーゼ阻害剤に耐性である癌の診断および治療のための方法および組成物
CA2665489C (fr) Compositions associees a prrg4 et procedes d'utilisation de celles-ci dans des procedes de diagnostic de tumeur
Jardin et al. The BCL6 proto-oncogene: a leading role during germinal center development and lymphomagenesis
US20060134121A1 (en) DII4 antagonists, assays, and therapeutic methods thereof
JP2008535853A (ja) 癌関連遺伝子
AU2023203737A1 (en) Methods for diagnosing and treating metastatic cancer
US7273927B2 (en) Mdm2 splice variants
JPWO2005097204A1 (ja) 癌の予防・治療剤
KR100740974B1 (ko) Ｒｎａ 앱타머 및 그의 용도
WO2004050834A2 (fr) Gpc99 et gpc99a: compositions et methodes de traitement du cancer
WO2006023210A2 (fr) Gene gp132: techniques et compositions de traitement du cancer
US20070042980A1 (en) Gp131: methods and compositions for treating cancer
WO2005021724A2 (fr) Gp115: methodes et compositions permettant de traiter le cancer
WO2005063987A1 (fr) Gp153 : methodes et compositions de traitement du cancer
WO2014005153A9 (fr) Procédés pour le traitement d'un cancer médié par la protéine mds1-evi1
WO2004043408A2 (fr) Gpc15 : methodes et compositions pour le traitement du cancer
WO2006053125A2 (fr) Gp201: procedes et compositions de traitement du cancer
BRPI0616656A2 (pt) ativador de membrana conservada de calcineurina (cmac), uma proteìna terapêutica e alvo
WO2006053155A2 (fr) Gp202: procedes et compositions destines au traitement du cancer
EP2021471B1 (fr) Procédé de criblage
JPWO2005061704A1 (ja) 癌の予防・治療剤
WO2004012817A2 (fr) Utilisation des genes identifies comme etant impliques dans la croissance tumorale, destinee au developpement de medicaments anticancereux
Huning Transcriptional Activation of Eukaryotic Promoters via Zinc Finger Protein 143
Guimaraes-Young Gynecological tissue homeostasis and tumorigenesis studies using mouse models
WO2004046356A1 (fr) Exon 1$g(b) du gene $g(a) du recepteur du pdgf et son utilisation

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NA NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GM KE LS MW MZ NA SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LU MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
122 Ep: pct application non-entry in european phase